RPA-CRISPR / Cas12a-LFD method and kit for detecting nitzschia multilistera

Abstract

The invention provides an RPA-CRISPR / Cas12a-LFD method and kit for detecting nitzschia multicolumn, the nucleotide sequence of an upstream primer is SEQ ID NO: 1, the nucleotide sequence of a downstream primer is SEQ ID NO: 2, and the sequence of a probe is TTATT; and the nucleotide sequence of the crRNA-2 used as the CRISPR RNA is SEQ ID NO: 3. According to the RPA-CRISPR-LFD detection method provided by the invention, the reaction can be completed in 40 minutes under the condition of 39 DEG C, the lowest detection limit of the genome can reach 1.63 * 10 < 1 > pg / mu L, and a target algae species is successfully detected in a field sample. The method has the advantages of short detection time, low requirements on instruments and equipment, extremely high specificity and sensitivity, extremely high application value on the field detection of the nitzschia multiflora, incomparable advantages in the aspects of prevention and control of the nitzschia multiflora, and wide application prospect. The method has positive significance in protection of sea areas and culture industries in China.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection of harmful algae, and specifically relates to an RPA-CRISPR / Cas12a-LFD method and a kit for detecting Pseudo-nitzschia multiseriate. Background Art

[0002] Pseudo-nitzschia multiseriformis is a toxic and harmful algae species that is widely distributed around the world and is also the main red tide species along my country's coast. This species produces the neurotoxin domoic acid (DA), which accumulates in fish and shellfish, thus endangering human health and causing damage to the aquaculture industry.

[0003] Microscopic examination is the most classic detection method, but it requires too high a level of personnel quality and is not easy to identify similar species. Molecular biology technology, as a powerful and powerful alternative method, can solve most of the problems of traditional methods, but it also has certain defects. Among the molecular detection technologies for Pseudo-nitzschia multiseriformis that have been reported so far, non-isothermal amplification technologies such as polymerase chain reaction (PCR) are limited by precision instruments and can only be performed under laboratory conditions, making it difficult to achieve field detection; isothermal amplification technologies, such as recombinase polymerase amplification (RPA), combined with lateral flow dipsticks (LFD), have achieved field detection, but there is a high risk of false positives, and primer dimers are inevitable, which seriously affects the interpretation of the results. Summary of the invention

[0004] The object of the present invention is to provide an RPA-CRISPR / Cas12a-LFD method and a kit for detecting Pseudo-nitzschia multiseriate, so as to achieve on-site rapid and sensitive detection of Pseudo-nitzschia multiseriate.

[0005] The present invention first provides an RPA-CRISPR / Cas12a-LFD primer and probe for detecting Pseudo-nitzschia multiseriate, and the sequence information thereof is as follows:

[0006] Upstream primer RPA-3-F: 5′-CGCAGCGAAATGCGATACGTAATGCGAATTGC-3′ (SEQ ID NO: 1),

[0007] Downstream primer RPA-3-R: 5′-CCAAAACAACCAGCTGCCAGCACGAGGCCAGC-3′ (SEQ ID NO: 2),

[0008] The sequence of the probe ssDNA-FB is TTATT.

[0009] The 5' end of the probe is labeled with FAM, and the 3' end is connected with Biotin.

[0010] The present invention also provides crRNA-2 used as CRISPR RNA in combination with the above primers and probes, and its sequence is as follows (SEQ ID NO: 3): 5′-UAAUUUCUACUAAGUGUAGAUGGGUAUUCCCGGUAGCAUGCUUG-3′

[0011] The present invention also provides a kit for detecting Pseudo-nitzschia multiseriate based on RPA-CRISPR / Cas12a-LFD technology, comprising the above-mentioned primer and probe combination and crRNA-2.

[0012] The present invention also provides a method for detecting Pseudo-nitzschia multiseriate, characterized in that it comprises the following steps:

[0013] 1) Extracting genomic DNA from the sample to be tested;

[0014] 2) Configure the RPA response system:

[0015] The total reaction system for RPA amplification is 50 μL, including 2.4 μL of 10 μM upstream primer, 2.4 μL of 10 μM downstream primer, 29.5 μL of buffer, 11.2 μL of ddH2O, 2 μL of DNA template of the sample to be tested, and 2.5 μL of 280 mM MgOAc solution. After oscillation and mixing, add them to the lyophilized tube containing RPA enzyme.

[0016] 3) Perform RPA amplification at 37°C for 20 min, purify with phenol / chloroform / isoamyl alcohol 25:24:1, add 1:1, centrifuge at 12000 rpm for 5 min, and take the supernatant;

[0017] 4) Configure the CRISPR reaction system:

[0018] The total reaction system of CRISPR is 20 μL, 1 μL of Cas12a protein with a concentration of 2 μM, 1 μL of ssDNA-FB with a concentration of 10 μM, 1 μL of crRNA with a concentration of 50 nM, 2 μL of buffer, 2 μL of RPA amplification product, and 13 μL of ddH2O;

[0019] 5) Perform CRISPR amplification at 39°C for 20 min;

[0020] 6) Perform LFD detection: add 8 μL of RPA amplification product to 92 μL of ddH2O and mix well, then place the LFD test strip spot area into the mixed solution and determine the result after 2 minutes.

[0021] The RPA-CRISPR / Cas12a-LFD detection primer and probe combination of Pseudo-nitzschia multiseriate provided by the present invention, as well as the construction method have the following advantages:

[0022] 1. High sensitivity, the minimum detection limit of genome can reach 1.63×10 1 pg / μL.

[0023] 2. Good specificity, crRNA and RPA primers were designed based on the ITS target sequence of Pseudo-nitzschia multiseriate.

[0024] 3. The detection speed is fast, and only two steps of reaction are required to complete the detection.

[0025] 4. Low requirements for instruments and equipment. No PCR instrument, electrophoresis instrument or gel imaging system is required. Only a constant temperature heater is needed to complete amplification and detection.

[0026] 5. The operator's professional quality requirements are relatively low. No professional algae experts are required. Only a little molecular biology knowledge is needed to complete the entire detection process of Pseudo-nitzschia multicolumnar. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 :Schematic diagram of RPA-CRISPR-LFD detection process.

[0028] Figure 2 : Schematic diagram of the test strip result determination process.

[0029] Figure 3 : Multi-column crRNA screening and RPA primer screening diagrams of Pseudo-nitzschia, wherein Figure a is a real-time fluorescence diagram of the optimal crRNA screening; Figure b is a comparison diagram of the highest fluorescence values ​​of the optimal crRNA screening, in which Figure 1: crRNA-1; 2: crRNA-2; 3: crRNA-3; Figure c is a real-time fluorescence diagram of the optimal RPA primer screening, and Figure d is a comparison diagram of the highest fluorescence values ​​of the optimal RPA primer screening, in which Figure 1: RPA-1; 2: RPA-2; 3: RPA-3.

[0030] Figure 4: Multi-column RPA amplification time screening diagram of Pseudo-nitzschia, where Figure a is the real-time fluorescence diagram of RPA amplification time screening, in which NC:ddH2O is the blank control of the template; 1:30min; 2:20min; Figure b is the comparison diagram of the highest fluorescence values ​​of RPA amplification time screening, in which NC:ddH2O is the blank control of the template; 1:30min; 2:20min.

[0031] Figure 5 : RPA-CRISPR / Cas12a-LFD system optimization diagram, wherein Figure a is a real-time fluorescence diagram for CRISPR reaction temperature screening, NC: ddH2O is a blank control for the template; 1: 35°C; 2: 37°C; 3: 39°C; Figure b is a comparison diagram for the highest fluorescence value for CRISPR reaction temperature screening, NC: ddH2O is a blank control for the template; 1: 35°C; 2: 37°C; 3: 39°C; Figure c is a real-time fluorescence diagram for Cas12a content screening, NC: ddH2O is a blank control for the template; 1: 2.0μl; 2: 1.5μl; 3: 1.0μl; 4: 0.5μl; Figure d is a comparison diagram for the highest fluorescence value for Cas12a content screening: NC: ddH2O is a blank control for the template; 1: 0.5μl; 2: 1.0μl; 3: 1.5μl; 4: 2.0μl.

[0032] Figure 6 : RPA-CRISPR / Cas12a-LFD system optimization diagram, wherein Figure a is the CRISPR reaction time screening diagram, 1: 10min; 2: 20min; 3: 30min; 4; 40min; Figure b is the ssDNA concentration screening diagram, 1: 500nmol / l; 2: 50nmol / l; 3: 5nmol / l; 4: 0nmol / l.

[0033] Figure 7: Evaluation effect diagram of the method of the present invention, wherein Figure a is a specific RPA-CRISPR / Cas12a-LFD detection diagram, NC is a blank control with ddH2O as a template; NC: blank control with ddH2O as a template; 1: Pseudo-nitzschia multiseries; 2-6: Pseudo-nitzschia sp.; 7: Skeletonema costatum; 8: Heterosigma akashiwo; 9: Phaeodactylumtricornutum; 10: Thalassiosira pseudonana; 11: Chaetoceros curvisetus; 12: Karenia mikimotoi; 13: Prymnesiumparvum; 14: Karlodinium veneficum; 15: Chrysotiladentata; 16: Rhodomonas salina; Figure b is the sensitivity RPA-CRISPR / Cas12a-LFD detection diagram, 1-8: Pseudo-nitzschia multicolumn genomic DNA concentration: 1.63×10 4 pg / μL-1.63×10 -3 pg / μL.

[0034] Figure 8 : Real field sample verification diagram, where Figure a is the South China Sea field sample RPA-CRISPR / Cas12a-LFD detection diagram, 1: XB 3.11; 2: XB 4.4; 3: XB 5.11; 4: XB 16.1; 5: XB 20.1; 6: XB 6.1; 7: XB 1.1; 8: DS 9.1; 9: XB 19.1; 10: XS 3.1; Figure b is the Bohai Sea field sample RPA-CRISPR / Cas12a-LFD detection diagram, where 1: 9801; 2: 9505; 3: 9503; 4: 9501; 5: 9305; 6: 9303; 7: 9301; 8: 9105; 9: 9103; 10: 9101. DETAILED DESCRIPTION

[0035] RPA-CRISPR-LFD technology is a new technology that combines recombinase polymerase amplification technology (RPA), clustered regularly interspaced short palindromic repeats (CRISPR) and lateral flow dipstick (LFD). RPA, as a pre-amplification step, only needs to react for 10 to 15 minutes in a constant temperature environment of 35 to 39°C to achieve exponential high-specificity DNA amplification. CRISPR can activate its trans-cleavage activity under the guidance of crRNA in the presence of target sequences to achieve transduction of detection signals. LFD is a detection device that can be combined with a variety of detection methods to greatly shorten the time it takes for the test results to appear. The fundamental principle of the LFD test strip is the combination of antibodies and antigens. The validity of the test strip can be judged by the control line, and the test results can be judged by the test line in the detection area, and they can be visualized with the naked eye. RPA-CRISPR-LFD technology is fast and efficient, with high sensitivity and strong specificity, and no equipment and technical restrictions. It has obvious advantages over traditional detection methods.

[0036] In order to improve the sensitivity and specificity of the detection method of the present invention, the present invention adopts the following steps:

[0037] 1) Design three pairs of crRNAs, named crRNA-1, crRNA-2, and crRNA-3, and use ITS universal primers (TW81, AB28) for PCR amplification instead of RPA amplification step, followed by conventional CRISPR reaction, and screen the best crRNA by fluorescence value;

[0038] 2) Use the best crRNA screened to screen RPA primers, design 3 pairs of RPA primers, name them RPA-1-F / R, RPA-2-F / R, and RPA-3-F / R, and screen them by fluorescence value;

[0039] 3) Using the best crRNA and RPA primers, first optimize the RPA amplification time, and then optimize the RPA-CRISPR-LFD reaction system, including Cas 12a protein amount optimization, reaction temperature optimization, probe concentration optimization, and reaction time optimization;

[0040] 4) Use the screened crRNA, RPA primers and reaction system to test the sensitivity and specificity of the method;

[0041] 5) Use the screened crRNA, RPA primers and reaction system to perform field validation of the method.

[0042] The experimental primers and probes screened and optimized during the establishment of the method of the present invention are shown in Table 1 Table 1: Sequence table of multiple columns of primers and probes of Pseudo-nitzschia

[0043]

[0044]

[0045] The algae strains used in the present invention include: Pseudo-nitzschia multiseries (NMBguh002-1-1), Prymnesium parvum (NMBjih029), Chaetoceroscurvisetus (NMBguh003-10), Thalassiosira pseudonana (NMBguh006), Skeletonema costatum (NMBguh0042), Karenia mikimotoi (NMBjah052), Karlodinium veneficum (NMBjah047-1), Prorocentrum donghaiense (NMBjah045), Chrysotila dentata (NMBjih026-1), Phaeodactylum triangularis (NMBjih027-1), and Chrysotila dentata (NMBjih028-1). tricornutum (CCMP2561), Pseudo-nitzschia sp., Heterosigma akashiwo, Rhodomonas salina.

[0046] The culture medium used was f / 2 medium. The algae were cultured in a 100 ml conical flask under fluorescent light with a light intensity of 15 to 20 μmol / (m 2 ·s), light-dark cycle of 12:12, and culture temperature of 16°C.

[0047] The present invention is further described in detail below in conjunction with implementation examples.

[0048] Example 1: Screening and optimizing primer-probe combinations related to RPA-CRISPR-LFD

[0049] The TwistAmpTM Basic kit was purchased from Shanghai Murray Biotechnology Co., Ltd.; the CRISPR / Cas12a protein was purchased from Guangzhou Meige Biotechnology Co., Ltd.; and the lateral flow test strips were purchased from Beijing Baoying Tonghui Biotechnology Co., Ltd.

[0050] 1. Design and screening of crRNA and RPA primers

[0051] According to the multiple ITS sequences of Pseudo-nitzschia published by NCBI, the PAM site (TTTN) was searched in this region, and the T7 promoter (TAATACGACTCACTATAGGG) and the Cas 12a structural sequence (TAATTTCTACTAAGTGTAGAT) were added to the 5'-end of the PAM sequence to design a total of 3 crRNAs. Then, ITS universal primers (TW81, AB28) were used for PCR amplification to replace the RPA amplification step, followed by a conventional CRISPR reaction, and the best crRNA was selected by fluorescence value screening. Subsequently, RPA primers were designed at both ends of the best crRNA and the fluorescence value was used for screening. The screening results are shown in the figure. Figure 3 As shown in (a, b), the fluorescence values ​​of crRNA-1 and crRNA-2 are higher, but the negative and positive fluorescence values ​​of crRNA-2 are more obvious, which can ensure the specificity of subsequent experiments, so crRNA-2 is selected as the best crRNA; Figure 3 As shown in (c, d), the positive fluorescence value of RPA-3-F / R is the highest, and is significantly different from its negative fluorescence value. While ensuring specificity, the amplification efficiency is significantly improved, so RPA-3-F / R is selected as the best primer. The optimal combination of crRNA and RPA primer set is as follows:

[0052] CRISPR RNA:

[0053] crRNA-2: 5′-UAAUUUCUACUAAGUGUAGAUGGGUAUUCCCGGUAGCAUGCUUG-3′,

[0054] RPA-3-F: 5′-CGCAGCGAAATGCGATACGTAATGCGAATTGC-3′;

[0055] RPA-3-R: 5′-CCAAAACAACCAGCTGCCAGCACGAGGCCAGC-3′;

[0056] The probe used in the fluorescence method was ssDNA-FT. The above crRNA and primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.

[0057] 2. RPA-CRISPR-LFD system optimization

[0058] 2.1RPA amplification time optimization

[0059] Reaction system: 2.4 μL of upstream primer at 10 μM, 2.4 μL of downstream primer at 10 μM, 29.5 μL of buffer, 11.2 μL of ddH2O, 2 μL of DNA template of the sample to be tested, 2.5 μL of MgOAc solution at 280 mM, and the amplification time was set to 20 min and 30 min. The reaction results are shown in Figure 2. Figure 4 shown.

[0060] 2.2 CRISPR reaction temperature optimization

[0061] The reaction temperature was set at three gradients, namely 35°C, 37°C, and 39°C. Figure 5 As shown in (a, b).

[0062] 2.3Cas12a content screening

[0063] Four Cas12a content gradients were set in the reaction system, namely 2.0 μl, 1.5 μl, 1.0 μl, and 0.5 μl. The reaction results are shown in Figure 5 (c, d) When the Cas12a content in the system is 1.0μl-2.0μl, the fluorescence value is significantly higher than 0.5μl. Considering the fluorescence value and cost factors, the Cas12a content is selected to be 1.0μl.

[0064] 2.4 CRISPR reaction time screening

[0065] The reaction time was set to three gradients, namely 10min, 20min, 30min, and 40min. Figure 6 When the reaction time was 20 min and 40 min, the positive band of the test strip was significantly higher than that of other reaction groups. Based on the experimental efficiency, 20 min was selected as the optimal reaction time for subsequent experiments.

[0066] 2.5 Optimization of probe ssDNA concentration

[0067] Reaction system: ssDNA-FB 1μL, ddH2O 19μL. ssDNA-FB was set at 4 concentration gradients, 500nmol / L, 50nmol / L, 5nmol / L, 0nmol / L. The reaction results are shown in Figure 6 (b) as shown.

[0068] In the LFD reaction, if the concentration of probe ssDNA is too high, the gold-labeled nanoparticles bound to ssDNA will escape from the control line and enter the detection line. If the concentration of ssDNA is too low, the gold-labeled nanoparticles will not be able to completely bind to ssDNA, ultimately leading to false positive results. In order to minimize this effect, through concentration screening, 500nmol / L, which has the lightest detection line when negative, was selected as the optimal ssDNA concentration for subsequent experiments.

[0069] Example 2: Specificity determination of RPA-CRISPR-LFD technology for detecting Pseudo-nitzschia multiseriformis

[0070] Sixteen common harmful algae, including Pseudo-nitzschia multiseries, Pseudo-nitzschia, Skeletonema costatum, Heterosigma akashiwo, Phaeodactylum tricornutum, Thalassiosira pseudonana, Chaetoceros curvisetus, Karenia mikimotoi, Prymnesium parvum, Karlodinium veneficum, Chrysotiladentata, and Rhodomonas salina, were selected for RPA-CRISPR-LFD specificity verification, and ddH2O was selected as the template as the negative control. After extracting algae genomic DNA, RPA-CRISPR-LFD technology was used for detection. The results are as follows: Figure 7 As shown in (a), it is shown that the primers and probe sequences provided by the present invention have good specificity and do not produce positive amplification reactions with other algae.

[0071] Example 3: Sensitivity determination of RPA-CRISPR-LFD technology for detecting Pseudo-nitzschia multiseriformis

[0072] Ezup column bacterial genomic DNA extraction kit was purchased from Shanghai Shenggong Biotechnology Co., Ltd. The genomic DNA of Pseudo-nitzschia multicolumns was extracted according to the kit instructions. The extracted genomic DNA template of Pseudo-nitzschia multicolumns (original concentration 1.63×10 4 pg / μL) was diluted 10-fold in a gradient and used as a reaction template. The results of the RPA-CRISPR-LFD test were as follows Figure 7(b) As shown in the multi-row Pseudo-nitzschia genome DNA sensitivity experiment, the sensitivity of the optimized RPA-CRISPR-LFD system was 1.63×10 1 pg / μL.

[0073] Example 4: Field validation of RPA-CRISPR-LFD technology for detecting Pseudo-nitzschia multiseriate

[0074] Real field samples were collected from the South China Sea (10 samples) and the Bohai Sea (10 samples). All water samples were filtered through a 0.22 μm membrane. The sample stations almost covered China's oceans and offshore aquaculture areas, representing the distribution of Pseudo-nitzschia multiseriformis from north to south. Figure 8 As shown in (a), a total of 8 samples were detected as positive, all from the South China Sea, and 3 of the positive samples showed relatively brighter bands. Figure 8 As shown in (b), all the samples tested were negative. This indicates that Pseudo-nitzschia multiseriformis is widely present in the waters of the South China Sea, and the cell concentration is relatively high in some areas.

Claims

1. A RPA-CRISPR / Cas12a-LFD primer and probe for detecting Pseudo-nitzschia multiseriate, characterized in that: The sequence information of the primer probe is as follows: The nucleotide sequence of the upstream primer is SEQ ID NO: 1, The nucleotide sequence of the downstream primer is SEQ ID NO:

2. The sequence of the probe is TTATT.

2. The primer and probe according to claim 1, characterized in that: The 5' end of the probe is labeled with FAM, and the 3' end is connected with Biotin.

3. A crRNA-2 used as CRISPR RNA in combination with the primer and probe according to claim 1, characterized in that: The sequence of the crRNA-2 is as follows: 5′-UAAUUUCUACUAAGUGUAGAUGGGUAUUCCCGGUAGCAUGCUUG-3′.

4. Use of the primers and probes described in claim 1 and the crRNA-2 described in claim 3 in the preparation of a preparation for detecting Pseudo-nitzschia multiseriate.

5. The use according to claim 4, characterized in that The preparation is an RPA-CRISPR / Cas12a-LFD detection kit.

6. A kit for detecting Pseudo-nitzschia multiseriate based on RPA-CRISPR / Cas12a-LFD technology, characterized in that: The kit comprises the primers and probes described in claim 1 and the crRNA-2 described in claim 3.

7. A method for detecting Pseudo-nitzschia multiseriate, characterized in that: The method is to use the kit according to claim 6 for detection, comprising the following steps: 1) Extracting genomic DNA from the sample to be tested; 2) Configure the RPA response system: The total reaction system for RPA amplification is 50 μL, including 2.4 μL of 10 μM upstream primer, 2.4 μL of 10 μM downstream primer, 29.5 μL of buffer, 11.2 μL of ddH2O, 2 μL of DNA template of the sample to be tested, and 2.5 μL of 280 mM MgOAc solution. After oscillation and mixing, add them to the lyophilized tube containing RPA enzyme. 3) Perform RPA amplification at 37°C for 20 min, purify with phenol / chloroform / isoamyl alcohol 25:24:1, add 1:1, centrifuge at 12000 rpm for 5 min, and take the supernatant; 4) Configure the CRISPR reaction system: The total reaction system of CRISPR is 20 μL, 1 μL of Cas12a protein with a concentration of 2 μM, 1 μL of ssDNA-FB with a concentration of 10 μM, 1 μL of crRNA with a concentration of 50 nM, 2 μL of buffer, 2 μL of RPA amplification product, and 13 μL of ddH2O; 5) Perform CRISPR amplification at 39°C for 20 min; 6) Perform LFD detection: add 8 μL of RPA amplification product to 92 μL of ddH2O and mix well, then place the LFD test strip spot area into the mixed solution and determine the result after 2 minutes.

Images