Molecular marker of rice strong stem and large panicle excellent genotype SCM3 and application thereof YCN1 Molecular marker of rice strong stem and large panicle excellent genotype SCM3 and application thereof
By developing molecular markers for the rice genotype SCM3YCN1, which has strong stems and large panicles, and using KASP technology for genotype detection, the problem of low breeding efficiency in existing technologies has been solved, and rapid and accurate genotype identification and an efficient breeding process have been achieved.
Patent Information
- Application Number
- CN202411624709.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-11-14
AI Technical Summary
The existing technology lacks effective molecular markers for screening and breeding strong-stem and large-panicle rice varieties, resulting in low breeding efficiency of high-yield and lodging-resistant varieties. In addition, the measurement of stem strength is time-consuming and labor-intensive, and difficult to observe in the field.
Molecular markers for the rice genotype SCM3YCN1, which has strong stems and large panicles, have been developed. KASP technology is used to detect nucleic acid variation sites, and genotyping is performed using specific primer sets and fluorescent linker sequences, providing a fast and accurate genotype identification method and simplifying the breeding process.
It achieves rapid and accurate genotype detection, improves breeding efficiency, reduces tedious experimental steps and the use of harmful chemicals, shortens breeding time, and increases the speed of selecting high-yield and lodging-resistant varieties.
Smart Images

Figure CN119464540B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of molecular markers, and relates to a molecular marker for screening of a rice strong stem and large panicle variety resource and an excellent genotype, in particular to a molecular marker for an excellent genotype SCM3 YCN1 of a rice strong stem and large panicle and application thereof. BACKGROUND
[0002] In recent years, with global warming, extreme gale and storm weather occurs frequently, which leads to easy occurrence of large-area lodging of rice at the grain filling and maturing period, causes reduction of rice quality and seed germination rate, and increases harvesting cost. The lodging phenomenon of high-yield varieties is more serious, and therefore, breeding of a rice variety with strong stem and large panicle can balance the relationship between high yield and lodging resistance, and is beneficial to realization of high yield and stable yield of rice. At present, variety resources and genes for breeding of a rice strong stem and large panicle type are still relatively few, which hinders breeding of a high-yield and lodging-resistant variety.
[0003] Stem strength is one of the most important agronomic traits of rice, and directly determines the bending resistance of the stem of rice. Improvement of the stem strength of rice can effectively enhance the lodging resistance of rice. However, determination of the stem strength of rice is time-consuming and laborious, and cannot be observed from the field phenotype, which limits the selection efficiency of breeders in lodging-resistant breeding.
[0004] The SCM3 gene reported by the previous person can effectively improve the stem strength, but is from an indica rice variety, and causes reduction of tillering. At present, rice strong stem and large panicle variety resources are still relatively few in China, which limits breeding of a high-yield, lodging-resistant and high-quality conventional japonica rice. Marker-assisted selection (MAS) technology directly selects the genotype of a variety, is not affected by the environment, and has the advantages of low cost, high efficiency and strong reliability. However, so far, a molecular marker directly used for selection of a rice strong stem and large panicle has not been found. If a rice strong stem and large panicle variety can be created or screened, and genetic variation of the stem strength-related gene of the variety is analyzed, and an operable molecular marker is developed, MAS breeding will effectively improve the breeding speed of a new rice variety with high yield and lodging resistance. SUMMARY
[0005] The technical problem to be solved by the present application is to provide a molecular marker for an excellent genotype SCM3 YCN1 of a rice strong stem and large panicle.
[0006] The technical problem to be solved by the present application is to provide a molecular marker for an excellent genotype SCM3 YCN1 of a rice strong stem and large panicle.
[0007] The application also aims to provide the application of the primer set or the kit in identifying, screening or breeding the strong culm and large panicle type rice.
[0008] The application also aims to provide a method for obtaining the strong culm and large panicle type rice.
[0009] The application also aims to provide a method for detecting the strong culm and large panicle type rice gene SCM3.
[0010] Technical scheme: In order to solve the above technical problems, the application provides a molecular marker of a strong culm and large panicle type rice excellent genotype SCM3 YCN1 , the molecular marker is SCM3 YCN1 _k_28430214, the nucleic acid variation site detected by the SCM3 YCN1 _k_28430214 is located at the base T or G at the 28430214th base of the 3rd chromosome of the rice reference genome MSU7.0.
[0011] The application also includes a primer set for detecting the molecular marker of the strong culm and large panicle type rice excellent genotype SCM3 YCN1 , and the primer set includes a specific primer pair as follows:
[0012] SCM3 YCN1 _k_28430214Rc X:GGAGTTCGATCTTAGTGCCGTAC;
[0013] SCM3 YCN1 _k_28430214Ra Y:GGAGTTCGATCTTAGTGCCGTAA.
[0014] The application also includes the primer set, and the primer set further includes a universal primer as follows: AGGATCAGTGGGAGCTCGG.
[0015] The specific primers are respectively connected with different fluorescent linker sequences, and the fluorescent linker sequences are FAM or HEX fluorescent linker sequences.
[0016] The application also includes a kit for detecting the strong culm and large panicle type rice gene SCM3 YCN1 SNP molecular marker, and the kit includes the primer set.
[0017] The application also includes the application of the primer set or the kit in identifying, screening or breeding the strong culm and large panicle type rice.
[0018] The application also relates to a method for obtaining a strong culm and large panicle rice variety, which comprises making the base at position 28430214 on chromosome 3 of the rice reference genome MSU7.0 a T.
[0019] The application also relates to a method for detecting a strong culm and large panicle gene SCM3 YCN1 of rice, which comprises the following steps:
[0020] 1) extracting genomic DNA of a rice sample;
[0021] 2) performing KASP reaction on the SCM3 YCN1 _k_28430214 molecular marker by using the primer set or the kit as the template;
[0022] 3) performing fluorescence detection on the sample after the reaction on an enzyme marker, obtaining genotyping results by using an SNP automatic typing tool, and detecting FAM fluorescence signals of the amplified sample on the enzyme marker, then obtaining genotyping results by using the SNP automatic typing tool, and determining that the SNP site is base G, so that the rice sample is homozygous SCM3 YCN1 , and the rice plant shows non-strong culm and large panicle; detecting HEX fluorescence signals of the amplified sample on the enzyme marker, then obtaining genotyping results by using the SNP automatic typing tool, and determining that the SNP site is base T, so that the rice sample is homozygous SCM3 YCN1 , and the rice plant shows strong culm and large panicle; simultaneously detecting FAM and HEX fluorescence signals of the amplified sample on the enzyme marker, then obtaining genotyping results by using the SNP automatic typing tool, and determining that the SNP site is base G / T heterozygote, so that the rice sample is heterozygous SCM3 YCN1 / scm3, and the rice plant shows strong culm and large panicle.
[0023] In the step 2), the amplification reaction system of the KASP reaction comprises the following components: a DNA template, a PARMS master mix, the primer set, ddH2O and mineral oil.
[0024] The PCR amplification reaction system is as follows:
[0025]
[0026] The PCR amplification reaction conditions are as follows:
[0027]
[0028] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages: the present application is aimed at creating and genome sequencing and analyzing a good genotype SCM3 of an SCM3 gene capable of increasing stem strength and grain number per panicle through strong stem and large panicle type material YCN1 . The molecular marker developed by using the variation site of the good genotype SCM3 YCN1 can be used for improving the yield and lodging resistance of rice, and can accelerate the breeding of high-yield and lodging-resistant varieties. The present application can predict the phenotype by detecting the genotype at the seedling stage, save the breeding time, and reduce the planting area. The present application uses KASP technology to genotype the developed SNP marker, which can quickly and accurately detect the good genotype SCM3 YCN1 , and the high-throughput application in commercial molecular breeding, at the same time, without the cumbersome procedures such as PCR, enzyme digestion, gel electrophoresis and sequencing in the experimental process, reduces the use of harmful chemicals and manual work, greatly improves the selection efficiency in the breeding process. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 QTLseq analysis of strong stem and large panicle in Yangchanuo No. 1 x Wuxiangjing 5245 F2 population;
[0030] Figure 2 SCM3 YCN1 _k_28430214 marker genotyping map;
[0031] Figure 3 SCM3 YCN1 indel-2 marker genotyping map;
[0032] Figure 4 Stem breaking resistance analysis of 42 rice varieties;
[0033] Figure 5 Analysis of the second node stem diameter of 42 rice varieties;
[0034] Figure 6 Analysis of grain number per panicle of 42 rice varieties;
[0035] Figure 7 Analysis of seed setting rate of 42 rice varieties;
[0036] Figure 8 SCM3 genotype and breaking resistance analysis of 32 Yangchanuo No. 1 x Wuxiangjing 5245 F2:3 lines; figure legend: the letters under the horizontal coordinate line represent the variation site of the SCM3 YCN1 _k_28430214 molecular marker detected by SCM3
[0037] Figure 9Analysis of SCM3 genotypes and stem diameters of 32 Yangchannuo 1×Wuxiangjing 5245F2:3 lines; Figure legend: The letters below the line number on the horizontal axis represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker.
[0038] Figure 10 Analysis of SCM3 genotypes and grain number per ear of 32 Yangchannuo 1×Wuxiangjing 5245F2:3 lines; Legend: The letters below the line number on the horizontal axis represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker;
[0039] Figure 11 Analysis of SCM3 genotypes and flexural strength of 30 Yangchannuo 1×Nanjing 5718F2:3 lines; Figure legend: The letters below the line number on the horizontal axis represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker;
[0040] Figure 12 Analysis of SCM3 genotypes and stem diameters of 30 Yangchannuo 1×Nanjing 5718F2:3 lines; Figure legend: The letters below the line number on the horizontal axis represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker;
[0041] Figure 13 Analysis of SCM3 genotypes and grain number per ear of 30 Yangchannuo 1×Nanjing 5718F2:3 lines; Legend: The letters below the line number on the horizontal axis represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker. DETAILED DESCRIPTION
[0042] Example 1
[0043] 1. Discovery of strong-stem and large-spike variety resources and QTLseq analysis of strong-stem and large-spike gene loci
[0044] The variety Yangchannuo No. 1 (Gan Shen Rice 20190032, https: / / www.ricedata.cn / variety / varis / 619751.htm), developed by our breeding team, has demonstrated excellent lodging resistance and high yield in the field (Table 1). Table 1 shows that compared to the widely planted rice varieties Nanjing 9108 and Nanjing 46, Yangchannuo No. 1 exhibits significantly greater stem breakage resistance, stem diameter at the second node, number of grains per panicle, and 1000-grain weight, demonstrating superior lodging resistance and high yield.
[0045] In order to explore and utilize the excellent lodging-resistant genotypes in the Yangchannuo No. 1 variety, we prepared a hybrid combination of Yangchannuo No. 1 and Wuxiangjing 5245 (variety right number: CNA20191002045) and constructed an F2 segregating population. From this, 30 individual plants with strong stems and large panicles and 30 individual plants with non-strong stems and large panicles were selected for mixing to construct a mixed pool of strong stems and large panicles and a mixed pool of non-strong stems and large panicles. We extracted DNA from the two extreme mixed pools of strong stems and large panicles of the two parents, Yangchannuo No. 1 and Wuxiangjing 5245, and the F2 segregating population of non-strong stems and large panicles, and sent them to Shanghai Lingen Biotechnology Co., Ltd. for genome resequencing and QTLseq analysis. The analysis results showed that there was a significant QTL locus for strong stems and large panicles in the interval 28400000-28600000 of chromosome 3 ( Figure 1 ).
[0046] To further explore and utilize genetic resources contributing to strong stems and large panicles, we used next-generation genome sequencing to analyze the sequence of chromosome 3 (range 28400000-28600000) of Yangchannuo 1. We then compared the sequence with the reference genome of Nipponbare (genebank: AP014959.1) and performed gene functional annotation analysis. This analysis revealed a gene, SCM3, that controls stem diameter within this region. Further sequence alignment of the SCM3 gene in four rice varieties—Yangchannuo 1, Wuxiangjing 5245, and Nipponbare—discovered two variants within this gene. One is located at base 28428731 (- / TGTG) on chromosome 3 of the rice reference genome MSU7.0, and the other is a single-base variant (G / T) at base 28430214, 1206 bp downstream of the ATG on chromosome 3 of the rice reference genome MSU7.0. The genotypes of the two variant sites in the SCM3 gene of the two strong-stem and large-spike varieties Yangchannuo No. 1 were consistent with the genotypes of the strong-stem and large-spike mixed pool in the above QTLseq analysis. Therefore, the SCM3 genotype with strong-stem and large-spike in Yangchannuo No. 1 was named SCM3. YCN1 (Table 2).
[0047] Table 1 Comparison of main agronomic traits of Yangchannuo 1, Nanjing 9108 and Nanjing 46
[0048]
[0049] Note: The last four columns of the table are the means plus or minus standard errors of 9 biological replicates.
[0050] Table 2 Comparison of SCM3 genotypes of five varieties including Yangchannuo No. 1
[0051]
[0052] 2. Molecular marker development
[0053] Based on the TGTG / - variant site, we developed the molecular marker SCM3 using the primer design and development tool of Rice Variation Map v2.0 (http: / / ricevarmap.ncpgr.cn / primer_by_id / ) on the rice variation database website. YCN1 Based on the G / T variant site, the molecular marker SCM3 was developed using the SNP typing tool website http: / / www.snpway.com / of Wuhan Jingpeptide Biotechnology Co., Ltd. YCN1 _k_28430214 (Table 4). SCM3 YCN1 The design of indel-2 primers includes two specific forward and reverse primers, SCM3 YCN1 The design of the _k_28430214 primers includes two specific primers and one universal primer. The primer set sequences are shown in Tables 3 and 4:
[0054] Table 3 Molecular marker SCM3 YCN1 Primers for indel-2
[0055]
[0056] Table 4 Primers for molecular marker SCM3_k_28430214
[0057]
[0058] 3. Detection of molecular markers
[0059] The SNP sites were detected using KASP technology, and the indel sites were detected using PCR and polyacrylamide gel electrophoresis technology. The method includes the following steps:
[0060] S1. Extract genomic DNA from rice leaf tissues of Yangchannuo 1, Wuxiangjing 5245 (variety right number: CNA20191002045), and Nanjing 5718 (variety right number: CNA20171721.3, approval number: Sushendao20210047).
[0061] S2, using the genomic DNA of Yangchannuo 1, Wuxiangjing 5245 and Nanjing 5718 as templates, the KASP reaction was detected using the primer combination SCM3_k_28430214; YCN1 _k_28430214Rc X The fluorescent linker sequence is FAM fluorescent linker sequence, SCM3 YCN1_k_28430214 The fluorescence linker sequence is the HEX fluorescence linker sequence; the fluorescence linker sequence is the fluorescence linker sequence designated by the KASP reaction reagent. PARMS mix (E001-1) of Wuhan Jingpeibio Technology Co., Ltd. is selected, and FAM or HEX fluorescence linker sequence is connected to the 5' end of the two specific primers during primer synthesis. The specific amplification reaction system and conditions are shown in Table 5 and Table 6.
[0062] Table 5 PCR amplification reaction system (PARMS mix Wuhan Jingpeibio)
[0063]
[0064] Table 6 PCR amplification reaction conditions (double-head 384 PCR instrument ABI Gene Amp 9700)
[0065]
[0066] After PCR, the fluorescence signal is read by TECAN infinite M1000 enzyme label instrument, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) is used to analyze and convert the fluorescence signal to obtain clear and intuitive typing chart (as shown in Figure 2 ), and the genotype results are output according to the color difference.
[0067] If SCM3 YCN1 _k_28430214 The reaction sample is detected by fluorescence on the enzyme label instrument TECAN INFINITEFNANO+, and the genotyping result is obtained by the SNP automatic typing tool of the online website SNPWay (http: / / www.snpway.com / ) of Wuhan Jingpeibio Technology Co., Ltd. The fluorescence detection of the amplified sample on the enzyme label instrument TECAN INFINITE F NANO+ is FAM fluorescence signal, and then the genotyping result obtained by the SNP automatic typing tool shows that the SNP site is base G, corresponding to the blue dot Figure 2 , it is judged that the rice sample is a homozygous scm3 genotype, and the rice plant shows non-stout panicle and large panicle; the fluorescence detection of the amplified sample on the enzyme label instrument TECAN INFINITE F NANO+ is HEX fluorescence signal, and then the genotyping result obtained by the SNP automatic typing tool shows that the SNP site is base T, corresponding to the green dot Figure 2 , it is judged that the rice sample is a homozygous SCM3 YCN1Genotype, the rice plants showed strong stem and large panicle; the amplification sample was detected for FAM and HEX fluorescence signals simultaneously on the TECAN INFINITE FNANO+ enzyme label instrument, and then the genotyping result obtained by the SNP automatic typing tool showed that the SNP site was base G / T heterozygous, corresponding to Figure 2 SCM3 YCN1 / scm3 genotype, the rice plants showed strong stem and large panicle (as shown in Figure 2 ).
[0068] S3, the genomic DNA of Yangyan Nuo No. 1, Wu Xiangjian 5245 and Nangjing 5718 was used as a template, and the indel site was detected by PCR and acrylamide gel electrophoresis using SCM3 YCN1 indel-2 primer combination; the molecular marker detection was performed using the conventional Polymerase Chain Reaction (PCR) amplification technology in the laboratory. The 10 μL reaction system included template DNA (about 15 ng μL -1 ) 1 μL, forward and reverse primers (forward and reverse primers in Table 3) 0.4 μL (10 μmol L -1 ) each, 2xNG PCR MasterMix 5 μL (Shanghai Huiling Biotechnology Co., Ltd., NG001M), and sterilized double distilled water 3.2 μL. Amplification was performed on a PCR instrument, and the reaction conditions were as follows: (1) 95℃, pre-denaturation for 5 min; (2) 95℃, 30 sec; 55℃, 30 sec; 72℃, 30 sec; a total of 35 cycles; (3) 72℃, extension for 10 min. After amplification, 3 μL of the PCR product was taken and spotted into an 8% polyacrylamide gel well, and after electrophoresis separation of the band, silver staining was performed with silver nitrate solution, color development was performed with NaOH solution, and the band size information was read.
[0069] If the SCM3 YCN1 indel-2 primer detected a 114 bp band, it was determined that the rice sample was homozygous for the SCM3 YCN1 genotype, showing strong stem and large panicle; if the SCM3 YCN1 indel-2 primer detected a 110 bp band, it was determined that the rice sample was homozygous for the scm3 genotype, showing non-strong stem and large panicle; if the SCM3 YCN1 indel-2 primer detected 114 bp and 110 bp bands at the same time, it was determined that the rice sample was heterozygous for the SCM3 YCN1 / scm3 genotype. (as shown in Figure 3 ).
[0070] The above experimental results show that the KASP type molecular marker SCM3 YCN1_k_28430214 and indel type molecular marker SCM3 YCN1 indel-2 can quickly, accurately and efficiently detect the excellent allelic genotype SCM3 of the strong culm and large panicle variety Yangyanchun 1 YCN1 SCM3 YCN1 _k_28430214 as a KASP type molecular marker can accurately, quickly and efficiently genotype rice samples on a large scale, and can provide an efficient genotype identification and analysis tool for high-yield and lodging-resistant rice molecular marker-assisted selection breeding. YCN1 indel-2 as an indel type molecular marker can be completed in a simple molecular laboratory and can detect a small number of samples.
[0071] Example 2 Variety Resource Evaluation
[0072] We used two molecular markers SCM3 YCN1 indel-2 and SCM3 YCN1 _k_28430214 developed in Example 1 to analyze the SCM3 genotype of 42 Jiangsu rice variety resources containing Yangyanchun 1 (Table 7). YCN1 indel-2 and SCM3 YCN1 _k_28430214 molecular marker detection and analysis method and steps refer to Example 1.
[0073] The molecular marker analysis results showed that Yangyanchun 1, Lianjing 15, and Sidao 20, a total of 4 rice variety resources, SCM3 YCN1 indel-2 molecular marker detection was 114 bp fragment, which was the genotype containing TGTG insertion. In the Yangyanchun 1 rice variety, SCM3 YCN1 _k_28430214 molecular marker detection was the base T genotype. The rice variation data website query showed that the SNP site of SCM3 gene 3 'UTR region was located at the 28430214th base of the 3rd chromosome of the rice reference genome MSU7.0, 1206 bp downstream of ATG, and the base T genotype accounted for only 0.7% in 4726 rice germplasm resources, 0.5% in 2759 indica rice germplasm resources, and 1.1% in 1512 japonica rice germplasm resources (https: / / ricevarmap.ncpgr.cn / vars_info / ). SCM3 YCN1 _k_28430214 molecular marker detection of Yangyanchun 1 SCM3 gene ATG downstream 1206 bp base T variation was highly specific in rice natural population.
[0074] We analyzed the lodging resistance and yield traits of the 42 rice varieties in Jiangsu Province (Table 7). Figure 4 ) and the diameter of the second node of the stem is as follows ( Figure 5 ) is significantly higher than other varieties, and the number of grains per spike of the main stem is as follows ( Figure 6 ) was significantly higher than other varieties, and the fruit setting rate ( Figure 7 ) had no significant difference.
[0075] The above experimental results show that the SNP site in the 3' region of the SCM3 gene of Yangchannuo No. 1 (a single base variation, G / T, located at base 28430214 on chromosome 3 of the rice reference genome MSU7.0, 1206 bp downstream of ATG) is highly correlated with its strong stems and large panicles and has significant specificity. YCN1 _k_28430214 detected and analyzed the offspring of the breeding population with Yangchannuo No. 1 as the donor parent, and it can identify the superior allele type SCM3 efficiently, quickly and accurately. YCN1 , accelerating the breeding of new high-yield and lodging-resistant rice varieties.
[0076] Table 7 Molecular marker information and lodging resistance and yield traits of 42 rice varieties
[0077]
[0078]
[0079] Example 3
[0080] Yangchannuo No. 1 (Gan Shen Rice 20190032) has the best comprehensive agronomic performance in terms of stem bending resistance, number of grains per panicle, number of panicles, etc. It is an excellent donor parent for hybrid breeding of high-yield and lodging-resistant varieties. We selected the high-quality and delicious fragrant rice variety Wuxiangjing 5245 (variety right number: CNA20191002045) as the male parent and combined it with Yangchannuo No. 1 to construct a breeding segregation population. In March 2021, the hybrid F1 of Yangchannuo No. 1 × Wuxiangjing 5245 was obtained through hybridization in Hainan. From June to October 2021, the F1 plants of the combination of Yangchannuo No. 1 × / Wuxiangjing 5245 were planted in Yangzhou, and the F2 seeds were harvested. In December 2021, the F2 seeds of the combination of Yangchannuo No. 1 × / Wuxiangjing 5245 were planted in Hainan to obtain F2 population plants. In the F2 population, we used SCM3 YCN1 The SCM3 genotypes of 300 plants were determined by the _k_28430214 molecular marker, and 32 homozygous SCM3 YCN1Genotypic single seed collection, 2022 June-October in Yangzhou; 25 days after the plants were in the same ear, select 5 plants with consistent growth for stem breaking strength and stem diameter determination. The detection method and steps of SCM3 genotype of Yangyuan Nuo No. 1 x Wuxiangjing 5245 F2 plants are referred to Example 1. The detection results of SCM3 genotype of Yangyuan Nuo No. 1 x Wuxiangjing 5245 F2 plants are shown in Figure 8 、 Figure 9 and Figure 10 . The stem breaking strength of the plant lines with T base detected by SCM3 YCN1 _k_28430214 molecular marker in Yangyuan Nuo No. 1 x Wuxiangjing 5245 F2:3 is significantly higher than that of the plant lines with G base, as shown in Figure 8 . The stem breaking strength of the plant lines with T base detected by SCM3 YCN1 _k_28430214 molecular marker in Yangyuan Nuo No. 1 x Wuxiangjing 5245 F2:3 is significantly higher than that of the plant lines with G base, as shown in Figure 9 . The stem breaking strength of the plant lines with T base detected by SCM3 YCN1 _k_28430214 molecular marker in Yangyuan Nuo No. 1 x Wuxiangjing 5245 F2:3 is significantly higher than that of the plant lines with G base, as shown in Figure 10 .
[0081] The above results show that the molecular marker SCM3 YCN1 _k_28430214 provided by the application can efficiently screen out rice plant lines with high stem strength and large panicle type in the offspring of Yangyuan Nuo No. 1 x Wuxiangjing 5245 separation population Figure 8 、 Figure 9 and Figure 10 ), which can be applied to molecular marker assisted selection breeding of high yield and lodging resistance of rice to improve breeding efficiency.
[0082] Example 4
[0083] Yangyuan Nuo No. 1 (GanShen rice 20190032) has the best agronomic performance of stem breaking strength, grain number per panicle, etc., and is an excellent donor parent for hybrid breeding of high yield and lodging resistance. We selected high-yield and high-quality taste variety Nangjing 5718 (variety right number: CNA20171721.3) as the male parent to mate with Yangyuan Nuo No. 1 to construct breeding separation population. In August 2021, Yangyuan Nuo No. 1 / Nangjing 5718 hybrid F1 was obtained by hybridization in Yangzhou, and F1 plants of Yangyuan Nuo No. 1 / Nangjing 5718 combination were planted in Hainan from December 2022 to April 2023, and F2 seeds were harvested. In June-October 2023, F2 seeds of Yangyuan Nuo No. 1 / Nangjing 5718 combination were planted in Yangzhou to obtain F2 population single plants. In the F2 population, we used SCM3 YCN1_k_28430214 molecular marker was used to detect the genotypes of 200 single plants of SCM3, and 30 plants of SCM3 YCN1 Homozygous genotype single plants were collected and planted in Hainan from December 2023 to April 2024; 25 days after the plants bloomed, 5 plants with consistent growth were selected to measure the stem breaking strength and stem diameter. The detection method and steps of the SCMs of the F2 plants of Yangchanu 1 / Nanjing 5718 were referred to Example 1.
[0084] The detection results of the SCMs of the F2 plants of Yangchanu 1 / Nanjing 5718 are shown in Figure 11 , Figure 12 and Figure 13 . The SCMs of the F2:3 plants of Yangchanu 1 / Nanjing 5718 YCN1 _k_28430214 molecular marker detected that the plants of the T base strain had a significantly higher stem breaking strength than the plants of the G base strain, as shown in Figure 10 . The SCMs of the F2:3 plants of Yangchanu 1 / Nanjing 5718 YCN1 _k_28430214 molecular marker detected that the plants of the T base strain had a significantly larger stem diameter than the plants of the G base strain, as shown in Figure 12 . The SCMs of the F2:3 plants of Yangchanu 1 / Nanjing 5718 YCN1 _k_28430214 molecular marker detected that the plants of the T base strain had a significantly higher panicle grain number than the plants of the G base strain, as shown in Figure 13 .
[0085] The above results show that the molecular marker SCM3 YCN1 _k_28430214 provided by the present application can efficiently screen rice strains with high stem strength and large panicle type in the offspring of the Yangchanu 1 / Nanjing 5718 separation population Figure 11 , Figure 12 and Figure 13 , and can be applied to molecular marker assisted selection breeding of high-yield and lodging-resistant rice to improve breeding efficiency.
Claims
1. Use of a primer set or kit in identifying or screening strong-stem and large-panicle type rice or cultivating strong-stem and large-panicle type rice, wherein the strong-stem and large-panicle type rice is rice with high stalk bending resistance, large diameter of the second internode of the stalk, and high number of grains per panicle on the main stem. The primer set includes the following specific primer pairs: SCM3 YCN1 _k_28430214Rc X: GGAGTTCGATCTTAGTGCCGTAC; SCM3 YCN1 _k_28430214Ra Y: GGAGTTCGATCTTAGTGCCGTAA; Universal primer: AGGATCAGTGGGAGCTCGG; The kit includes the primer set.
2. The use according to claim 1, characterized in that The specific primers are connected to different fluorescent linker sequences respectively, and the fluorescent linker sequence is a FAM or HEX fluorescent linker sequence.
3. A method for obtaining a rice variety with strong stems and large panicles, characterized in that: The method comprises the steps of making the base at position 28430214 on the third chromosome of the rice reference genome MSU7.0 be T, and the strong-stem and large-panicle rice variety is a rice with high stalk bending resistance, large diameter of the second internode of the stalk, and high number of grains per main stalk and panicle.
4. A method for detecting rice varieties with strong stems and large panicles, characterized in that: The following steps are involved: 1) Extract genomic DNA from rice samples; 2) Using rice genomic DNA as a template, use the primer set or the kit to cleave SCM3 YCN1 _k_28430214 molecular marker to perform KASP reaction; the primer set includes the following specific primer pairs: SCM3 YCN1 _k_28430214Rc X:GGAGTTCGATCTTAGTGCCGTAC;SCM3 YCN1 _k_28430214Ra Y: GGAGTTCGATCTTAGTGCCGTAA; universal primer: AGGATCAGTGGGAGCTCGG; The kit includes the primer set; 3) After the reaction, the sample is fluorescently detected on a microplate reader, and the genotyping results are obtained by the SNP automatic typing tool. The amplified sample is fluorescently detected on the microplate reader as a FAM fluorescent signal. Subsequently, the genotyping results obtained by the SNP automatic typing tool show that the SNP site is base G, and the rice sample is judged to be homozygous. scm3 Genotype, rice plants show non-strong stems and large panicles; the amplified sample is detected as a HEX fluorescence signal on the microplate reader, and then the genotyping result obtained by the SNP automatic typing tool shows that the SNP site is base T, which means the rice sample is homozygous. SCM3 YCN1 The rice plant has a strong stem and large panicle genotype; the strong stem and large panicle rice variety is a rice with high stem bending resistance, large stem internode diameter and high number of grains per panicle.
5. The method for detecting strong-stem and large-spike rice varieties according to claim 4, characterized in that: The amplification reaction system of the KASP reaction in step 2) includes: a DNA template, PARMS master mix, the primer set, ddH2O and mineral oil.
6. The method for detecting strong-stem and large-spike rice varieties according to claim 5, characterized in that: The PCR amplification reaction conditions are as follows: 。
Citation Information
Patent Citations
SNP marker of rice lodging-resistant gene and application of single nucleotide polymorphism marker
CN108048458A
Molecular marker of gene related to dominant early heading in rice material capable of early heading without decreasing yield, and use thereof
WO2022056767A1