Molecular beacon probe for recombinase-mediated isothermal amplification detection technology, primer combination thereof, RAA method and application

Abstract

The invention belongs to the technical field of gene engineering, and discloses a molecular beacon probe for a recombinase-mediated isothermal amplification detection technology, a primer combination of the molecular beacon probe, an RAA method and application of the molecular beacon probe. The molecular beacon probe for the recombinase-mediated isothermal amplification detection technology sequentially comprises an N1 region for forming a stem part of a stem-loop structure, an M region for forming a loop part of the stem-loop structure, an N2 region for forming the stem part of the stem-loop structure and a single-chain region from the 5'end to the 3 'end, and has a fluorescent label. The primer combination with a paired common primer is used as a primer of an RAA kit, so that the detection efficiency can be remarkably improved, and the amplification specificity and sensitivity can be improved. The RAA method based on the molecular beacon probe can realize triple fluorescent quantitative detection, and pathogenic microorganisms and drug-resistant genes thereof can be detected at the same time. The method is suitable for normal-temperature amplification and detection of target genes.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene engineering, and relates to a molecular beacon probe for recombinase-mediated isothermal amplification detection technology, a primer combination thereof, a RAA method and an application thereof. Background Art

[0002] Recombinase-aided amplification (RAA) is a new isothermal amplification technology independently developed in my country in 2012. This technology can achieve rapid amplification of nucleic acids under constant temperature conditions by using recombinase, single-stranded binding protein and DNA polymerase. It is suitable for rapid diagnosis of target genes and has good prospects for promotion and application in the field of nucleic acid detection.

[0003] In conventional RAA technology, at least one pair of primers and one probe are required to amplify the target gene. The design of primers and probes is the main factor limiting the application effect of RAA technology. Among them, the probe is the key factor in the specificity of the RAA reaction. Incompatible probes will produce non-specific fluorescence, resulting in false positives or missed detections. The design of primer pairs is the key factor in determining the sensitivity of RAA reactions. Inappropriate primer pairs will seriously affect the sensitivity of the reaction and even lead to missed detection of positive samples. Therefore, targeted design of probes or primer pairs is an important research direction to improve the specificity and sensitivity of RAA technology.

[0004] For example, the Chinese invention patent application with publication number CN118995977A discloses a RAA primer pair and probe for detecting Mycoplasma hyopneumoniae, and the probe is modified with C3-spacer blocking to improve the specificity and sensitivity of RAA reaction for detecting Mycoplasma hyopneumoniae. However, on the one hand, this RAA technology still requires a pair of primers and a probe, a total of three nucleic acid sequences, which adds a burden to nucleic acid sequence synthesis, experimental operations, and reagent storage, and reduces detection efficiency; on the other hand, the design of the probe is only used for the detection of Mycoplasma hyopneumoniae, and it is impossible to confirm the effect on genes related to other pathogens. In particular, when multiple genes need to be detected at the same time or when there is a need to detect drug-resistant genes at the same time, this technology cannot be applied.

[0005] The simultaneous detection of drug-resistant genes and pathogen-related genes is an important problem to be solved in the field of animal husbandry and food safety. For example, Staphylococcus aureus (S. aureus) is the main pathogen of dairy cow mastitis. In dairy farming, a variety of aminoglycoside antibiotics (AAs) such as kanamycin and gentamicin are usually used to synergistically treat diseases such as dairy cow mastitis. If antibiotics enter the human body through the food chain and accumulate in the body, they will cause serious harm to human health. Different dairy farms have different drug resistance conditions due to different medication conditions. Therefore, establishing a rapid and accurate detection of Staphylococcus aureus isolates and their drug resistance in dairy farms is of great significance for the early diagnosis of dairy cow mastitis and the adjustment of medication regimens. At present, the detection of Staphylococcus aureus and drug-resistant genes still depends on the national food safety standard GB4789.10-2016 and drug sensitivity tests. There are problems such as a detection cycle of up to 4 days, high requirements for detection personnel and equipment, and it is not conducive to promotion at the grassroots and on-site. Summary of the invention

[0006] One object of the present invention is to provide a molecular beacon probe for recombinase-mediated isothermal amplification detection technology, a primer combination thereof and a recombinase-mediated isothermal amplification method, by transforming a primer of RAA technology into an improved molecular beacon (IMB) probe having a single-stranded region after forming a stem-loop structure, so that the IMB probe has both primer and probe functions, so as to achieve the purpose of improving experimental efficiency, amplification specificity and sensitivity when used in RAA technology;

[0007] Another object of the present invention is to provide the use of the above-mentioned IMB probe and its primer combination in an isothermal amplification detection kit, especially a kit for detecting Staphylococcus aureus, so as to achieve the purpose of simultaneous and rapid detection of drug-resistant genes and pathogen-related genes, and reduce the requirements for detection personnel and equipment.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] A molecular beacon probe for a recombinase-mediated isothermal amplification detection technique, wherein one primer of the recombinase-mediated isothermal amplification detection technique is a primer that does not form a stem-loop structure, and the molecular beacon probe for the recombinase-mediated isothermal amplification detection technique serves as another primer of the recombinase-mediated isothermal amplification detection technique; the molecular beacon probe sequentially comprises, from the 5' end to the 3' end, an N1 region for forming a stem of a stem-loop structure, an M region for forming a loop of a stem-loop structure, an N2 region for forming a stem of a stem-loop structure, and a single-stranded region;

[0010] The bases of the N1 region and the N2 region are complementary to each other; the 5' end of the N1 region has a fluorescent group binding site, and the 3' end of the N2 region has a quenching group binding site that matches the fluorescent group;

[0011] The M region used to form the loop of the stem-loop structure, the N2 region used to form the stem of the stem-loop structure, and the single-stranded region are sequentially complementary to the bases at one end of the target gene. That is, the M region, the N2 region, and the single-stranded region assume the function of pairing the common primer with the target gene during the amplification reaction.

[0012] As a limitation of the present invention, the N1 region and the single-stranded region are both composed of 5 to 8 base sequences complementary to one end of the target gene.

[0013] As another limitation of the present invention, the N1 region and the N2 region contain 1-2 locked nucleic acid modification sites respectively.

[0014] The present invention also provides a primer combination, which comprises a primer gyrBF with a sequence of SEQ ID NO: 1 and a molecular beacon probe gyrBR with a sequence of SEQ ID NO: 2;

[0015] The molecular beacon probe gyrBR is the molecular beacon probe used for recombinase-mediated isothermal amplification detection technology, that is, it has the above structure, having an N1 region for forming the stem of the stem-loop structure, an M region for forming the loop of the stem-loop structure, an N2 region for forming the stem of the stem-loop structure, and a single-stranded region.

[0016] As a further limitation of the present invention, the primer combination further comprises a molecular beacon probe genF with a sequence of SEQ ID NO: 3, a primer genR with a sequence of SEQ ID NO: 4, a molecular beacon probe kanF with a sequence of SEQ ID NO: 5, and a primer kanR with a sequence of SEQ ID NO: 6;

[0017] The molecular beacon probe gyrBR, the molecular beacon probe genF and the molecular beacon probe kanF are all molecular beacon probes used for the recombinase-mediated isothermal amplification detection technology, and the excitation light wavelengths of the fluorescent groups in the three are different.

[0018] Further, the fluorescent group can be selected from one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LCRED460, and the quenching group can be selected from one of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0019] As a limitation of the present invention, the fluorescent group of the molecular beacon probe gyrBR is FAM; the fluorescent group of the molecular beacon probe genF is VIC; and the fluorescent group of the molecular beacon probe kanF is ABY.

[0020] The present invention also provides the use of the molecular beacon probe for recombinase-mediated isothermal amplification detection technology in the preparation of a recombinase-mediated isothermal amplification detection kit.

[0021] The present invention also provides the use of the primer combination in preparing a kit for detecting Staphylococcus aureus by recombinase-mediated isothermal amplification.

[0022] The present invention also provides a kit based on a molecular beacon probe for recombinase-mediated isothermal amplification detection technology, the kit comprising the above primer combination, a reagent system suitable for recombinase-mediated isothermal amplification reaction, and a single-stranded DNA binding protein, a recombinase and a polymerase.

[0023] The present invention also provides a fluorescence quantitative recombinase-mediated isothermal amplification method, using the above-mentioned primer combination to perform fluorescence quantitative recombinase-mediated isothermal amplification reaction, in the reaction system, the total volume fraction of the primer combination is 10-15%, and the concentration is 40 μM. Wherein, the volume of the upstream primer (or the molecular beacon probe used for the recombinase-mediated isothermal amplification detection technology) and the downstream primer (or the molecular beacon probe used for the recombinase-mediated isothermal amplification detection technology) is the same.

[0024] Furthermore, the reaction system of the RAA reaction is 25 μL, and the reaction system includes primers (i.e., primer gyrBF, molecular beacon probe gyrBR, molecular beacon probe genF, primer genR, molecular beacon probe kanF and primer kanR), buffer, Abuffer, Bbuffer, recombinase, recombinase auxiliary protein, single-stranded binding protein, polymerase, dNTPs, template DNA and distilled water. The reaction conditions are constant temperature at 38-45° C. for 20-40 min.

[0025] Due to the adoption of the above technical solution, the present invention has the following technical advances compared with the prior art:

[0026] The molecular beacon probe for recombinase-mediated isothermal amplification detection technology of the present invention is a modified molecular beacon (IMB) probe having a "single-stranded tail" after one of the primers of the RAA reaction is structurally modified to form a stem-loop structure. The modified IMB probe has both probe and primer functions, reducing the number of primers required for the RAA reaction to two, and only using the IMB probe and another unmodified common primer can perform amplification capable of fluorescence quantification.

[0027] The molecular beacon probe for recombinase-mediated isothermal amplification detection technology of the present invention has a special structure, including an N1 region for forming a stem portion of a stem-loop structure, an M region for forming a loop portion of a stem-loop structure, an N2 region for forming a stem portion of a stem-loop structure, and a single-stranded region, wherein the 5' end of the N1 region has a fluorescent group binding site, and the 3' end of the N2 region has a quenching group binding site that matches the fluorescent group. The single-stranded region is a 5-8 base sequence at the 3' end, and the remaining sequence to the 5' end can form a stem-loop structure after folding, and the binding force of the IMB probe stem is enhanced by locked nucleic acid modification, while the single-stranded region does not participate in the stem-loop structure and exists in the form of a "single-stranded tail".

[0028] According to the primer design principles, those skilled in the art can design molecular beacon probes with the above-mentioned special structure, using known pathogenic microorganism-specific genes and their drug-resistant genes as target genes, and form primer pairs with matching common primers that do not form a stem-loop structure for use in fluorescent quantitative RAA reactions.

[0029] The present invention forms multiple pairs of primer combinations through multiple groups of "molecular beacon probes for recombinase-mediated isothermal amplification detection technology + matching common primers", uses different fluorescent groups labeled with different primers, and realizes the simultaneous detection of multiple target genes through RAA reaction. For example, specific genes of pathogenic microorganisms and their drug-resistant genes can be detected at the same time, thereby facilitating the early diagnosis of microbial infection diseases and the adjustment of medication regimens.

[0030] Compared with the national standard GB4789.10-2016 method and the drug-sensitive paper agar diffusion method, the fluorescent quantitative recombinase-mediated isothermal amplification method of the present invention can significantly shorten the experimental cycle. The RAA reaction using the triple fluorescently labeled IMB probe-primer combination only takes 20 minutes. Amplification and detection are completed simultaneously in one tube and one step. There is no need to open the lid of the amplified product for detection, which significantly improves the detection efficiency and achieves a more efficient analysis of the matching rate of drug-resistant genes and drug-resistant phenotypes. 7 copies / μL-1.6×10 2 The results were within the detection range of 1000 copies / μL, and the coefficient of variation was less than 2%, with good repeatability. The detection limit of artificial contamination plasmid DNA in skim milk was 1.8×10 2 copies / μL, with high sensitivity and strong specificity.

[0031] In summary, the IMB probe and primer combination of the present invention is suitable for RAA technology, and the method of the present invention is suitable for industrial production and can be used for the preparation of RAA detection kits to detect pathogenic microorganisms or simultaneously detect pathogenic microorganisms and their drug-resistant genes.

[0032] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a schematic diagram of the working principle of the IMB probe in Example 1;

[0034] Figure 2 A schematic diagram of the formation of a stem-loop structure by three IMB probes in Example 5;

[0035] Figure 3 This is a diagram of the specificity verification results in Example 5;

[0036] Figure 4 This is a graph showing the fluorescence value detection results of the serial dilution of the G55855-1 plasmid DNA in Example 5;

[0037] Figure 5 This is the standard curve result diagram in Example 5. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below by specific examples. It should be understood that the described examples are only used to explain the present invention, and are not intended to limit the present invention.

[0039] Unless otherwise specified, the materials and reagents used in the examples of the present invention can be obtained from commercial sources. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer. Some of the reagents are as follows:

[0040] ①LB liquid medium: 5 g tryptone, 2.5 g yeast extract, 5 g NaCl, 500 mL distilled water, adjust the pH to 7.4 with 1 mol / L HCl.

[0041] ②LB solid medium: Add 2% agar to LB liquid medium.

[0042] 0.85% normal saline: 8.5 g NaCl, 1000 mL distilled water, divided into test tubes, 9 mL per tube.

[0043] All prepared culture media and reagents were sterilized by autoclave at 121°C for 15 min.

[0044] ③RAA nucleic acid amplification reagent (basic type): Hangzhou Zhongce Biotechnology Co., Ltd.; dNTP Mixture (10mM): Bao Bioengineering (Dalian) Co., Ltd.

[0045] ④ Gene recombination positive plasmid pUC57 (gyrB: 900bp, aac6'-aph2: 850bp and ant(4')-Ia850bp seamlessly cloned into pUC57): 5310bp; plasmid transformation into glycerol bacteria G55855-1 (pUC57 transformed into DH5α competent cells): Jiangsu Saisuofei Biotechnology Co., Ltd. 16SrDNA universal primer sequence 341F: 5'CCTACGGGNGGCWGCAG3', 805R: 5'GACTACHVGGGTATCTAATCC3': synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0046] ⑤ Gentamycin and kanamycin drug sensitivity papers, Hangzhou Microbiological Reagent Co., Ltd. Tiangen Plasmid Mini Extraction Kit, Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0047] Some of the instruments and equipment include: PQuantStudio3 real-time fluorescence PCR instrument (Applied Biosystems (ABI) Company, USA); BSC-1304ⅡA2 biological safety cabinet (Suzhou Antai Air Technology Co., Ltd.); Milli-Q Synthesis ultrapure water machine (Merck Millipore, Germany); micropipette gun (Eppendorf AG, Germany).

[0048] The primers synthesized and prepared in each embodiment of the present invention and the molecular beacon probes for recombinase-mediated isothermal amplification detection technology are all in the form of lyophilized powder, centrifuged at 4°C, 6000r / min for 5min, diluted with TE to a 100μM stock solution, and diluted with TE to a 40μM working solution when used.

[0049] The molecular biology experimental operations in the examples, including plasmid construction, culture medium preparation, etc., were mainly performed with reference to Molecular Cloning Experiment Guide (3rd edition), edited by J. Sambrook and DW Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002).

[0050] Example 1 A molecular beacon probe gyrBR for recombinase-mediated isothermal amplification detection technology

[0051] In GenBank, the 812 bp sequence of the gene gyrB (ACCNo: KX638827.1: 1116 bp) encoding the B subunit protein of the DNA gyrase of Staphylococcus aureus (S. aureus) was used as the target gene (target gene). The primer gyrBF and the molecular beacon probe gyrBR for recombinase-mediated isothermal amplification detection technology were designed using PrimerPremier v5.00 software, following the general principles of primer design, and the primer probe structure analysis was performed using DNAMAN V6.0. The design results and analysis are as follows:

[0052] ① The sequence of primer gyrBF is SEQ ID NO: 1, and it is the front primer used to amplify the target gene.

[0053] ② A molecular beacon probe gyrBR sequence for recombinase-mediated isothermal amplification detection technology, SEQ ID NO: 2, is as follows:

[0054]

[0055] The molecular beacon probe for recombinase-mediated isothermal amplification detection technology sequentially comprises an N1 region for forming a stem portion of a stem-loop structure, and the sequence is The sequence of the M region used to form the loop of the stem-loop structure is GAGTCACGACCAGA; the sequence of the N2 region used to form the stem of the stem-loop structure is and a single-stranded region with the sequence TAGACCC;

[0056] In the above sequence, the underline indicates that the site is fluorescently labeled, and the emphasis indicates that the site is modified with locked nucleic acid. Among them, the bases of the N1 region and the N2 region are complementary; the "C" at the 5' end of the N1 region is labeled with the fluorescent group FAM, containing 2 locked nucleic acid modification sites, specifically locked nucleic acid modification at "A" and "A"; the "G" at the 3' end of the N2 region is labeled with the quenching group DABCYL matching the fluorescent group FAM, containing 2 locked nucleic acid modification sites, specifically locked nucleic acid modification at "T" and "T"; the single-stranded region consists of 7 base sequences complementary to one end of the target gene.

[0057] The working principle of the molecular beacon probe used for recombinase-mediated isothermal amplification detection technology of the present invention is as follows: Figure 1 As shown, an unmodified primer for amplifying the target gene and a modified molecular beacon probe IMB probe for recombinase-mediated isothermal amplification detection technology rely on multiple enzymes (recombinase, recombinase auxiliary protein, single-stranded binding protein, DNA polymerase) to bind and recognize during the reaction, bind to and extend the DNA double strand, and start the replication process. At the beginning of the RAA reaction, common primers and IMB probes bind to the recombinase to form a complex, which is specifically recognized with the help of the recombinase auxiliary protein. After recognition, one single-stranded DNA binds to the complex, while the other single-stranded DNA binds to the single-stranded binding protein (SSB) to prevent the DNA from reforming into a double-stranded structure. The recombinases on the 3' ends of the primer and the IMB probe fall off, and the DNA polymerase replaces the recombinase to bind to the primer at the 3' end of the primer, thereby extending the primer forward. The quenching group and fluorescent group marked at the 5' and 3' ends of the molecular beacon stem of the IMB probe complex are pulled apart to show fluorescence, and the replication process begins immediately. This procedure is repeated, and the target gene fragment is exponentially amplified, which is proportional to the fluorescence intensity, that is, the amplification result can be displayed by a fluorescence curve.

[0058] In other embodiments, the sequence of a molecular beacon probe used for recombinase-mediated isothermal amplification detection technology is basically the same as that in Example 1, except that the single-stranded region consists of 5 base sequences complementary to one end of the target gene, and the sequence of the single-stranded region is TAGAC.

[0059] In other embodiments, the fluorescent group can be selected from one of FAM, VIC, JOE, TET, CY3, CY5, ROX, TexasRed or LCRED460 as needed, and the quenching group can be selected from one of the matching BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra. It has been verified that they can all be used as primers for RAA technology and also have probe functions.

[0060] In other embodiments, the sequence of a molecular beacon probe used for recombinase-mediated isothermal amplification detection technology is substantially the same as that of Example 1, except that the N1 region consists of 6, 7 or 8 nucleotide sequences complementary to one end of the target gene.

[0061] Example 2 A molecular beacon probe genF for recombinase-mediated isothermal amplification detection technology

[0062] A molecular beacon probe genF for recombinase-mediated isothermal amplification detection technology is designed with the gentamicin resistance gene aminoglycoside O-phosphotransferase gene aac(6')-aph(2") (ACCNo: AP024293.1: 1437 bp) as the target gene. Its design and analysis methods are the same as those in Example 1. The results are as follows:

[0063] The sequence of a molecular beacon probe genF for recombinase-mediated isothermal amplification detection technology, SEQ ID NO: 3, is as follows:

[0064] 5'- T GGTTGCCACACTATCATAACC A CTACCGA-3'. ...

[0066] The molecular beacon probe for recombinase-mediated isothermal amplification detection technology sequentially comprises an N1 region for forming a stem portion of a stem-loop structure, and the sequence is T GGTT; the M region used to form the loop of the stem-loop structure has a sequence of .

[0068] GCCACACTATCAT; the N2 region used to form the stem of the stem-loop structure has a sequence of AACC A ; and a single-stranded region, ..

[0070] The sequence is CTACCGA;

[0071] In the above sequence, the underline indicates that the site is fluorescently labeled, and the emphasis indicates that the site is modified with locked nucleic acid. Among them, the bases of the N1 region and the N2 region are complementary; the "T" at the 5' end of the N1 region is marked with the fluorescent group VIC, containing 1 locked nucleic acid modification site, specifically, the locked nucleic acid modification is performed at "G"; the "G" at the 3' end of the N2 region is marked with the quenching group DABCYL matching the fluorescent group, containing 2 locked nucleic acid modification sites, specifically, the locked nucleic acid modification is performed at "A" and "C"; the single-stranded region is composed of 7 base sequences complementary to one end of the target gene.

[0072] A common primer genR matching the molecular beacon probe genF used in the recombinase-mediated isothermal amplification detection technology is designed with the same target gene, and its sequence is shown in SEQ ID NO:4.

[0073] In other embodiments, the sequence of a molecular beacon probe used for recombinase-mediated isothermal amplification detection technology is substantially the same as that of Example 2, except that the N1 region consists of 6, 7 or 8 nucleotide sequences complementary to one end of the target gene.

[0074] Example 3 A molecular beacon probe kanF for recombinase-mediated isothermal amplification detection technology

[0075] A molecular beacon probe kanF for recombinase-mediated isothermal amplification detection technology is designed with the kanamycin resistance gene aminoglycoside O-nucleotidyltransferase ant(4')-Ia (ACCNo: NG_047375.1: 768bp) as the target gene. Its design and analysis methods are the same as those in Example 1. The results are as follows:

[0076] The sequence of a molecular beacon probe kanF for recombinase-mediated isothermal amplification detection technology, SEQ ID NO: 5, is as follows:

[0077] 5'- G AACTTATGACCATCTGTGCCAGTT C GTAATGTC-3'. ....

[0079] The molecular beacon probe for recombinase-mediated isothermal amplification detection technology sequentially comprises an N1 region for forming a stem portion of a stem-loop structure, and the sequence is G AACT; the M region used to form the loop of the stem-loop structure has a sequence of ..

[0081] TATGACCATCTGTGCC; the N2 region used to form the stem of the stem-loop structure has a sequence of AGTTC ; and single ..

[0083] Chain region, the sequence is GTAATGTC;

[0084] In the above sequence, the underline indicates that the site is fluorescently labeled, and the emphasis indicates that the site is modified with locked nucleic acid. Among them, the bases of the N1 region and the N2 region are complementary; the "G" at the 5' end of the N1 region is marked with the fluorescent group ABY, containing 2 locked nucleic acid modification sites, specifically locked nucleic acid modification at "A" and "T"; the "C" at the 3' end of the N2 region is marked with the quenching group BHQ2 matching the fluorescent group, containing 2 locked nucleic acid modification sites, specifically locked nucleic acid modification at "G" and "T"; the single-stranded region consists of 8 base sequences complementary to one end of the target gene.

[0085] A common primer kanR matching the molecular beacon probe kanF used in the recombinase-mediated isothermal amplification detection technology was designed with the same target gene, and its sequence is shown in SEQ ID NO:6.

[0086] In other embodiments, the sequence of a molecular beacon probe used for recombinase-mediated isothermal amplification detection technology is substantially the same as that of Example 3, except that the N1 region consists of 6, 7 or 8 nucleotide sequences complementary to one end of the target gene.

[0087] When the N1 region consists of 4, 9 or 10 nucleotide sequences complementary to one end of the target gene, the molecular beacon probe function is unstable and cannot be used in the RAA technology.

[0088] Example 4 A primer combination Z1 for detecting Staphylococcus aureus and its application

[0089] The molecular beacon probe gyrBR used in the recombinase-mediated isothermal amplification detection technology is used as a rear primer of the recombinase-mediated isothermal amplification detection technology, and is used with the matching and unmodified common front primer gyrBF as a pair of primer compositions Z1 to prepare a kit for detecting Staphylococcus aureus by recombinase-mediated isothermal amplification to detect Staphylococcus aureus.

[0090] The kit comprises a primer combination Z1; reagents suitable for recombinase-mediated isothermal amplification reaction: system buffer, Abuffer, Bbuffer; and single-stranded DNA binding protein, recombinase and polymerase.

[0091] Example 5 A primer combination Z2 for detecting Staphylococcus aureus and drug resistance genes

[0092] The primer combination Z2 of this embodiment comprises the primer combination Z1 of Example 4, as well as a molecular beacon probe genF with a sequence of SEQ ID NO:3, a primer genR with a sequence of SEQ ID NO:4, a molecular beacon probe kanF with a sequence of SEQ ID NO:5, and a primer kanR with a sequence of SEQ ID NO:6. The specific sequences are shown in Table 1.

[0093] The schematic diagram of the stem-loop structure formed by three molecular beacon probes is shown in the figure Figure 2 , fluorescent labels and locked nucleic acid modifications (LNA) were labeled at the corresponding sites.

[0094] Table 1 Primers and molecular beacon probe sequences

[0095]

[0096] 1) Verification of the specificity of primer combination Z2

[0097] 1) Cultivation of the bacteria to be tested.

[0098] Three strains of S. aureus and 14 strains of non-S. aureus glycerol-preserved bacteria were inoculated into LB liquid culture medium and cultured at 37°C for 18 h. G55855-1 was inoculated into LB liquid culture medium containing ampicillin and cultured at 37°C for 18 h. The bacteria were then transferred and subcultured once for later use.

[0099] Table 2 Information of strains to be tested

[0100]

[0101]

[0102]

[0103] Note: ATCC is the American Type Culture Collection; CICC is the China Industrial Microbiology Culture Collection Center; CGMCC is the China General Microbiology Culture Collection Center; “+” means resistant, and “-” means sensitive.

[0104] The other strains are preserved in the Food Science and Engineering Laboratory of Shijiazhuang University, and all of the above strains are available to the public.

[0105] 2) Preparation of DNA samples of bacteria to be tested.

[0106] The subcultured bacterial liquid was inoculated into LB liquid medium and cultured at the corresponding temperature for 18 h. 1 mL of the bacterial liquid was taken for 10-fold serial dilutions. 1 mL of the dilutions of three continuous concentration gradient bacteria were taken and mixed with LB solid medium and cultured at the corresponding culture temperature for 24 h. The plate counts were performed and the concentration of 1 mL of the bacterial liquid of each strain was recorded.

[0107] At the same time, 1 mL of bacterial solution was used to extract genomic DNA according to the Tiangen Bacterial Genomic DNA Extraction Kit (DP302), and 4 mL of bacterial solution was used to extract G55855-1 plasmid DNA according to the Tiangen Plasmid Mini Extraction Kit (DP103). The extracted genomic and plasmid G55855-1 DNA were measured using Nanodrop2000 ultra-micro spectrophotometer, and the DNA concentration was 40-100 ng / uL, and was frozen and stored at -20°C for later use.

[0108] Calculate the copy number, dilute the plasmid with deionized water to a final concentration of 108-101 copies / μL, and store at -20°C for later use. Calculation formula: plasmid copy number (copies·mL-1) = 6.02×1023×plasmid concentration (g·mL-1) / plasmid length×660.

[0109] 3) Specificity verification method.

[0110] Take 1 μL of the genomic DNA of 3 different strains of S. aureus and 14 non-S. aureus strains and the recombinant plasmid G55855-1 plasmid DNA respectively and mix them with sterile ddHO. 2 O 1μL was used as blank control, and RAA detection was performed using primer combination Z2 as primer to verify the specificity of the primers.

[0111] RAA detection reaction system configuration and reaction conditions are as follows:

[0112] The 25 μL reaction system was prepared as follows: 10 μL system buffer, 6.25 μL Abuffer, 1.4 μL premix of four proteins (the volume ratio of recombinase, recombinase auxiliary protein, single-stranded binding protein and polymerase was 0.28:0.09:0.82:0.21); the working concentration of primers and molecular beacon probes used for recombinase-mediated isothermal amplification detection technology was 40 μM, and the total volume fraction was 11.6%, of which gyrBF and gyrBR were 0.5 μL, genF and genR were 0.45 μL, and kanF and kanR were 0.5 μL respectively; dNTPs working concentration was 10 mM, 0.9 μL, template DNA was 1 μL, and sterile distilled water was 1.3 μL, and mixed well, and 1.25 μL of Bbuffer was added to the inner wall of each reaction tube cover;

[0113] After instantaneous centrifugation of the reaction system, it was immediately put on the machine and the reaction conditions were set to a constant temperature of 40°C and a reaction time of 30 minutes for RAA amplification reaction.

[0114] 4) Specificity verification results and comparison.

[0115] like Figure 3As shown, the results showed that the gyrB gene amplification of DNA from 3 different sources of S. aureus and G55855-1 showed an S-shaped amplification curve, while the DNA amplification of 14 non-S. aureus strains did not show an S-shaped amplification curve, indicating that the primer combination had good specificity.

[0116] The drug sensitivity paper agar diffusion method was used to determine that, except for the positive plasmid G55855-1, S. aureus CICC23926 and Lactobacillus acidophilus CICC60962 were resistant to kanamycin, and the kan gene amplification showed an S-type amplification curve. The DNA amplification of the other 15 strains of S. aureus and non-S. aureus bacteria did not show an S-type amplification curve, indicating that the primer combination for detecting the kanamycin-resistant ant (4')-Ia gene was consistent with its phenotype, but was not species-specific.

[0117] Using the drug sensitivity paper agar diffusion method, DNA amplification of five strains with gentamicin-resistant aac(6')-aph genes, including S. aureus CICC23926, Enterococcus faecium ATCC51299, Streptococcus pyogenes CICC10373, Lactobacillus acidophilus CICC6096 and G55855-1, all showed an S-shaped amplification curve, while DNA amplification of the remaining 13 strains of S. aureus and non-S. aureus bacteria did not show an S-shaped amplification curve, indicating that the primer combination for detecting the kanamycin-resistant ant(4')-Ia gene is consistent with its phenotype, but is not species-specific.

[0118] II) Sensitivity of primer combination Z2 for detecting pure cultured S. aureus

[0119] The recombinant plasmid G55855-1 DNA was diluted 10-fold from 1.6 × 10 7 copies.μL －1 to 1.6×10 1 copies·μL －1 As a template, three replicates were made for each concentration to perform triple IMB probe-RAA amplification. The standard curve was drawn with the logarithm of plasmid concentration as the horizontal axis and the cycle threshold (Ct) as the vertical axis, and its linear equation (y = ax + b, where a is the slope of the linear equation and b is the intercept) and amplification efficiency (E = 10 -1 / a -1, a is the slope of the linear equation), to indicate the sensitivity of the primer combination in detecting pure culture of S. aureus.

[0120] The results are as follows Figure 4As shown, the G55855-1 plasmid DNA concentration was 1.6×10 7 copies·μL -1 ~1.6×10 1 copies·μL -1 The highest fluorescence intensity of the S-shaped curve of the reaction amplification was different. The fluorescence intensity of the gyrB gene amplification was the highest, and the fluorescence values ​​of the gen gene and the kan gene were not much different. Within 20 minutes, all primer combinations could amplify the G55855-1 plasmid. The concentration of the 10-fold serial dilution DNA was 1.6×10 2 copies·μL -1 .

[0121] According to the concentration of G55855-1 plasmid DNA at 1.6×10 7 copies·μL -1 ~1.6×10 1 copies·μL -1 The logarithmic values ​​of the series concentrations were plotted as the horizontal axis, and the Ct value (1 Cycle = 1 min) was used as the vertical axis to draw a standard curve. The results are shown in Figure 5 As shown, the linear equations of the standard curves of single gyrB gene amplification, gen resistance gene and kan resistance gene are gyrB-y=-3.2804x+26.068, gen-y=-3.3661x+26.733, kan-y=-3.2669x+26.812, where x is the reaction time (min), y is the logarithm of the initial concentration of plasmid DNA (log10), gyrB-R 2 =0.9989, gen-R2 = 0.9966, kan-R 2 =0.9979, R of 3 genes 2 >0.99, all with good linear correlation, and the amplification efficiencies were E(gyrB)=101.76%, E(gen)=98.19%, E(kan)=102.35%, and 90%<E<110%.

[0122] The above results show that the primer combination of the present invention is 1.6×10 7 copies / μL-1.6×10 2 The results were within the detection range of 100 copies / μL, and the coefficient of variation was less than 2%, with high sensitivity and good repeatability.

[0123] III) Detection limit of primer combination Z2 for artificially contaminated G55855-1 plasmid DNA in skim milk powder

[0124] Take 25mL skim milk powder and homogenize it in 225mL sterile saline under sterile conditions to make 1:10 skim milk. Before adding, test the skim milk powder to ensure that S. aureus is negative. Take G55855-1 bacterial suspension and concentrate it 10 times, take 1mL and add it to 9mL 1:10 skim milk. Take 5mL recombinant plasmid G55855-1 bacterial suspension and add 1mL anhydrous ethanol, 1mL ammonia water and 1mL petroleum ether to mix. Centrifuge the mixture at 12000rpm for 10min, collect the bacteria and discard the supernatant. Suspend the cells with 1 mL of sterile deionized water, shake with an oscillator, centrifuge at 12000 rpm for 1 min, and discard the supernatant; treat the cells with 500 μL of lysozyme (50 mg / mL) for 5 min, centrifuge at 12000 rpm for 1 min, and discard the supernatant; suspend the cells with 1 mL of sterile deionized water, shake with an oscillator, centrifuge at 12000 rpm for 1 min, and discard the supernatant; dissolve the precipitate with 1 mL of sterile deionized water, take 1 μL of plasmid DNA extracted at the same time and different times, respectively, in the same reaction tube, use primer combination Z2 for RAA reaction, and detect gyrB gene, gen gene and kan gene at the same time, and amplify to determine the detection limit of artificially added S. aureus. Each sample was repeated 3 times, and the intra-group and inter-group repeatability tests were performed. The coefficient of variation (CV%) of the intra-group and inter-group repeatability tests was calculated to evaluate the repeatability of the method.

[0125] The results showed that the detection limit of plasmid DNA in artificially contaminated G55855-1 bacteria in skim milk powder was 1.8×10 2 copies·μL -1 The coefficient of variation (CV) of the intra-group and inter-group repeatability tests for each sample was <2.00%, as shown in Table 3.

[0126] Table 3 Results of repeatability test of plasmid DNA for gyrB, gen and kan genes

[0127]

[0128]

[0129] The above results show that the detection limit of artificial contamination plasmid DNA in skim milk is 1.8×10 2 The molecular beacon probes and related primer combinations for recombinase-mediated isothermal amplification detection technology in other embodiments of the present invention were tested for the above specificity, detection limit and sensitivity, and similar results were obtained.

[0130] Example 6 Fluorescence quantitative recombinase-mediated isothermal amplification method based on primer combination Z2

[0131] This example is a fluorescence quantitative recombinase-mediated isothermal amplification method based on primer combination Z2, i.e., RAA reaction of triple fluorescently labeled IMB probe-primer combination (triple IMB probe-RAA amplification reaction), which is used to simultaneously detect Staphylococcus aureus and drug resistance genes (gentamicin resistance gene gen and kanamycin resistance gene kan) in 160 milk samples of cows with mastitis collected from family-based individual dairy farms in Hebei Province. The details are as follows:

[0132] S1. Extract DNA from the sample to be tested as a template:

[0133] 1mL of milk samples of 160 cases of mastitis collected from family-based dairy farms in Hebei Province were mixed with 1mL of anhydrous ethanol, 1mL of ammonia water and 1mL of petroleum ether. The mixture was centrifuged at 12000rpm for 10min to collect the bacteria and discard the supernatant. The bacteria were suspended with 1mL of sterile deionized water, shaken with an oscillator and centrifuged at 12000rpm for 1min, and the supernatant was discarded; the bacteria were treated with 500μL of lysozyme (50mg / mL) for 5min, centrifuged at 12000rpm for 1min, and the supernatant was discarded; the bacteria were suspended with 1mL of sterile deionized water, shaken with an oscillator and centrifuged at 12000rpm for 1min, and the supernatant was discarded; the precipitate was dissolved with 1mL of sterile deionized water, the precipitate was fully suspended, 50μL of the suspension was boiled in a boiling water bath for 10min, and centrifuged at 1,2000rpm for 1min. The supernatant was the template DNA.

[0134] S2. Reaction system configuration and triple IMB probe-RAA amplification reaction:

[0135] Prepare a 25 μL reaction system: 10 μL system buffer, 6.25 μL Abuffer, 1.4 μL premix of four proteins (the volume ratio of recombinase, recombinase auxiliary protein, single-stranded binding protein and polymerase is 0.28:0.09:0.82:0.21); the working concentration of primers and molecular beacon probes is 40 μM, and the total volume fraction is 11.6%, of which gyrBF and gyrBR are 0.5 μL, genF and genR are 0.45 μL, and kanF and kanR are 0.5 μL respectively; dNTPs working concentration is 10 mM, 0.9 μL, template DNA is 1 μL, and sterile distilled water is 1.3 μL, and mixed well, and 1.25 μL of Bbuffer is added to the inner wall of each reaction tube cover;

[0136] After instantaneous centrifugation of the reaction system, it was immediately put on the machine and the reaction conditions were set to a constant temperature of 40°C and a reaction time of 20 min for triple IMB probe-RAA amplification reaction.

[0137] S3. Real-time monitoring of fluorescence intensity and analysis of the results:

[0138] Among 160 samples of mastitis milk from dairy cows, 53 samples were found to contain S. aureus, with a detection rate of 33.13%. There were 8 strains of gentamicin-resistant and 10 strains of kanamycin-resistant genes.

[0139] In other embodiments, the total volume fraction of the primers and the molecular beacon probes used for the recombinase-mediated isothermal amplification detection technology in step S2 is 10%, 13%, 12.5%, 14% or 15%, the reaction conditions are 38°C, 39°C, 42°C, 43°C or 45°C, and the constant temperature reaction time is 25min, 28min, 33min, 37min or 40min, and the triple IMB probe-RAA amplification reaction is successfully carried out and similar effects are achieved.

[0140] Comparative Example 1 The above 160 milk samples were tested by the method of detecting 16SrRNA. According to the operation method and judgment criteria of the antimicrobial susceptibility test of the Clinical & Laboratory Standards Institute (CLSI), the strains isolated from the S. aureus samples were subjected to drug susceptibility tests, and the sensitivity of the strains to gentamicin and kanamycin resistance genes to aminoglycosides was determined by the drug sensitivity paper agar diffusion method. Each drug sensitivity paper was repeated 3 times to analyze the matching rate of resistance genes and resistance phenotypes.

[0141] Comparative Example 2 used the GB4789.10-2016 method to test the above 160 milk samples, and the results of the drug-sensitive paper agar diffusion method in Comparative Example 1 were used as the resistance gene detection results.

[0142] Comparing the results of Example 6, Comparative Example 1 and Comparative Example 2, the coincidence rates of each method in detecting S. aureus were compared, wherein coincidence rate = (number of true positives + number of true negatives) / total number of samples tested.

[0143] The results show that for the detection of S. aureus: Comparative Example 1 detected 53 samples containing S. aureus, with a detection rate of 33.13%. The GB4789.10-2016 method of Comparative Example 2 separated and identified 50 samples as S. aureus, with a detection rate of 31.25%. The method of Example 6 had a 100% compliance rate with Comparative Example 1 and a 98.13% compliance rate with Comparative Example 2. That is, under the premise of almost the same accuracy as Comparative Examples 1 and 2, the method of the present invention has a shorter detection cycle.

[0144] For the detection of drug resistance genes: the drug sensitivity paper agar diffusion method detected 8 strains of gentamicin-resistant and 10 strains of kanamycin-resistant strains, respectively. The method of Example 6 was 100% consistent with the results of the drug sensitivity paper agar diffusion method, and the phenotypic consistency was also 100%.

[0145] The above results show that the method of Example 6 of the present invention can complete the simultaneous detection of pathogenic microorganisms and drug-resistant genes within a reaction time of 20 minutes, and is convenient, efficient, and has high accuracy compared to traditional methods such as GB4789.10-2016, which are time-consuming, cumbersome, and require higher equipment and operations. It provides support for the early diagnosis of bovine mastitis and the adjustment of medication regimens.

[0146] In some embodiments, the target gene is a S. aureus heat-resistant nucleic acid gene (nuc gene) or a species-specific identification gene of pathogenic microorganisms such as Escherichia coli, Mycobacterium bovis, Listeria monocytogenes, Salmonella spp., and Brucella spp., and a molecular beacon probe is designed to sequentially include, from the 5' end to the 3' end, an N1 region for forming a stem portion of a stem-loop structure, an M region for forming a loop portion of a stem-loop structure, an N2 region for forming a stem portion of a stem-loop structure, and a single-stranded region, wherein the bases of the N1 region and the N2 region are complementary to each other; the 5' end of the N1 region has a fluorescent group binding site, and the 3' end of the N2 region has a quenching group binding site matching the fluorescent group.

[0147] In some embodiments, the target gene is a resistance gene to antibiotics such as aminoglycosides, tetracyclines, β-lactams, macrolides, etc., and a molecular beacon probe is designed to include, from the 5' end to the 3' end, an N1 region for forming a stem portion of a stem-loop structure, an M region for forming a loop portion of a stem-loop structure, an N2 region for forming a stem portion of a stem-loop structure, and a single-stranded region, wherein the bases of the N1 region and the N2 region are complementary to each other; the 5' end of the N1 region has a fluorescent group binding site, and the 3' end of the N2 region has a quenching group binding site that matches the fluorescent group.

[0148] Among them, the resistance genes of aminoglycoside antibiotics include streptomycin resistance gene, gentamicin resistance gene, tobramycin resistance gene, kanamycin resistance gene, amikacin resistance gene, neomycin resistance gene, netilmicin resistance gene or isepamicin resistance gene.

[0149] Resistance genes for tetracycline antibiotics include chlortetracycline resistance gene, oxytetracycline resistance gene, tetracycline resistance gene, minocycline resistance gene, doxycycline resistance gene or doxycycline resistance gene.

[0150] The resistance genes of β-lactam antibiotics include penicillin resistance genes, cephalosporin resistance genes, carbapenem resistance genes, cephamycin resistance genes, thiomycin resistance genes, oxacephem resistance genes,

[0151] The resistance genes of macrolide antibiotics include erythromycin resistance gene, roxithromycin resistance gene, azithromycin resistance gene, clarithromycin resistance gene, dirithromycin resistance gene, fluazifop resistance gene or telithromycin resistance gene.

[0152] The above molecular beacon probes can all be used as a primer in the recombinase-mediated isothermal amplification detection technology and can be used to prepare RAA kits to achieve simultaneous detection of pathogenic microorganisms and drug-resistant genes.

[0153] It should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the above embodiments, those skilled in the art can still modify the technical solutions described in the above embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the scope of protection of the claims of the present invention.

Claims

1. A molecular beacon probe for recombinase-mediated isothermal amplification detection technology, wherein a primer of the recombinase-mediated isothermal amplification detection technology is a primer that does not form a stem-loop structure, characterized in that: The molecular beacon probe used in the recombinase-mediated isothermal amplification detection technology is used as another primer of the recombinase-mediated isothermal amplification detection technology; The molecular beacon probe comprises, from the 5' end to the 3' end, an N1 region for forming a stem portion of a stem-loop structure, an M region for forming a loop portion of a stem-loop structure, an N2 region for forming a stem portion of a stem-loop structure, and a single-stranded region; The bases of the N1 region and the N2 region are complementary to each other; the 5' end of the N1 region has a fluorescent group binding site, and the 3' end of the N2 region has a quenching group binding site that matches the fluorescent group; The M region used to form the loop portion of the stem-loop structure, the N2 region used to form the stem portion of the stem-loop structure, and the single-stranded region are sequentially complementary to the bases at one end of the target gene.

2. A molecular beacon probe for recombinase-mediated isothermal amplification detection technology according to claim 1, characterized in that: The N1 region and the single-stranded region are both composed of 5 to 8 base sequences complementary to one end of the target gene.

3. A molecular beacon probe for recombinase-mediated isothermal amplification detection technology according to claim 1 or 2, characterized in that: The N1 region and the N2 region contain 1-2 locked nucleic acid modification sites respectively.

4. A primer combination, characterized in that: The primer combination comprises a primer having a sequence of SEQ ID NO: 1 ikB F and a molecular beacon probe having a sequence of SEQ ID NO: 2 ikB R; The molecular beacon probe ikB R is the molecular beacon probe for recombinase-mediated isothermal amplification detection technology as described in claim 1.

5. The primer combination according to claim 4, characterized in that: The primer combination also includes a molecular beacon probe with a sequence of SEQ ID NO: 3 gen F. Primer with sequence SEQ ID NO: 4 gen R, a molecular beacon probe having a sequence of SEQ ID NO: 5 kan F and a primer having a sequence of SEQ ID NO: 6 kan R; The molecular beacon probe ikB R. Molecular beacon probe gen F and molecular beacon probes kan F are all molecular beacon probes for recombinase-mediated isothermal amplification detection technology as described in claim 1, and the excitation light wavelengths of the fluorescent groups in the three are different.

6. The primer combination according to claim 5, characterized in that: The molecular beacon probe ikB The fluorescent group of R is FAM; the molecular beacon probe gen The fluorescent group of F is VIC; the molecular beacon probe kan The fluorescent group of F is ABY.

7. Use of the molecular beacon probe for recombinase-mediated isothermal amplification detection technology according to any one of claims 1 to 3 in the preparation of a recombinase-mediated isothermal amplification detection kit.

8. Use of the primer combination according to claim 4 in preparing a kit for detecting Staphylococcus aureus by recombinase-mediated isothermal amplification.

9. A kit based on a molecular beacon probe for recombinase-mediated isothermal amplification detection technology, characterized in that: The kit comprises the primer combination according to claim 5, a reagent system suitable for recombinase-mediated isothermal amplification reaction, and a single-stranded DNA binding protein, a recombinase and a polymerase.

10. A recombinase-mediated isothermal amplification method, characterized in that: The primer combination according to claim 5 or 6 is used to carry out a fluorescent quantitative recombinase-mediated isothermal amplification reaction. In the reaction system, the total volume fraction of the primer combination is 10-15%, and the concentration is 40 μM.

Images