KASP molecular marker for identifying wheat grain weight and application thereof

By developing a KASP molecular marker and primer combination at 153452675 bp on wheat chromosome 2A, the problem of wheat grain weight identification was solved, enabling rapid and accurate identification and improving breeding efficiency and yield.

CN119464549BActive Publication Date: 2025-11-04INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411717167.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-27
Publication Date
2025-11-04
Estimated Expiration
2044-11-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately determine wheat grain weight, which affects wheat breeding and yield improvement.

Method used

Develop a KASP molecular marker, utilize the polymorphic nucleotide sequence at 153452675 bp on wheat chromosome 2A, design specific KASP primer combinations for PCR amplification, and detect it by fluorescent labeling. Provide corresponding detection kits and identification methods.

Benefits of technology

It enables rapid and accurate identification of wheat grain weight, improves breeding selection efficiency, shortens the breeding cycle, and enhances the ability to select high-yield plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application relates to the technical field of genetic engineering, and discloses a KASP molecular marker for identifying the grain weight of wheat and application. The SNP site of the application is located at 153452675 bp of the 2A chromosome of wheat, and the polymorphism is G / A. The application obtains a SNP site related to the thousand-grain weight of plants through phenotype difference analysis and exon capture analysis of the thousand-grain weight, and designs a corresponding KASP primer combination according to the SNP site. The KASP primer combination provided by the application can accurately and quickly identify the thousand-grain weight of wheat, and has important significance in the breeding of high-yield plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a KASP molecular marker for identifying wheat grain weight and application thereof. BACKGROUND

[0002] Wheat (Triticum aestivum L.) is one of the most important crops in the world, and is the second largest food crop in China after rice. Improving wheat yield has become the focus of research in the field of wheat. Triticum aestivum Wheat (Triticum aestivum L.) is one of the most important crops in the world, and is the second largest food crop in China after rice. Improving wheat yield has become the focus of research in the field of wheat.

[0003] Exon capture sequencing is a method for extracting and sequencing exons (a collection of all exons) in the genome and obtaining exon variations in a single biological sample. This method enables studies to quickly focus on the part of the genome that is most likely to affect phenotypic variations. KASP (Kompetitive Allele Specific PCR), a molecular marker developed based on SNP sites, has high stability, accuracy, and low cost, and has been widely used in high-throughput SNP typing. In particular, when the sample size is large and the SNP site is small, the application of KASP is more significant.

[0004] Wheat (Triticum aestivum L.) is one of the most important crops in the world, and is the second largest food crop in China after rice. Improving wheat yield has become the focus of research in the field of wheat. Triticum aestivum Wheat (Triticum aestivum L.) is one of the most important crops in the world, and is the second largest food crop in China after rice. Improving wheat yield has become the focus of research in the field of wheat. SUMMARY

[0005] The present application relates to the technical field of genetic engineering, in particular to a KASP molecular marker for identifying wheat grain weight and application thereof.

[0006] To achieve the object of the present application, in a first aspect, the present application provides a KASP molecular marker for identifying wheat grain weight, which is a SNP molecular marker related to plant thousand grain weight, and contains a nucleotide sequence with polymorphism G / A at position 153452675 bp of wheat chromosome 2A.

[0007] Further, plants with genotype AA at the polymorphism site have higher thousand grain weight than plants with genotype GG.

[0008] In a second aspect, the present application provides a KASP primer combination for amplifying the molecular marker, including a forward primer 1 (AGGAGCGCAAGCTGGAGACCGG) as shown in SEQ ID NO: 1, a forward primer 2 (AGGAGCGCAAGCTGGAGACCGA) as shown in SEQ ID NO: 2, and a reverse primer (CTTGCTCTTGTGTCGCGCCCGT) as shown in SEQ ID NO: 3.

[0009] Further, the 5' end of the forward primer 1 and the forward primer 2 in the KASP primer combination can be further connected with a fluorescent label sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0010] In one specific embodiment of the present application, the KASP primer combination is as follows:

[0011] 153452675-F1: 5'-GAAGGTGACCAAGTTCATGCTAGGAGCGCAAGCTGGAGACCGG-3'; (SEQ ID NO: 4)

[0012] 153452675-F2: 5'-GAAGGTCGGAGTCAACGGATTAGGAGCGCAAGCTGGAGACCGA-3'; (SEQ ID NO: 5)

[0013] 153452675-R: 5'-CTTGCTCTTGTGTCGCGCCCGT-3' (SEQ ID NO: 3).

[0014] In a third aspect, the present application provides a detection reagent or a kit containing the primer combination.

[0015] In a fourth aspect, the present application provides a method for identifying the thousand-grain weight (high / low, large / small) of a plant, comprising: using the DNA of a plant sample to be tested as a template, and using the KASP primer combination or the detection reagent or the kit to perform PCR amplification, and according to the amplification result, determining the thousand-grain weight of the plant sample to be tested.

[0016] Preferably, the system used for PCR amplification includes: 2xKASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the rest is water, based on a total system of 10 μL.

[0017] The primer mixture includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the rest is water, based on 100 μL.

[0018] Preferably, the reaction procedure for PCR amplification is as follows: 95℃ 8-12 min; 95℃ 15-25 s, 61℃ 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5-0.7℃ in each cycle; 95℃ 15-25 s, 55℃ 35-45 s, 32-36 cycles; 25℃ 10-20 min.

[0019] Further, judging the thousand-grain weight of the plant sample to be tested according to the amplification result comprises: analyzing the genotype of the polymorphic site contained in the molecular marker in the amplification product, and plants with genotype AA have a higher thousand-grain weight than plants with genotype GG.

[0020] Further, the plant is wheat.

[0021] In a fifth aspect, the present application provides any of the following applications of the molecular marker, the combination of molecular markers, or the detection reagent or kit:

[0022] (1) used for identifying, breeding and improving the thousand-grain weight of wheat;

[0023] (2) used for early prediction of the thousand-grain weight trait of wheat;

[0024] (3) used for molecular marker-assisted breeding of wheat;

[0025] (4) used for screening or breeding high-yield plants.

[0026] By the above technical solutions, the present application has at least the following advantages and beneficial effects:

[0027] (I) The present application obtains a SNP site of a gene through phenotype difference analysis of the thousand-grain weight and exon capture sequencing technology analysis, the SNP site is closely related to the phenotype of the thousand-grain weight of the plant, and the polymorphism of the SNP site can be detected to accurately and quickly identify whether the plant has high thousand-grain weight, the marker for the site has the advantages of good genetic stability, high resolution, and suitability for high-throughput detection application.

[0028] (II) The SNP site and the corresponding KASP primer combination provided by the present application can not only be used for identifying the high and low of the thousand-grain weight of plants, but also can be used for improving the selection efficiency of plant varieties, shortening the breeding cycle, and accelerating the field of high-yield plants, which has important application value. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 The gene exon SNP site map obtained by the exon capture sequencing technology analysis provided for Example 1 of the present application. TraesCS2A02G188500

[0030] Figure 2 ​Statistical chart of thousand kernel weight of different genotypes of 2A chromosome 153452675 site provided for example 2 of the present application.

[0031] Figure 3 Genotyping results of wheat genotypes of 2A chromosome 153452675 site provided for example 2 of the present application; wherein, GG represents 153452675-G, AA represents 153452675-A, and CK represents no template control, i.e. using ultrapure water instead of sample DNA.

[0032] Figure 4 Sequencing peak chart of different genotypes of 2A chromosome 153452675 site provided for example 2 of the present application. DETAILED DESCRIPTION

[0033] The following examples are intended to illustrate the present application but not to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are the conventional means well known to those skilled in the art, and the raw materials used are commercially available.

[0034] The relevant wheat varieties (lines) involved in the following examples are all provided by Professor Zhang Xueyong of Crop Science Institute, Chinese Academy of Agricultural Sciences, and the relevant wheat is sown in Xinxiang, Henan, and harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0035] It should be noted that, as a professional agricultural research institution, the applicant has long-term preservation of related germplasm materials, and the relevant wheat varieties are publicly available in the market or existing germplasm bank.

[0036] Example 1 Obtaining of SNP molecular marker related to plant thousand kernel weight and KASP primer design

[0037] 1. Exome capture sequencing of 149 samples

[0038] The process of whole exome sequencing mainly includes the following steps:

[0039] 1) Sample detection: First, the DNA sample is detected to ensure that its quality and quantity meet the sequencing requirements. The detection methods include agarose gel electrophoresis and nanodrop detection, and the requirements are that the DNA concentration is greater than or equal to 20 ng / ul, and the total amount is greater than 800 ng.

[0040] 2) Library construction: The genomic DNA was randomly broken into 180-280 fragments with a Covaris disruptor, and end repair, phosphorylation and poly A were performed using an Agilent SureSelect Human All Exon V5 / V6 kit. Subsequently, by liquid hybridization and PCR linear amplification, the library with specific index was hybridized with biotin-labeled probes, and after PCR linear amplification, library quality control was performed.

[0041] 3) Library detection: After library construction, preliminary quantification was performed using Qubit 2.0, and then Agilent 2100 was used to detect the insert fragments of the library. After passing the detection, Q-PCR method was used to accurately quantify the effective concentration of the library (3 nmol / L) to ensure the quality of the library.

[0042] 4) Sequencing: After passing the library detection, according to the effective concentration of the library and the data output requirement, Illumina HiSeq PE150 sequencing was performed. PE150 (Pair End 150 bp) refers to high-throughput double-end sequencing, each end is measured for 150 bp. Double-end sequencing is high-throughput sequencing by inserting fragments (Insert DNA) in the constructed small fragment library, which is convenient for subsequent alignment analysis.

[0043] 2. Obtain the thousand-grain weight of different wheat and develop SNP molecular markers

[0044] In order to obtain wheat high thousand-grain weight regulatory genes, combined with existing technologies, first, the thousand-grain weight of wheat was determined, and the thousand-grain weight phenotype of 149 wheat varieties planted above was determined, in order to preliminarily determine the difference of wheat thousand-grain weight phenotype. The specific determination results are shown in Table 1.

[0045] Based on the 149 thousand-grain weight phenotype data obtained in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to thousand-grain weight was mined, and on the 2A chromosome of the wheat genome, a SNP site was screened TraesCS2A02G188500 The SNP site exists in the exon of the gene, and the thousand-grain weight of the SNP variation is significantly increased, and a significant site affecting the thousand-grain weight of wheat (2A: 153452675 bp) is identified (part of the results are shown in Figure 1 ), and the site is named: 153452675.

[0046] Based on the above sequence difference, and based on the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed, and the specific design is as follows:

[0047] 153452675-F1: 5'-GAAGGTGACCAAGTTCATGCTAGGAGCGCAAGCTGGAGACCGG-3', (the sequence of the part of "GAAGGTGACCAAGTTCATGCT" at the 5' end is a FAM-labeled sequence)

[0048] 153452675-F2: 5'-GAAGGTCGGAGTCAACGGATTAGGAGCGCAAGCTGGAGACCGA-3', (the sequence of the part of "GAAGGTCGGAGTCAACGGATT" at the 5' end is a HEX-labeled sequence)

[0049] 153452675-R: 5'-CTTGCTCTTGTGTCGCGCCCGT-3';

[0050] When the primer pair combination of 153452675-F1 and 153452675-R is used, the sequence of the base G at the 153452675 locus of the 2A chromosome in the wheat molecular marker is amplified;

[0051] When the primer pair combination of 153452675-F2 and 153452675-R is used, the sequence of the base A at the 153452675 locus of the 2A chromosome in the wheat molecular marker is amplified.

[0052] Example 2 Application of the SNP molecular marker in identifying the thousand-grain weight of wheat

[0053] 1. Based on the primer pair design in Example 1, the genotype (GG 40 / AA 40) of 160 wheat materials was detected, and the correlation between the genotype and the thousand-grain weight phenotype was identified, and the specific process is as follows:

[0054] First, the genomic DNA of each wheat variety was extracted;

[0055] Then, according to the primers designed in Example 1, the DNA extracted above was used as a template to perform PCR (using a Quant Studio 1 fluorescent quantitative PCR instrument) detection analysis on different wheat samples.

[0056] The 10 μL amplification system is designed as follows:

[0057] KASP Mix (2x), 5 μL (i.e. HiGeno 2x Probe Mix (provided at a concentration of 2x), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2, and reference dye ROX);

[0058] Primer Mix, 0.14 μL;

[0059] DNA, 30 ng;

[0060] ddH2O, supplemented to 10 μL.

[0061] wherein the Primer Mix, per 100 μL:

[0062] 505806275-F1, 100 μM, 12 μL;

[0063] 505806275-F2, 100 μM, 12 μL;

[0064] 505806275-R, 100 μM, 30 μL;

[0065] ddH2O, 46 μL.

[0066] PCR reaction program (may be adjusted according to the amplification results) is as follows:

[0067] 95 °C 10 min; 95 °C 20 s, 61 °C 60 s (10 cycles, each cycle reduced by 0.6 °C); 95 °C 20 s, 55 °C 40 s, 34 cycles; 25 °C 15 min.

[0068] 2. Using the genomic DNA of each wheat variety extracted in step 1, ordinary PCR is performed, and sequencing is performed to verify the accuracy of KASP genotyping.

[0069] First, specific primers are designed for amplification at 153452675 bp of wheat chromosome 2A (reference sequence is Chinese Spring wheat), and the primer sequences are as follows:

[0070] GAF: 5'- TTGGTTCCTCCTACGTGGACAT-3'

[0071] GAR: 5'- TCATCGTCCGGCCCCAGCTGGC-3'

[0072] Randomly select 8 wheat varieties of GG / AA genotype KASP genotyping results, use ordinary PCR to amplify, and after electrophoresis detection, sequencing is performed to verify the reliability of the genotyping results.

[0073] The 25 μL amplification system is designed as follows during specific PCR amplification:

[0074] 2x EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL;

[0075] 10 μM primer CTF / CTR, 1 μL each;

[0076] DNA, 60 ng;

[0077] ddH2O, supplemented to 25 μL.

[0078] PCR reaction program (may be adjusted according to the amplification results) is:

[0079] 94℃ 5min; 94℃ 30 s, 58℃ 30 s, 72℃ 40 s (35 cycles); 72℃ 10 min; 16℃ end.

[0080] The specific genotype and wheat thousand kernel weight statistics results are shown in Tables 1-3 and Figures 1-4 .

[0081] Table 1 Different wheat variety genotype and its corresponding results of thousand kernel weight

[0082]

[0083] Table 2 Different wheat variety genotype and its corresponding results of thousand kernel weight

[0084]

[0085] Table 3 Different wheat variety genotype and its corresponding results of thousand kernel weight

[0086]

[0087] From the above experimental results, the average of GG genotype wheat thousand kernel weight is 33.147 g, and the average of AA genotype wheat thousand kernel weight is 39.933 g. The AA genotype wheat thousand kernel weight is significantly higher than the GG genotype wheat, and increases by 20.47%, which has significant difference at p<0.01 level. That is, the GG genotype wheat thousand kernel weight is significantly lower than the AA genotype wheat.

[0088] By designing primers and detecting specific sites, the high and low traits of wheat thousand kernel weight can be accurately determined, thereby laying a foundation for the application of molecular breeding technology. At the same time, based on the SNP site, new wheat varieties with different thousand kernel weight can be bred, which has important significance for breeding high-yield wheat.

[0089] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. A method for determining the thousand-grain weight of plants, characterized in that, include: Using the DNA of the plant sample to be tested as a template, PCR amplification of the polymorphic site was performed using the KASP primer combination or a detection reagent containing the KASP primer combination. The polymorphic site is the base at 153452675 bp on chromosome 2A of Chinese spring wheat, with a polymorphism of G / A. Plants with the genotype AA have a higher thousand-grain weight compared to plants with the genotype GG. The thousand-grain weight of the plant sample to be tested was determined based on the amplification results. The KASP primer combination consists of the sequences shown in SEQ ID NO:3-5; The plant in question is wheat.

2. The method according to claim 1, characterized in that, Based on a total volume of 10 μL, the PCR amplification system includes: 4–6 μL of 2×KASP Mix, 0.12–0.16 μL of primer mixture, 25–35 ng of DNA template, and the remainder is water.

3. The method according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 95℃ for 8-12 min; 95℃ for 15-25 s, 61℃ for 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5℃-0.7℃ in each cycle; 95℃ for 15-25 s, 55℃ for 35-45 s, 32-36 cycles; 25℃ for 10-20 min.

4. Any of the following applications of the KASP primer combination or a detection reagent containing the said KASP primer combination: (1) Used for the identification, selection and improvement of wheat thousand-grain weight; (2) Used for early prediction of the thousand-grain weight trait of wheat; The KASP primer combination consists of the sequences shown in SEQ ID NO:3-5.