Method for efficiently editing and creating black-spot-free golden yellow grass carp based on tyrb gene and application

Abstract

The invention discloses a method for efficiently editing and creating black-spot-free golden yellow grass carp based on tyrb gene and application, comprising target gene selection and target design: selecting the tyrb gene of grass carp as a target gene, adopting CRISPR / Cas9 editing technology and designing sgRNA required by a CRISPR / Cas9 system, the method comprises the following steps: setting three target spots, synthesizing gRNAs, combining Cas9 protein and the three gRNAs, injecting the combined Cas9 protein and the three gRNAs into fertilized eggs of grass carps, placing the fertilized eggs in water for flowing incubation, and the like, and also comprises the application of the method in creation of black-spot-free golden yellow grass carp varieties. According to the method, the problems of impure color, black spots and black eyes of the current golden grass carp breeding variety are solved, efficient gene mutation is performed on the tyrb gene by adopting a CRISPR / Cas9 multi-target editing technology, pure golden grass carp germplasm without black spot residue and with red eyes can be quickly and efficiently obtained, and in addition, the obtained golden grass carp new variety is fertile and good in growth performance, and has good application prospects. The economic value of commercial fish is obviously improved; the method can be widely popularized and applied in farms.

Description

Technical Field

[0001] The invention relates to the technical field of fish molecular design breeding, and in particular to a method and application of creating golden grass carp without black spots based on efficient editing of tyrb genes. Background Art

[0002] Grass carp (Ctenopharyngodon idella), as one of the four major carps in my country, has extensive economic value and market demand. With the continuous improvement of people's living standards, people's requirements for the ornamental value of fish are also increasing, especially the demand for grass carp varieties with bright colors and beautiful appearance has increased significantly. Among them, golden grass carp (hereinafter referred to as "golden grass") is very popular because of its gorgeous color. However, the existing golden grass on the market, such as Russian golden grass, still has shortcomings such as black spots on the body and black eyes. The specific appearance is as follows: Figure 1 As shown. In addition, the golden grass carp or red-eyed golden carp sold on the market are mainly produced through traditional methods such as selective breeding and cross breeding. These methods can achieve the target traits to a certain extent, but there are still problems such as insufficient stability and impure body color.

[0003] Although the existing golden grass carp has certain ornamental value in terms of body shape and color, black spots still remain on its body, especially on its head, and its eyes are black, and the overall color is not bright enough. These shortcomings not only affect the ornamental effect of golden grass, but also limit its application and promotion in the high-end market. Therefore, there is an urgent need for a method for creating a new golden grass carp variety that can solve the shortcomings of the existing golden grass, such as impure color, black spots and black eyes. Summary of the invention

[0004] The technical problem to be solved by the present invention is that the current varieties bred with golden grass are impure in color and have black spots and black eyes. The purpose is to provide a method and application for creating golden grass carp without black spots based on efficient editing of the tyrb gene, thereby solving the problem that the current varieties bred with golden grass are impure in color and have black spots and black eyes.

[0005] The present invention is achieved through the following technical solutions:

[0006] One aspect of the present invention provides a method for creating golden grass carp without black spots based on efficient editing of the tyrb gene, comprising the following steps:

[0007] S1, target gene selection and target site design: grass carp tyrb gene was selected as the target gene, the sequence of tyrb gene is shown in SEQ ID NO: 1, CRISPR / Cas9 editing technology was used and sgRNA required by CRISPR / Cas9 system was designed, and there were three target sites, namely sgRNA1, sgRNA2 and sgRNA3;

[0008] S2, gRNA synthesis: including primer synthesis, template preparation, in vitro transcription and purification recovery process, and finally synthesizing gRNA1, gRNA2 and gRNA3;

[0009] S3, microinjection and fertilized egg hatching: Cas9 protein, gRNA1, gRNA2 and gRNA3 are combined and injected into grass carp fertilized eggs; the microinjected fertilized eggs are placed in aerated water for flow hatching until the embryos hatch and swim flat;

[0010] S4, screening and identification of golden grass carp: hatch and culture the injected embryos, and after the gene-edited individuals develop to a certain stage, conduct statistical analysis of mutation efficiency and phenotypic analysis on the mutant individuals to screen out new grass carp germplasm that is pure golden in color, without black spots and with red eyes.

[0011] As one of the preferred technical solutions, in step S1, the target sequence of sgRNA1 is shown as SEQ ID NO: 2, the target sequence of sgRNA2 is shown as SEQ ID NO: 3, and the target sequence of sgRNA3 is shown as SEQ ID NO: 4.

[0012] As one of the preferred technical solutions, the primer synthesis in step S2 uses a forward primer and a reverse primer, wherein the forward primer includes a T7 promoter, a target and a gRNA backbone sequence, the reverse primer sequence is an R primer, and the gRNA plasmid is used as a DNA template to amplify the gRNA transcription template, and in vitro transcription and purification and recovery are performed to finally obtain gRNA.

[0013] As one of the preferred technical solutions, the gRNA synthesis system in step S2 is: 10X T7 Buffer, 2 μL; rNTP, 1 μL; T7 RNA polymerase, 2 μL; DNA template, 1000 ng; RNase inhibitor, 0.5 μL; enzyme-free water to a total volume of 20 μL.

[0014] As one of the preferred technical solutions, the volume ratio of the combined Cas9 protein, gRNA1, gRNA2 and gRNA3 prepared in step S3 is 1:10:10:10.

[0015] As one of the preferred technical solutions, the final concentration of Cas9 protein in step S3 is 100 ng / μL; the final concentrations of gRNA1, gRNA2 and gRNA3 are all 500 ng / μL.

[0016] As one of the preferred technical solutions, step S3 uses a microinjection instrument for injection, and the thin end of the injection capillary needle is inserted into the position of the animal pole.

[0017] As one of the preferred technical solutions, the grass carp fertilized eggs in step S3 develop to the I-cell stage.

[0018] Another aspect of the present invention provides an application of a method for efficiently editing the tyrb gene in creating a golden grass carp variety without black spots.

[0019] Furthermore, new grass carp varieties were obtained in the F0 generation.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0021] 1. The present invention adopts CRISPR / Cas9 multi-target editing technology to carry out efficient gene mutation on the tyrb gene, which can quickly and efficiently obtain grass carp varieties with no black spots, pure gold color and red eyes, effectively solving the problems of impure body color, black spots and black eyes in the existing golden grass, and realizing the improvement of grass carp color to meet the market demand for golden grass carp with high ornamental value.

[0022] 2. The new variety of golden grass carp obtained by the present invention is fertile and has good growth performance, which significantly improves the economic value of commercial fish and can be widely promoted and applied in breeding farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0024] Figure 1 This is the appearance diagram of the existing Russian golden grass;

[0025] Figure 2 The schematic diagram of the structure of the grass carp tyrb gene of the present invention, wherein A: schematic diagram of the exon structure of the grass carp tyrb gene; B: schematic diagram of the mutation target site of the grass carp tyrb gene;

[0026] Figure 3 This is a statistical diagram of the mutation efficiency of different combinations of gRNA for the grass carp tyrb gene of the present invention;

[0027] Figure 4 This is the phenotypic statistics and appearance diagram of the grass carp tyrb gene mutation. DETAILED DESCRIPTION

[0028] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0029] Embodiment 1 creates the method for producing the golden grass carp variety without black spots

[0030] The existing golden grass on the market, such as Russian golden grass, still has some shortcomings such as black spots on the body and black eyes. Figure 1 Based on this, this embodiment proposes a method for creating golden grass carp without black spots based on efficient editing of the tyrb gene. It includes the following steps:

[0031] Target gene selection and target site design:

[0032] The target gene is the grass carp tyrosinase encoding gene tyrb, with gene ID: LOC127496052. Studies on tilapia and others have shown that tyrb plays a key role in pigment metabolism, so it was selected as the target gene.

[0033] CRISPR / Cas9 multi-target editing technology was used, and the sgRNA required for the CRISPR / Cas9 system was designed. There were three targets, namely sgRNA1, sgRNA2 and sgRNA3, so that the mutant tyrb gene could be accurately targeted.

[0034] CRISPR / Cas9 gene editing breeding has the advantages of strong targeting and short breeding cycle. The present invention uses CRISPR / Cas9 gene editing technology for the first time to accurately target the mutation of the tyrb gene in grass carp and designs three target points, so as to quickly and efficiently obtain grass carp varieties with no black spots, pure gold color and red eyes. New grass carp varieties are obtained in the F0 generation, which significantly improves the economic value of commercial fish and can be widely promoted and applied in farms.

[0035] The specific process of target design is as follows: isolate the complete gene sequence of the target gene tyrb from the published XX female grass carp genome (https: / / www.ncbi.nlm.nih.gov / assembly / GCA_004786185.1), download the annotated open reading frame sequence of the grass carp target gene from the NCBI website, distinguish exons and introns, and identify the start codon and stop codon. Paste the exon sequence into the website CHOPCHOP (http: / / chopchop.cbu.uib.no) to design a target sequence with a length of 17-21 bases, starting with G or GG at the 5′ end, and ending with NGG after the target sequence. When designing the target, there is an available restriction site near the PAM sequence NGG, which is convenient for detecting the mutation efficiency of the target by restriction digestion in the later stage. Design 3 mutation targets, and the target designs are all at the position of the first exon (such as Figure 2 A), Figure 2 In A, #1 represents sgRNA1, #2 represents sgRNA2, and #3 represents sgRNA3.

[0036] The target sequence of sgRNA1 is shown in SEQ ID NO: 2, the target sequence of sgRNA2 is shown in SEQ ID NO: 3, and the target sequence of sgRNA3 is shown in SEQ ID NO: 4 (as shown in Figure 2 B).

[0037] Synthesis of sgRNA:

[0038] The process includes four steps: primer synthesis, template preparation, in vitro transcription, and purification and recovery. sgRNA was synthesized by in vitro transcription using T7 as the promoter. The forward primer sequence includes the T7 promoter, target sequence, and gRNA backbone sequence. The R primer is the universal sequence AGCACCGACTCGGTGCCAC. The gRNA backbone plasmid was used as a template for PCR amplification and gel excision to recover the target fragment, which is about 110bp in length. The sequence of the gRNA backbone plasmid is

[0039] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT. Finally, add enzyme-free water to dissolve, and Nanodrop 2000 detects the concentration. The template concentration is greater than 200ng / μL. T7 RNA polymerase (Invitrogen, AM1344) was used to transcribe gRNA in vitro, and finally, sodium acetate and anhydrous ethanol were used to precipitate RNA and purify and recover it. The quality of gRNA1, gRNA2, and gRNA3 was determined by concentration determination and electrophoresis detection.

[0040] The gRNA synthesis system and steps are as follows: 10X T7 Buffer, 2μL; rNTP (NEB, N0466S), 1μL; T7 RNA polymerase, 2μL; DNA template, 1000ng; RNase inhibitor (NEB, M0314S), 0.5μL; enzyme-free water to a total volume of 20μL. Incubate at 37℃ for 3 hours, then add DNase I (RNase free) (CW2090S, 10U / μL) and digest the template DNA at 37℃ for 15 minutes; add 50μL 100% anhydrous ethanol and 2μL of sodium acetate with a pH of 5.3 and a concentration of 3mol / L; vortex to mix, and freeze at -80℃ overnight. The next day, centrifuge at 12000rpm for 30 minutes at 4℃; discard the ethanol and use 70% ethanol. This process uses enzyme-free water, and then wash. Do not vortex during the washing process; centrifuge at 12000rpm for 15 minutes at 4℃, discard the 70% anhydrous ethanol, and dry at room temperature for 10 minutes; add 1μL of RNase inhibitor and 30μL of enzyme-free water, detect the concentration and OD value with Nanodrop 2000, and store at -80℃ for future use.

[0041] Microinjection and fertilized egg hatching: Prepare 1.5% agarose gel and pour it into a culture dish with a diameter of 10 cm. When it is almost solidified, place a mold with a 2 mm groove. Pull out the groove after solidification. Since grass carp fertilized eggs are floating eggs, arrange the fertilized eggs neatly in the groove, and then add a small amount of water to make them moist but not floating. Cas9 protein, gRNA1, gRNA2 and gRNA3 are combined and prepared. Cas9 protein was purchased from Thermo Fisher Scientific (Invitrogen TM , A36499), the final concentration of Cas9 protein was 100ng / μL; the final concentration of gRNA1, gRNA2 and gRNA3 were all 500ng / μL, and the mixed volume ratio was 1:10:10:10. They were injected into 1-cell grass carp fertilized eggs using a microinjector. Because of the need to produce efficient mutations, the fine end of the injection capillary needle should be inserted into the animal pole as much as possible. After that, the injected fertilized eggs were placed in aerated water for flow incubation until the embryos hatched and swam flat.

[0042] Screening and identification of golden grass carp: The injected embryos are hatched and cultured. After the gene-edited individuals develop to a certain stage, statistical analysis of mutation efficiency and phenotypic analysis are performed on the mutant individuals to screen out new grass carp germplasm that is pure gold in color, without black spots and with red eyes.

[0043] Example 2 Gene mutation efficiency detection

[0044] Embryos were collected 2 days after injection, and the embryos obtained in Example 1 were used as the experimental group, and normal embryos of the same period were used as the control group. The following 6 comparative groups were set up.

[0045] Comparative Example 1: The steps of Comparative Example 1 are basically the same as those of Example 1, except that: in step S3, gRNA2 and gRNA3 are not added, and Cas9 protein and gRNA1 are combined and prepared with a mixing volume ratio of 1:10, a final concentration of Cas9 protein of 100 ng / μL, and a final concentration of gRNA1 of 500 ng / μL, which are injected into 1-cell stage grass carp fertilized eggs using a microinjector.

[0046] Comparative Example 2: The steps of Comparative Example 1 are basically the same as those of Example 1, except that: in step S3, gRNA1 and gRNA3 are not added, and Cas9 protein and gRNA2 are combined and prepared with a mixing volume ratio of 1:10, a final concentration of Cas9 protein of 100 ng / μL, and a final concentration of gRNA2 of 500 ng / μL, which are injected into 1-cell stage grass carp fertilized eggs using a microinjector.

[0047] Comparative Example 3: The steps of Comparative Example 1 are basically the same as those of Example 1, except that: in step S3, gRNA1 and gRNA2 are not added, and Cas9 protein and gRNA3 are combined and prepared with a mixing volume ratio of 1:10, a final concentration of Cas9 protein of 100 ng / μL, and a final concentration of gRNA3 of 500 ng / μL, which are injected into 1-cell stage grass carp fertilized eggs using a microinjector.

[0048] Comparative Example 4: The steps of Comparative Example 1 are basically the same as those of Example 1, except that: in step S3, gRNA3 is not added, and Cas9 protein, gRNA1 and gRNA2 are combined and prepared in a mixing volume ratio of 1:10:10. The final concentration of Cas9 protein is 100 ng / μL, and the final concentrations of gRNA1 and gRNA2 are both 500 ng / μL, which are injected into 1-cell stage grass carp fertilized eggs using a microinjector.

[0049] Comparative Example 5: The steps of Comparative Example 1 are basically the same as those of Example 1, except that: in step S3, gRNA1 is not added, and Cas9 protein, gRNA2 and gRNA3 are combined and prepared in a mixing volume ratio of 1:10:10. The final concentration of Cas9 protein is 100 ng / μL, and the final concentrations of gRNA2 and gRNA3 are both 500 ng / μL, which are injected into 1-cell stage grass carp fertilized eggs using a microinjector.

[0050] Comparative Example 6: The steps of Comparative Example 1 are basically the same as those of Example 1, except that in step S3, gRNA2 is not added.

[0051] Cas9 protein, gRNA1 and gRNA3 were combined and prepared with a mixing volume ratio of 1:10:10. The final concentration of Cas9 protein was 100 ng / μL, and the final concentrations of gRNA1 and gRNA3 were both 500 ng / μL. They were injected into 1-cell stage grass carp fertilized eggs using a microinjector.

[0052] Ten embryos were taken from each comparative group, control group, and experimental group, and genomic DNA was extracted using the conventional phenol-chloroform method. Detection primers across the mutation target were designed to amplify DNA fragments by PCR. After purification and recovery of the target fragments, they were connected to the pMD-19T plasmid vector, transformed, and positive single clones were selected for sequencing. The number and proportion of mutant clones were counted.

[0053] The steps for extracting genomic DNA are as follows:

[0054] The genomic DNA was extracted by conventional phenol / chloroform method: the embryos collected 2 days after hatching were cut into pieces, 1 mL of STNE (NaCl: 100 mmol / L, pH 8.0; EDTA: 1 mmol / L, pH 8.0; Tris-HCl: 10 mmol / L, pH 8.0), 0.1 mL of 10% SDS and 10 μL of 20 mg / mL proteinase K were added and gently mixed, and the mixture was placed in a 55°C shaker (80 rpm) for overnight digestion; 600 μL of phenol / chloroform / isoamyl alcohol (volume ratio 25:24:1) mixture was added, gently mixed, centrifuged at 12000 rpm for 15 minutes, and the supernatant was recovered; the phenol / chloroform / isoamyl alcohol extraction process was repeated twice, and then the chloroform extraction was switched to, and the recovered supernatant was added with 1 / 10 volume of 3 mol / L NaAc and an equal volume of isopropanol were mixed and allowed to stand at 4°C for 2 hours. The mixture was centrifuged at 13,000 rpm at 4°C for 20 minutes and the supernatant was discarded. The mixture was washed once with 75% and 100% ethanol respectively. The mixture was dried naturally and dissolved in enzyme-free water. The DNA concentration and OD value were detected by Nanodrop 2000.

[0055] The PCR amplification system was as follows: 10×PCR Buffer, 2.5μL; dNTP Mixture (2.5mM), 0.5μL; Forward Primer (10μM), 0.5μL; Reverse Primer (10μM), 0.5μL; Genomic DNA, 1μL or 20ng; Taq enzyme, 0.25μL; Add water to 25μL. The PCR program was as follows: 95℃ pre-denaturation for 3min, 95℃ for 30s, 60℃ for 30s, 72℃ for 45s, 35 cycles; Finally, 72℃ extension for 10min, and storage at 4℃.

[0056] PCR product recovery: 1.5% agarose gel electrophoresis: 80mL 1×TAE buffer, 1.2g agarose powder, heat in a microwave oven to dissolve, add 1μL Goldview nucleic acid dye, shake well and pour into the gel plate, cool and solidify before use. Spotting: 25μL PCR product, 5μL DL 2000DNAMarker. Electrophoresis at 170V constant voltage in 1×TAE buffer for 20min, take pictures with a gel imaging system (Bio-Rad, USA), if there is a band, cut it with a blade and recover it using a gel recovery kit.

[0057] T7E1 enzyme digestion detection: Take 1μg of the recovered DNA fragment, add NEB buffer 2 (New England Biolabs), and prepare a 10μL system. The reaction procedure is as follows: the first stage, 95℃ reaction for 5min; the second stage, from 95℃ to 85℃, the rate of decrease is 2℃ / s; the third stage, from 85℃ to 25℃, the rate of decrease is 0.1℃ / s; store at 4℃. Then take out the PCR tube and add 10U of T7 Endonuclease I, and digest at 37℃ for 60 minutes. Detection was performed according to the above electrophoresis method. The specific results are as follows Figure 3 shown.

[0058] The embryos are then incubated and cultured, and after the gene-edited individuals develop to a certain stage, statistical analysis of mutation efficiency and phenotypic analysis are performed on the mutant individuals.

[0059] like Figure 3 As shown, the conclusions are as follows:

[0060] Combining the control group, experimental group and 6 comparative groups, the target gene of the control group did not have any mutation, T7 Endonuclease I could not cut the band, and the phenotype was all wild type; while the target gene of the experimental group and the 6 comparative groups mutated, and incompletely matched double-stranded DNA would be produced after denaturation and renaturation. T7 Endonuclease I would cut this part of DNA, thus producing two smaller bands.

[0061] The experimental group and the six control groups all had three phenotypes, namely wild type, golden chimera and pure golden mutant (such as Figure 4 In addition, the mutation rates of embryos injected with different targets were counted by enzyme digestion and subclone sequencing. The results showed that most of the embryos in groups 1-3 (one of the targets was injected) were still wild-type, with a low gene mutation rate. The gene mutation rate of groups 4-6 (two targets were injected in combination) increased, but most of them were still golden chimeras. The number of pure golden mutants in the experimental group (embryos injected with three targets at the same time) increased significantly.

[0062] Example 3 Screening of golden grass carp

[0063] In the F0 generation, a new grass carp variety is obtained, among which individuals with high tyrb mutation will have golden body color, red eyes and no black spots; while individuals with low mutation have mostly golden body color, but have black spots and black eyes. Grass carp individuals with high tyrb mutation are selected from them.

[0064] Finally, the present invention relates to the following sequence;

[0065] The nucleotide sequence of the tyrb gene, SEQ ID NO: 1, is:

[0066]

[0067] The target sequence of sgRNA1 is SEQ ID NO: 2:

[0068] GGTTACTTCGGCGCCAACTG.

[0069] The target sequence of sgRNA2 is SEQ ID NO: 3:

[0070] TGGCACCGAGTTTACCTGC.

[0071] The target sequence of sgRNA3 is SEQ ID NO: 4:

[0072] TACTGGGACTGGCGCGACGC.

[0073] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for creating golden grass carp without black spots based on efficient editing of tyrb gene, characterized in that: The steps include: S1, target gene selection and target site design: grass carp tyrb gene was selected as the target gene, the sequence of tyrb gene is shown in SEQ ID NO: 1, CRISPR / Cas9 editing technology was used and sgRNA required by CRISPR / Cas9 system was designed, and there were three target sites, namely sgRNA1, sgRNA2 and sgRNA3; S2, gRNA synthesis: including primer synthesis, template preparation, in vitro transcription and purification recovery process, and finally synthesizing gRNA1, gRNA2 and gRNA3; S3, microinjection and fertilized egg hatching: Cas9 protein, gRNA1, gRNA2 and gRNA3 are combined and injected into grass carp fertilized eggs; the microinjected fertilized eggs are placed in aerated water for flow hatching until the embryos hatch and swim flat; S4, screening and identification of golden grass carp: hatch and culture the injected embryos, and after the gene-edited individuals develop to a certain stage, conduct statistical analysis of mutation efficiency and phenotypic analysis on the mutant individuals to screen out new grass carp germplasm that is pure golden in color, without black spots and with red eyes.

2. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1, characterized in that: In step S1, the target sequence of sgRNA1 is shown in SEQ ID NO: 2, the target sequence of sgRNA2 is shown in SEQ ID NO: 3, and the target sequence of sgRNA3 is shown in SEQ ID NO:

4.

3. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1, characterized in that: In step S2, the primer synthesis uses a forward primer and a reverse primer, wherein the forward primer includes a T7 promoter, a target site, and a gRNA backbone sequence, and the reverse primer sequence is an R primer. The gRNA plasmid is used as a DNA template to amplify the gRNA transcription template, and in vitro transcription and purification and recovery are performed to finally obtain the gRNA.

4. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1, characterized in that: The gRNA synthesis system in step S2 is: 10X T7 Buffer, 2 μL; rNTP, 1 μL; T7 RNA polymerase, 2 μL; DNA template, 1000 ng; RNase inhibitor, 0.5 μL; enzyme-free water to a total volume of 20 μL.

5. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1, characterized in that: The volume ratio of the combined Cas9 protein, gRNA1, gRNA2 and gRNA3 prepared in step S3 is 1:10:10:

10.

6. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1 or 5, characterized in that: In step S3, the final concentration of Cas9 protein was 100 ng / μL; the final concentrations of gRNA1, gRNA2, and gRNA3 were all 500 ng / μL.

7. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1, characterized in that: In step S3, a microinjection instrument is used for injection, and the fine end of the injection capillary needle is inserted into the position of the animal pole.

8. The method for creating golden grass carp without black spots based on efficient editing of tyrb gene according to claim 1, characterized in that: The grass carp fertilized eggs in step S3 develop to the I-cell stage.

9. Use of the method according to any one of claims 1 to 8 in creating a golden grass carp variety without black spots.

10. The use according to claim 9, characterized in that: New grass carp varieties are obtained in the F0 generation.

Images