MiRNA for pulmonary tuberculosis diagnosis and application thereof
By developing a diagnostic method based on extracellular vesicle miRNA and using microRNA 107 as a marker, the problems of low diagnostic sensitivity and high detection cost in the prior art have been solved, and efficient and convenient tuberculosis diagnosis has been achieved.
Patent Information
- Application Number
- CN202411557041.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-04
- Publication Date
- 2025-02-18
AI Technical Summary
The prior art has low sensitivity and high detection cost in tuberculosis laboratory diagnosis. It has poor diagnostic efficacy for clinical samples with low bacteria content and lacks convenient and sensitive diagnostic methods.
Develop a diagnostic method based on extracellular vesicle miRNA, using microRNA 107 as a marker, to achieve the distinction between tuberculosis patients and healthy people by specifically amplifying or identifying detection reagents for miRNA 107.
It improves the sensitivity and specificity of tuberculosis diagnosis, provides a convenient and sensitive method that can effectively distinguish tuberculosis patients and healthy people, and reduces the cost of testing.
Smart Images
Figure CN119464474A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of diagnostic technology, and in particular to miRNA for diagnosing tuberculosis and application thereof. Background Art
[0002] Tuberculosis is a respiratory infectious disease caused by Mycobacterium tuberculosis. It is the disease with the highest mortality rate caused by infection with a single pathogen, except for the new coronavirus. The latest data from the World Health Organization (WHO) shows that due to the impact of factors such as the COVID-19 pandemic, tuberculosis has tended to rise in recent years (1). Therefore, there is still a long way to go to achieve the goal of ending the tuberculosis epidemic by 2035.
[0003] At present, one of the biggest challenges facing tuberculosis prevention and control is the lack of laboratory diagnosis of tuberculosis, which seriously restricts the timely detection of patients, causing delays in diagnosis and treatment of patients and further human-to-human transmission. Sputum smear and culture of Mycobacterium tuberculosis are currently the most widely used laboratory diagnostic techniques for tuberculosis, but the sensitivity is low. The rapid development of molecular biology technology and genomic DNA sequencing has greatly improved the sensitivity of etiological diagnosis of Mycobacterium tuberculosis, but there are also problems such as high detection costs and poor diagnostic efficiency for clinical samples with low bacterial content. According to statistics from the WHO, only 58% of pulmonary tuberculosis patients in my country have bacteriological laboratory evidence. Therefore, in addition to traditional sputum specimens, the development of more convenient and sensitive diagnostic methods based on biological samples such as blood can serve as an effective supplement to existing laboratory diagnostic methods for tuberculosis.
[0004] In recent years, many studies have shown that RNA (especially miRNA) carried by extracellular vesicles can serve as markers for early detection of diseases, progression monitoring, and evaluation of treatment effects (2,3).
[0005] Therefore, there is a need to develop new molecular markers that can distinguish between tuberculosis and non-tuberculosis.
[0006] It should be noted that the information disclosed in the above background technology section is only used to enhance the understanding of the background of the present invention, and therefore may include information that does not constitute the prior art known to ordinary technicians in the field. Summary of the invention
[0007] The present invention aims to provide a miRNA for diagnosing pulmonary tuberculosis and its application.
[0008] Specifically, the present invention aims to provide an extracellular vesicle miRNA for diagnosing tuberculosis patients, so as to distinguish tuberculosis patients from healthy people through in vitro samples.
[0009] In a first aspect of the present invention, there is provided a use of microRNA 107 or a detection reagent thereof for preparing a reagent or a kit for diagnosing pulmonary tuberculosis.
[0010] In another preferred embodiment, the detection reagent includes a primer or a primer pair, a probe or a chip that specifically amplifies microRNA 107 or a fragment thereof.
[0011] In another preferred embodiment, the microRNA 107 is derived from humans or non-human mammals.
[0012] In another preferred embodiment, the microRNA 107 is derived from human.
[0013] In another preferred embodiment, the nucleotide sequence of the microRNA 107 is shown in SEQ ID NO.1.
[0014] In another preferred embodiment, the detection reagent includes a PCR primer pair for specifically amplifying microRNA 107 or a fragment thereof.
[0015] In another preferred embodiment, the PCR primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and / or a downstream primer as shown in SEQ ID NO.3.
[0016] In another preferred embodiment, the detection reagent includes a modified nucleic acid that specifically recognizes microRNA 107 or a fragment thereof, a labeled nucleic acid probe, a fluorescent molecule, a nanoparticle, a small molecule compound, or a combination thereof.
[0017] In another preferred embodiment, the detection reagent includes a modified nucleic acid that specifically recognizes the precursor form of microRNA 107, a labeled nucleic acid probe, a fluorescent molecule, a nanoparticle, a small molecule compound, or a combination thereof.
[0018] In another preferred embodiment, the label is selected from the following group: fluorescent group label, nanoparticle label, or a combination thereof.
[0019] In another preferred embodiment, the nucleic acid probe is labeled with a fluorescent group and / or a quencher group.
[0020] In another preferred embodiment, the fluorescent group is labeled at the 5' end of the detection probe; and the quencher group is labeled at the 3' end of the detection probe.
[0021] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, VIC, JOE, TET, CY3, CY5, ROX, TexasRed, LC RED460, or a combination thereof.
[0022] In another preferred embodiment, the quenching group is selected from the following group: BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.
[0023] In another preferred embodiment, the nanoparticles are selected from the following group: gold nanoparticles, silver nanoparticles, quantum dots, or a combination thereof.
[0024] In another preferred embodiment, the diagnosis includes early diagnosis, auxiliary diagnosis, combined diagnosis, or a combination thereof.
[0025] In another preferred embodiment, the diagnosis includes differential diagnosis of pneumonia and tuberculosis.
[0026] In another preferred embodiment, the diagnosis uses extracellular vesicle miR-107 as a single target for the diagnosis of infection.
[0027] In another preferred embodiment, the diagnosis combines extracellular vesicle miR-107 with other targets for diagnosis.
[0028] In another preferred embodiment, the miR-107 is derived from mammals.
[0029] In another preferred embodiment, the mammals include humans and non-human mammals, preferably primates (such as humans).
[0030] In another preferred embodiment, the microRNA 107 (abbreviated as miR-107) is in a mature form.
[0031] In another preferred embodiment, the miR-107 is extracellular vesicle miR-107.
[0032] In another preferred embodiment, the extracellular vesicle miR-107 is derived from pathological and / or non-pathological body fluids.
[0033] In another preferred embodiment, the pathological and / or non-pathological body fluid is selected from the following group: extracellular vesicles of peripheral blood plasma, peripheral blood, lymphocytes, throat swab samples, alveolar lavage fluid, saliva, pleural effusion, or a combination thereof.
[0034] In another preferred embodiment, the detection is a detection of an in vitro sample.
[0035] In another preferred embodiment, the in vitro sample is selected from the following group: a blood sample, a body fluid sample, a tissue sample, a cell sample, or a combination thereof.
[0036] In another preferred embodiment, the sample is selected from whole blood, serum or plasma samples, preferably a plasma sample.
[0037] In another preferred example, the sample is a blood sample.
[0038] In another preferred embodiment, the detection is detecting the presence or absence and / or expression level of miR-107 in the sample.
[0039] In another preferred embodiment, if the expression level of the marker is significantly higher than that of the normal population, it indicates that the subject is suffering from pulmonary tuberculosis.
[0040] In another preferred embodiment, if the expression level E1 in the detected sample is significantly higher than the control reference value E0, the probability of the detected subject developing tuberculosis is greater than that of the general population.
[0041] In another preferred embodiment, the control reference value is the expression level of miR-107 in samples from healthy people and / or pneumonia people.
[0042] In another preferred embodiment, the “significantly higher than” refers to a ratio of E1 / E0 of ≥1.2, preferably ≥1.5, and more preferably ≥1.8.
[0043] In another preferred embodiment, the extracellular vesicle miR-107 is used to diagnose an infection type selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium tuberculosis complex, nontuberculous mycobacteria, bacterial infection, or a combination thereof.
[0044] In a second aspect of the present invention, a kit for diagnosing pulmonary tuberculosis is provided, the kit comprising:
[0045] (a) a detection reagent for microRNA 107; and
[0046] (b) instructions, wherein the instructions indicate that the kit is used for diagnosing pulmonary tuberculosis.
[0047] In another preferred embodiment, the kit further contains a reference substance or a quality control substance.
[0048] In another preferred embodiment, the reference substance or quality control substance is selected from the full-length microRNA 107, its precursor form, mature form, its cDNA or a fragment thereof.
[0049] In another preferred embodiment, the microRNA 107 nucleotide sequence is shown as SEQ ID NO.1.
[0050] In another preferred embodiment, the detection reagent is a PCR primer pair for specifically amplifying microRNA 107 or a fragment thereof.
[0051] In another preferred embodiment, the PCR primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0052] In another preferred embodiment, the instructions include the following content: if the expression level E1 of microRNA 107 in the sample from the test subject is significantly higher than the control reference value E0, it indicates that the test subject is a tuberculosis patient, or the possibility of tuberculosis is higher than that of the general population.
[0053] In another preferred embodiment, the sample is a blood sample, a tissue sample, or a combination thereof.
[0054] In another preferred embodiment, the sample is selected from whole blood, serum or plasma samples, preferably a plasma sample.
[0055] In another preferred embodiment, the sample is a plasma sample.
[0056] In another preferred embodiment, the control reference value is the expression level of microRNA107 in samples from healthy people and / or pneumonia people.
[0057] In another preferred embodiment, the “significantly higher than” refers to a ratio of E1 / E0 of ≥1.2, preferably ≥1.5, and more preferably ≥1.8.
[0058] In another preferred embodiment, the infection type diagnosed by the kit is selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium tuberculosis complex, nontuberculous mycobacteria, bacterial infection, or a combination thereof.
[0059] In a third aspect of the present invention, a detection method is provided, comprising the following steps:
[0060] (a) provide test samples;
[0061] (b) detecting the expression amount or level of microRNA 107 in the test sample; and
[0062] (c) comparing the expression amount or level of the microRNA 107 with a control reference value; wherein, if the expression amount or level of the microRNA 107 in the test sample is significantly higher than the control reference value, it indicates that the test sample is a tuberculosis sample.
[0063] In another preferred embodiment, the sample is a blood sample or a tissue sample.
[0064] In another preferred embodiment, the sample is selected from whole blood, serum or plasma samples, preferably a plasma sample.
[0065] In another preferred embodiment, the expression level is detected by quantitative PCR.
[0066] In another preferred embodiment, the expression level is detected by a fluorescent colorimetric method.
[0067] In another preferred embodiment, the expression level is detected by quantum dot fluorescence colorimetry.
[0068] In another preferred embodiment, the expression level is detected by colloidal gold colorimetric method.
[0069] In another preferred embodiment, the control reference value is the expression level of microRNA107 in the same sample of healthy people or pneumonia people.
[0070] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.
[0071] In another preferred embodiment, the method is an in vitro method.
[0072] In a fourth aspect of the present invention, there is provided a method for diagnosing pulmonary tuberculosis, comprising the following steps:
[0073] a) providing a test sample from a subject to be tested, wherein the test sample is selected from the following group: a blood sample, a tissue sample or a combination thereof;
[0074] b) detecting the expression level of microRNA 107 in the test sample; and
[0075] c) comparing the expression level of the microRNA 107 with a control reference value.
[0076] In another preferred embodiment, if the expression level of microRNA 107 in the sample is significantly higher than the control reference value, it indicates that the subject to be tested is a tuberculosis patient or the probability of developing tuberculosis is higher than that of the general population.
[0077] In another preferred embodiment, the subject to be tested is a mammal, preferably a primate, and more preferably a human.
[0078] In another preferred embodiment, the sample is a blood sample, a tissue sample, or a combination thereof.
[0079] In another preferred embodiment, the blood sample is selected from whole blood, serum or plasma samples, preferably a plasma sample.
[0080] In another preferred embodiment, in step (b), the detection includes PCR, sequencing, or a combination thereof.
[0081] In another preferred embodiment, the detection is quantitative PCR detection.
[0082] In another preferred embodiment, the diagnosis includes early diagnosis, auxiliary diagnosis, combined diagnosis, or a combination thereof.
[0083] In another preferred embodiment, the general population includes healthy people and / or pneumonia people.
[0084] In a fifth aspect of the present invention, a use of a microRNA 107 inhibitor is provided for preparing a pharmaceutical composition for treating and / or preventing pulmonary tuberculosis.
[0085] In another preferred embodiment, the microRNA 107 inhibitor includes: small molecule compounds, nucleic acid drugs, gene editing drugs, or a combination thereof.
[0086] In another preferred embodiment, the inhibitor can reduce the plasma microRNA 107 level.
[0087] In a sixth aspect of the present invention, a microRNA 107 for diagnosing the occurrence of pulmonary tuberculosis is provided.
[0088] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0089] The accompanying drawings herein are incorporated into and constitute a part of the specification, illustrate embodiments consistent with the present invention, and together with the specification are used to explain the principles of the present invention. Obviously, the accompanying drawings described below are only some embodiments of the present invention, and for those of ordinary skill in the art, other accompanying drawings can be obtained based on these accompanying drawings without creative work.
[0090] Figure 1 The results showed that in the transcriptome sequencing samples, there was a statistical difference in the expression level of miR-107 in tuberculosis patients (TB) and healthy people (Health).
[0091] Figure 2 The left figure shows the expression level of miR-107 detected by qRT-PCR (****, P<0.0001, significant difference); the right figure shows the ROC curve of miR-107 in the embodiment of the present invention. DETAILED DESCRIPTION
[0092] Example embodiments will now be described more fully with reference to the accompanying drawings. However, example embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the present invention will be comprehensive and complete and fully convey the concept of the example embodiments to those skilled in the art.
[0093] Unless otherwise defined, all terms and phrases used herein include the meanings that the terms and phrases have in the art, unless explicitly stated to the contrary or clearly apparent from the context in which the terms and phrases are used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, specific methods and materials are now described.
[0094] After extensive and in-depth research, the inventors unexpectedly discovered microRNA 107, which can be used for the diagnosis of pulmonary tuberculosis. The experimental results confirmed that the expression level of microRNA 107 (abbreviated as miR-107) in the extracellular vesicles of peripheral blood plasma of tuberculosis patients was significantly higher than that of uninfected healthy people and / or pneumonia people. Extracellular vesicle miR-107 can be used as an important target for the diagnosis of tuberculosis.
[0095] Specifically, the present invention uses transcriptome sequencing to find miRNAs highly expressed in extracellular vesicles of tuberculosis patients' plasma, detects the expression level of extracellular vesicle miR-107 in multiple clinical samples, and further verifies the sequencing results, and determines that there is a significant difference in the expression level of extracellular vesicle miR-107 in the plasma extracellular vesicles of tuberculosis patients and healthy controls. Therefore, extracellular vesicle miR-107 can be used as a potential marker for diagnosing tuberculosis, and has good sensitivity and specificity. At the same time, because it is derived from extracellular vesicles in peripheral blood, it has the characteristics of convenient detection, non-invasiveness, safety, and high stability.
[0096] Compared with traditional sputum specimen detection, the more convenient and sensitive diagnostic method developed for extracellular vesicle miRNA in blood samples can be used as an effective supplement to the existing laboratory diagnosis method for tuberculosis. Extracellular vesicle miR-107 has the potential to be used as a biomarker for tuberculosis diagnosis. Based on this, the present invention is completed.
[0097] the term
[0098] As used herein, the term "sample" or "specimen" refers to material specifically associated with a subject from which specific information about the subject can be determined, calculated, or inferred. A sample may consist in whole or in part of biological material from a subject.
[0099] As used herein, the term "expression" refers to the production of microRNA 107 from a gene or a portion of a gene.
[0100] Extracellular vesicles
[0101] Extracellular vesicles are nanoscale vesicles composed of lipid bilayers secreted by cells and are widely distributed in various body fluids, including blood, urine, saliva, cerebrospinal fluid, etc. Extracellular vesicles contain components such as nucleic acids, lipids, proteins, and carbohydrates, which can be transported to target cells with body fluids, taken up by target cells through membrane fusion or endocytosis, and trigger downstream signaling pathways. And due to the protection of extracellular vesicles, nucleic acids and other substances in the vesicles can be protected from degradation by enzymes, and thus transported to target cells to complete intercellular communication. Based on the above characteristics, extracellular vesicles can be used as biomarkers for disease diagnosis.
[0102] Typically, the extracellular vesicles include microvesicles, exosomes and apoptotic bodies.
[0103] miRNA
[0104] miRNA (microRNA) is a type of small non-coding RNA with a length of about 22 nucleotides. They participate in a variety of biological processes by regulating gene expression in cells. Studies have shown that specific miRNA expression levels are closely related to the occurrence and development of certain diseases, so miRNA has the potential to be used as a biomarker for disease diagnosis.
[0105] Generally speaking, the mature form of miRNA is produced by degradation of its precursor form. Generally, the mature form is produced by degradation of its precursor form in the cytoplasm.
[0106] microRNA107
[0107] As used herein, the terms "marker of the present invention", "tuberculosis marker of the present invention", "miRNA of the present invention", or "microRNA107 of the present invention" or "miR-107" are used interchangeably to refer to microRNA107 or its corresponding nucleic acid sequence.
[0108] Specifically, the biological gene information of microRNA107 involved in the present invention is as follows: microRNA107, [Homosapiens (human)], Gene ID: 406901, updated on 12-sep-2024.
[0109] The microRNA 107 of the present invention includes its precursor form, mature body form, full-length microRNA 107 or its fragment (as long as the fragment can distinguish microRNA 107 from other nucleic acids). In addition, the term also includes nucleic acid molecules in RNA form or its cDNA form or DNA form. In addition, the term also includes nucleic acid molecules in single-stranded or double-stranded, positive strand and antisense strand form. In addition, the term also includes circular or linear marker nucleic acid molecules.
[0110] In a preferred embodiment of the present invention, the microRNA 107 is derived from extracellular vesicles.
[0111] In a preferred embodiment of the present invention, the microRNA 107 is derived from plasma extracellular vesicles.
[0112] In a preferred embodiment of the present invention, the microRNA 107 is derived from plasma exosomes.
[0113] Specifically, the extracellular vesicle miR-107 of the present invention can be used as a target for the diagnosis of tuberculosis infection in humans, and can also be used for the diagnosis of infections in other animals.
[0114] Detection Methods
[0115] Based on the high expression of microRNA107 in the plasma of pulmonary tuberculosis patients, the present invention also provides a corresponding method for diagnosing pulmonary tuberculosis.
[0116] The present invention relates to a diagnostic test method for quantitatively detecting the expression level of microRNA 107. These tests are well known in the art. The expression level of human pulmonary tuberculosis marker microRNA 107 detected in the test can be used to diagnose (including auxiliary diagnosis) whether the test subject has pulmonary tuberculosis.
[0117] A preferred method is to perform quantitative PCR detection on RNA or cDNA.
[0118] According to the experimental results of the present invention, a preferred method for diagnosing pulmonary tuberculosis patients is based on the expression level of microRNA 107. Preferably, the method includes the following judgment method: if the expression level of microRNA 107 in the serum and / or plasma and / or tissue sample of the test subject is significantly higher than that of the healthy population and / or pneumonia population, the test subject can be preliminarily judged to have pulmonary tuberculosis.
[0119] Detection Kits
[0120] Based on the correlation between microRNA107 and pulmonary tuberculosis, the present invention provides a kit for diagnosing pulmonary tuberculosis, wherein the kit contains a detection reagent for detecting microRNA107 (including its precursor form, mature form, full length, or fragments thereof). Preferably, the kit contains primers or primer pairs, probes or chips for specifically amplifying the pulmonary tuberculosis marker microRNA107. The kit may also contain the pulmonary tuberculosis marker microRNA107 or its cDNA of the present invention as a reference substance or quality control substance.
[0121] In another preferred embodiment, the reference substance or quality control substance is selected from the full-length microRNA 107, its precursor form, mature form, its cDNA or a fragment thereof.
[0122] In another preferred embodiment, the microRNA 107 nucleotide sequence is shown as SEQ ID NO.1.
[0123] In another preferred embodiment, the kit further comprises an instruction manual, wherein the instruction manual indicates that the kit is used for diagnosing pulmonary tuberculosis and / or predicting the occurrence of pulmonary tuberculosis.
[0124] In another preferred embodiment, the instructions include the following content: if the expression level E1 of microRNA 107 in the sample from the test subject is significantly higher than the control reference value E0, it indicates that the test subject is a tuberculosis patient, or the possibility of tuberculosis is higher than that of the general population.
[0125] ROC Curve
[0126] ROC curve is short for receiver operating characteristic curve, which is mostly used in the medical field to determine whether a certain factor has diagnostic value for the diagnosis of a certain disease. The ROC curve reflects the relationship between sensitivity and specificity. The horizontal axis X-axis is 1-specificity, also known as the false positive rate (false alarm rate). The closer the X-axis is to zero, the higher the accuracy; the vertical axis Y-axis is called sensitivity, also known as the true positive rate (sensitivity). The larger the Y-axis is, the better the accuracy is. According to the position of the curve, the entire graph is divided into two parts. The area under the curve is called AUC (Area Under Curve), which is used to indicate the prediction accuracy. The higher the AUC value, that is, the larger the area under the curve, the higher the prediction accuracy. The closer the curve is to the upper left corner (the smaller the X, the larger the Y), the higher the prediction accuracy.
[0127] The main advantages of the present invention include:
[0128] (1) The advantages of extracellular vesicle miRNA as a biomarker for disease diagnosis are its high sensitivity and specificity, as well as the stability of miRNA in extracellular vesicles;
[0129] (2) Compared with traditional sputum specimen testing, the more convenient and sensitive diagnostic method developed for extracellular vesicle miRNA in blood samples can serve as an effective supplement to the existing laboratory diagnostic methods for tuberculosis;
[0130] (3) Extracellular vesicle miR-107 has the potential to serve as a biomarker for tuberculosis diagnosis;
[0131] (4) Extracellular vesicle miR-107 has the potential to serve as a biomarker for evaluating tuberculosis treatment efficacy or disease progression.
[0132] The following is a further description of the biomarker panel for pulmonary tuberculosis diagnosis provided by the invention in conjunction with specific examples.
[0133] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples that do not specify detailed conditions are usually based on conventional conditions such as the conditions described in "Molecular Cloning Laboratory Guide" by Sambrook.J, USA (Huang Peitang, etc., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer (e.g., product instructions). Unless otherwise specified, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels or can be prepared according to literature methods unless otherwise specified.
[0134] Example 1 Screening of detection markers and verification of effects of the present invention
[0135] The samples selected in the present invention are peripheral blood from tuberculosis patients and healthy people. Plasma is separated from peripheral blood, extracellular vesicles in the plasma are extracted, and the expression of extracellular vesicle miRNA is detected by quantitative PCR. The expression of miR-107 in the plasma extracellular vesicles of the subjects is detected and compared with the expression of miR-107 in the healthy control group. If the expression of miR-107 in the subject is higher than that in the healthy control group, there is a higher risk of tuberculosis, thereby distinguishing tuberculosis patients from healthy people.
[0136] 1. Research subjects:
[0137] The subjects were collected from blood samples sent by the Tuberculosis Department of Shanghai Pulmonary Hospital and blood samples from the physical examination center. The plasma samples included 270 confirmed cases of Mycobacterium tuberculosis infection as the experimental group, i.e. tuberculosis (TB) patients; and 264 plasma samples from healthy people in the physical examination center as the healthy control group. All were regardless of gender and aged between 20 and 55 years old.
[0138] 2. Research methods:
[0139] (1) miRNA high-throughput sequencing
[0140] Four patients with tuberculosis (TB) were selected as the experimental group and four healthy controls (HC) were selected as the healthy control group. The total RNA in the extracellular vesicles of the plasma was extracted and sent to the company for transcriptome sequencing. The miRNAs upregulated in TB patients were screened according to the following requirements: 1) P < 0.05; 2) FC (abs) > 1; 3) the average expression level of at least one of the two groups of samples was higher than 2; 4) miRNAs with expression levels of 0 in all four samples in the group were excluded.
[0141] The sequencing results showed that has-miR-107 (abbreviated as miR-107) was upregulated in tuberculosis patients, and the log2 (FC) was 1.97 (PValue = 0.00034). A bar graph was drawn based on the mean expression value in the sequencing results, and statistical analysis was performed using GraphpadPrism 9.0.0 software. The results of the non-parametric test showed that there was a statistical difference (P = 0.0286) ( Figure 1 ).
[0142] (2) Detection of specific miRNA
[0143] The selected miRNAs were initially validated using samples from 10 healthy subjects and 8 tuberculosis patients, and miR-107 was screened to be upregulated in tuberculosis patients with significant differences. Subsequently, the sample size was expanded for validation.
[0144] ① Peripheral blood samples were collected from 250 healthy subjects and 268 tuberculosis patients, centrifuged at 800g for 10 min, and the upper plasma layer was taken for pretreatment of extracellular vesicles extraction.
[0145] ② The plasma obtained in step ① was centrifuged according to the following steps, and the supernatant was aspirated after each centrifugation and the precipitate was discarded: 1) 500g, 10min, 4℃; 2) 3000g, 20min, 4℃; 3) 12000g, 30min, 4℃;
[0146] ③ Use a commercial kit (exoRNeasy Midi Kit (50), QIAGEN, Cat. No. 77144) to extract RNA from extracellular vesicles according to the instructions, and use a Thermo Scientific NanoDrop spectrophotometer to detect the concentration and purity of RNA.
[0147] ④ Use a commercial kit (miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit (KR211), Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. KR211-02) to reverse transcribe RNA into cDNA, use a Thermo Scientific NanoDrop spectrophotometer to detect the concentration and purity of cDNA, and store it at -20°C until use.
[0148] ⑤ Purchase or design the primers of miRNA, among which the miR-107 primer was purchased from Tiangen Biochemical Technology CD201-0192. The cDNA obtained in step ④ was diluted 5 times with RNase-Free water to a final concentration of 100 ng / μl, and qPCR was performed using a 10 μl system according to the kit (miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (SYBR Green)). The relative quantitative method was used to analyze the content of miRNA in the sample, with U6 as the internal reference and 2 -△△t To indicate the relative expression level of miR-107.
[0149] (3) Statistical analysis
[0150] Graphpad Prism 9.0.0 software was used for statistical analysis. Data were expressed as mean ± standard error. Unpaired two-tailed t-test was used to compare the experimental group with the control group. Figure 2 , left figure). The diagnostic value of miRNA was analyzed by the receiver operating characteristic curve (ROC curve), and the area under the curve as well as the sensitivity and specificity were obtained, P = 0.0002 ( Figure 2 , right).
[0151] 3. Result analysis:
[0152] After further verification, it was confirmed that the expression level of miR-107 in plasma exosomes of tuberculosis patients was significantly higher than that in healthy controls ( Figure 1 , Figure 2 ). The expression level of miR-107 in plasma extracellular vesicles can be detected to distinguish tuberculosis patients from healthy people.
[0153] The expression of miR-107 in plasma extracellular vesicles of pneumonia patients showed an increasing trend, but there was no statistical difference compared with healthy controls. The expression of miR-107 in plasma extracellular vesicles of tuberculosis patients was significantly higher than that of the healthy control group. Therefore, the expression level of miR-107 can also be used to distinguish between patients with pulmonary tuberculosis and pneumonia.
[0154] Those skilled in the art will readily appreciate other embodiments of the present invention after considering the specification and practicing the invention disclosed herein. This application is intended to cover any variations, uses or adaptations of the present invention, which follow the general principles of the present invention and include common knowledge or customary techniques in the art that are not disclosed by the present invention. The specification and examples are intended to be exemplary only, and the true scope and spirit of the present invention are indicated by the appended claims.
[0155] Sequence information involved in the present invention:
[0156] SEQ ID NO.1AGCAGCAUUGUACAGGGCUAUCA
[0157] SEQ ID NO.2CAGCAGCATTGTACAGGGCTATCA upstream primer
[0158] SEQ ID NO.3GTGCAGGGTCCGAGGT downstream universal primer
[0159] References
[0160] [1]World Health Organization.Global tuberculosis report 2022.Geneva:World Health Organization,2022.
[0161] [2]Hannah Burke,Doriana Cellura,Anna Freeman,Alex Hicks,KrisOstridge,Alastair Watson,Nicholas P Williams,C Mirella Spalluto,KarlJStaples,Tom M A Wilkinson.Pulmonary EV miRNA profiles identify disease anddistinct inflammatory endotypes in COPD.Front Med(Lausanne).2022Dec 15:9:1039702.doi:10.3389 / fmed.2022.1039702.eCollection 2022.
[0162] [3]Christina M Eckhardt,Simone Gambazza,Tessa R Bloomquist,Peter DeHoff,Aishwarya Vuppala,Pantel S Vokonas,Augusto A Litonjua,David Sparrow,Faruque Parvez,Louise C Laurent,Joel Schwartz,Andrea ABaccarelli,HaotianWu.Extracellular Vesicle-Encapsulated microRNAs as Novel Biomarkers of LungHealth.Am J Respir Crit Care Med..2023Jan1;207(1):50-59.doi:10.1164 / rccm.202109-2208OC.
Claims
1. A use of microRNA 107 or a detection reagent thereof, characterized in that: Used for preparing reagents or kits for diagnosing pulmonary tuberculosis.
2. The use according to claim 1, characterized in that The nucleotide sequence of the microRNA 107 is shown in SEQ ID NO.
1.
3. The use according to claim 1, characterized in that The detection reagent includes a PCR primer pair for specifically amplifying microRNA 107 or a fragment thereof.
4. The use according to claim 3, characterized in that The PCR primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and / or a downstream primer as shown in SEQ ID NO.
3.
5. A kit for diagnosing pulmonary tuberculosis, characterized in that: The kit contains: (a) a detection reagent for microRNA 107; and (b) instructions, wherein the instructions indicate that the kit is used for diagnosing pulmonary tuberculosis.
6. The kit according to claim 5, characterized in that The nucleotide sequence of microRNA 107 is shown in SEQ ID NO.
1.
7. The kit according to claim 5, characterized in that The detection reagent is a PCR primer pair for specifically amplifying microRNA107 or a fragment thereof, and the PCR primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.
3.
8. The kit according to claim 5, characterized in that The instructions include the following content: if the expression level E1 of microRNA 107 in the sample from the test subject is significantly higher than the control reference value E0, it indicates that the test subject is a tuberculosis patient, or the possibility of developing tuberculosis is higher than that of the general population, and the "significantly higher" means that the ratio of E1 / E0 is ≥1.2, preferably ≥1.5, and more preferably ≥1.
8.
9. The kit according to claim 8, characterized in that The sample is a plasma sample.
10. A use of a microRNA 107 inhibitor, characterized in that: Used for preparing a pharmaceutical composition for treating and / or preventing pulmonary tuberculosis.