Molecular markers for identification of drought resistance and genetic improvement of Brassica napus and their applications

Abstract

The present invention discloses a molecular marker for the identification and genetic improvement of drought resistance in Brassica napus. BnaA10.LEA4‑5 This study has been shown to improve drought resistance in Brassica napus. Using resequencing data, the present invention designed molecular markers and primers corresponding to different functional haplotypes of this gene. These DNA markers can distinguish functional haplotypes of this gene in the Brassica napus lines being tested and can be used for marker-assisted breeding of drought resistance in Brassica napus and for genetic improvement of drought resistance in non-drought-resistant haplotypes. This simple, rapid, and highly accurate method provides strong technical support for the selection and genetic improvement of new drought-resistant Brassica napus varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of rapeseed breeding, and in particular relates to a molecular marker for drought resistance identification and genetic improvement of Brassica napus and its application. Background Art

[0002] The growing global population has led to increasingly severe food and oil shortages. Currently, my country's vegetable oil self-sufficiency rate is only one-third. Brassica napus is my country's largest oilseed crop, accounting for over half of all oilseed crop production. Furthermore, rapeseed has multiple uses, including as feed, a vegetable, and for tourism, making it an important cash crop. Rapeseed cultivation has the advantage of not competing with staple crops for land. Therefore, increasing rapeseed planting area and production capacity is crucial to national edible oil security.

[0003] Brassica napus is primarily cultivated in my country's Yangtze River Basin and Northwest China, where rapeseed production is susceptible to seasonal and prolonged droughts. In 2022, the middle and lower reaches of the Yangtze River experienced a rare, consecutive summer, autumn, and winter drought, significantly reducing rapeseed production. Therefore, breeding drought-resistant rapeseed varieties and improving their resistance to drought stress are essential for maintaining and increasing rapeseed planting area and yield. Drought stress in Brassica napus seedlings can cause dehydration and leaf wilting, inhibiting normal growth and even causing plant death.

[0004] Most water in young plants is lost through stomata, with a small amount also lost through transpiration from the cuticle on the leaf surface. Therefore, identifying key drought-resistance QTLs in Brassica napus through stomatal traits, screening and validating drought-resistance functional genes, and developing corresponding molecular markers for marker-assisted breeding are crucial for improving drought resistance and yield in Brassica napus, expanding cultivated areas, and increasing vegetable oil self-sufficiency. Summary of the Invention

[0005] The purpose of the present invention is to provide a class of molecular markers for drought resistance identification and genetic improvement of Brassica napus and applications thereof.

[0006] To achieve the above objectives, we first used a natural population of Brassica napus containing 167 germplasm resources to analyze the stomatal conductance traits under mild drought conditions (50% relative soil moisture content). Combined with genome-wide association analysis technology, we successfully located a gene encoding a protein abundant in the late embryo on chromosome BnaChrA10. BnaA10.LEA4-5 This gene was shown to positively regulate drought resistance in Brassica napus. Subsequently, specific molecular markers and primers were developed based on its different functional haplotypes. These molecular markers and primers can be used to identify drought resistance in Brassica napus and genetically improve non-drought-resistant haplotype materials.

[0007] There are four pairs of molecular marker primers designed in the present invention, namely YX1, YX2, YX3, and YX4, and their nucleotide sequences are shown below:

[0008] YX1 forward primer: GACCTGAGAATGAGTCTATTAC (SEQ ID NO. 1)

[0009] YX1 reverse primer: TCTTGTCCATGCCAGACTTG (SEQ ID NO. 2)

[0010] YX2 forward primer: ACACGTCTCGCTTACGTGTT (SEQ ID NO. 3)

[0011] YX2 reverse primer: TCGGTGAGCATGTCCCATTA (SEQ ID NO. 4)

[0012] YX3 forward primer: GATGTGACCATCAGGTCTCT (SEQ ID NO. 5)

[0013] YX3 reverse primer: GCTCATCATCACCGATTCTAC (SEQ ID NO. 6)

[0014] YX4 forward primer: TCACCGAGCAAAGCATCGAA (SEQ ID NO. 7)

[0015] YX4 reverse primer: TGAAGCTGTTTCCTTCATCG (SEQ ID NO. 8)

[0016] The YX1 forward and reverse primers amplify fragments of 920-931 bp in length, encompassing variant sites for five haplotypes. A single Sanger sequencing of the amplified product allows differentiation of the five haplotypes of rapeseed, and thus, identification of drought-resistant varieties. The YX2 forward and reverse primers amplify fragments of 109-114 bp in length, the YX3 forward and reverse primers amplify fragments of 99-101 bp in length, and the YX4 forward and reverse primers amplify fragments of 110-117 bp in length. Using these three primer pairs, genetic improvement can be achieved against non-drought-resistant haplotype background material.

[0017] The present invention also provides the application of the molecular marker in the identification and genetic improvement of drought resistance of Brassica napus.

[0018] The present invention also provides a method for identifying and genetically improving drought resistance of Brassica napus, the method comprising the following steps:

[0019] Step 1: Extract DNA from the plant to be tested;

[0020] Step 2: Using the DNA obtained in step 1 as a template and the above-mentioned molecular marker YX1 as a primer, perform PCR amplification;

[0021] Step 3: Detect the PCR amplification product.

[0022] Furthermore, the reaction system for PCR amplification in step 2 was 10 μL, including: 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O.

[0023] Furthermore, the reaction procedure of PCR amplification in step 2 is: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min, 1 cycle.

[0024] Compared with the prior art, the present invention has the following advantages: the present invention locates and screens candidate genes through genome-wide association analysis BnaA10.LEA4-5 Functional research results indicate that this gene positively regulates the drought resistance of Brassica napus. Based on this drought-resistant functional gene, haplotype analysis was conducted and corresponding molecular markers were designed. This molecular marker can specifically amplify the functional gene or its haplotype, thereby determining the drought resistance of the tested plant and enabling genetic improvement of drought resistance in materials corresponding to non-drought-resistant haplotypes. This method is simple, rapid, accurate, and reproducible. Combining this molecular marker with field selection can rapidly identify and select drought-resistant Brassica napus varieties, helping to advance the process of drought-resistant breeding for Brassica napus. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This figure uses the phenotypic data of stomatal conductance traits of a natural population of 167 Brassica napus lines under normal conditions and mild drought conditions. A is a box plot of stomatal conductance traits; B is a frequency distribution histogram of stomatal conductance traits;

[0026] Figure 2 The location of candidate genes. A is the Manhattan plot and QQ plot of genome-wide association analysis of stomatal conductance traits under mild drought conditions; B is the expression of genes in the QTL interval of chromosome A10 in response to abiotic stress and BnaA10.LEA4-5 Screening; C is the candidate gene BnaA10.LEA4-5 Variation analysis of the gene region and its upstream 1 kb; D is based on candidate genes BnaA10.LEA4-5 Haplotype analysis of variants and their correspondence with phenotypes.

[0027] Figure 3 Candidate genes BnaA10.LEA4-5Validation of drought resistance. A shows the creation of a Brassica napus mutant using CRISPR; B shows the validation of the overexpression strain using real-time fluorescence quantitative PCR; C shows the validation of the overexpression strain using protein immunoblotting; and D shows the validation of the drought resistance of the Brassica napus material.

[0028] Figure 4 In the present invention, YX1 primers were used in combination with Sanger sequencing to divide functional haplotypes.

[0029] Figure 5 In the present invention, primers YX2, YX3 and YX4 are used to perform molecular marker detection on the plants to be tested. DETAILED DESCRIPTION

[0030] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0031] Example 1 Brassica napus BnaA10.LEA4-5 Gene mapping, cloning and verification.

[0032] Mild Drought Stress Treatment and Phenotyping of Natural Populations of Brassica napus (1) On October 1, 2016, 167 core accessions of Brassica napus were potted at the potting farm of Huazhong Agricultural University. The experiment was divided into a control group (WW, soil relative moisture content of approximately 80%) and a drought group (WS, soil relative moisture content of 50%), with four replicates for each treatment.

[0033] (2) Each group of Brassica napus core germplasm was planted in four pots. Each pot was filled with 3 kg of soil sample, with a soil to sand ratio of 2:1. Each pot contained 0.65 g of urea, 1.5 g of phosphorus fertilizer, and 0.35 g of potassium fertilizer. Five self-pollinated seeds were sown in each pot. When the rapeseed reached the two-leaf and one-heart stage, uniform seedlings were selected and transplanted to one plant per pot.

[0034] (3) Water the rapeseed plants normally in the early stage, and then start drought treatment when the rapeseed plants have 4-5 true leaves. During the drought treatment, the control group was watered normally, and the soil relative water content (SRWC) of the potted plants was controlled at about 80% by weighing. The treatment group was not watered, and the soil relative water content (SRWC) of the potted plants was controlled at 50% by weighing.

[0035] (4) The water content was calculated as follows. The experimental soil was dried in a 70°C oven for 36 h and placed in a pot with a hole in the bottom and lined with filter paper (W0). The pot was weighed (W1), watered until water flowed out of the bottom, and then left overnight and weighed (W2). This was repeated four times to calculate the field water holding capacity. During the drought stress period, the pot was weighed daily (W3) to calculate the relative soil water content.

[0036] (5) A Li-Cor 6800 portable photosynthetic system (Li-Cor Bioscience) equipped with a red / blue (9:1) light source (Li-Cor Part No. 6800-2B, area 6 cm 2 ), photosynthetic parameters were measured on fully expanded new leaves of appropriate size. The measurement time was 8:30-16:30 on clear days, and the main photosynthetic parameter was a leaf chamber flow rate of 500 µmol s -1 ; Relative moisture content 50%-80%; High-pressure carbon dioxide cylinder maintains a carbon dioxide flow rate of 400 µmol s -1 The fan speed was 10,000 rpm, the rapeseed leaf temperature was 25°C, and the light intensity in the leaf chamber was 1200 µmol m −2 s −1 Save the data after the photosynthetic parameters are stable and no longer fluctuate significantly.

[0037] (6) The experimental results of stomatal conductance of the group under mild drought conditions are shown in Table 1. The statistical group data are as follows Figure 1 shown.

[0038] Table 1. Stomatal conductance values ​​of 167 Brassica napus accessions under mild drought conditions

[0039]

[0040] Example 2 Candidate genes BnaA10.LEA4-5 Positioning

[0041] (1) Our laboratory performed genome resequencing on a collection of 505 Brassica napus accessions for association analysis (Tang et al 2021) and obtained high-quality sequencing data using BWA (v0.75) software (Heng et al 2009).

[0042] (2) Using the Darmor-bzh v4.1 genome (http: / / www.Genoscope.cns.fr / brassicanapus / data / ) as the reference genome for this experiment, we performed variation analysis on 167 of the 505 Brassica napus genome resequencing results used in the present invention, and screened out 8,535,594 high-quality SNP and InDel markers.

[0043] (3) In the genome-wide association analysis, the GEMMA software model was used to adopt the linear mixed model method. 8,535,594 high-quality SNP and InDel markers were used, combined with phenotypic values ​​(i.e., stomatal conductance after mild drought treatment), and the 1.0e -06 As the significance threshold, QTL loci related to drought resistance were identified on a genome-wide scale. Figure 2 As shown in A.

[0044] (4) A major drought resistance QTL locus was identified on the A10 chromosome of Brassica napus, located between bp 15665693 and bp 15954314 of the A10 chromosome. Figure 2 As shown in A.

[0045] (5) Among the QTL sites, combined with transcriptome data, genes were found BnaA10.LEA4-5 (BnaA10g24180D) is more easily induced by a variety of abiotic stresses than other genes in the region. Therefore, this gene was identified as a candidate gene. Figure 2 As shown in B.

[0046] Example 3 Functional verification of candidate genes

[0047] In order to verify the function of the candidate gene, a high-fidelity polymerase was used to amplify the BnaA10.LEA4-5 The gene region coding sequence was obtained, the amplified fragment was recovered and double-enzyme digested, then cloned into the plant expression vector pMDC83, transformed into Escherichia coli DH5α, and single clones were picked for detection and sequencing, successfully obtaining a plant recombinant expression vector containing the candidate gene. BnaA10.LEA4-5 The coding sequence of the gene region is as follows (the underlined part is the reverse complementary sequence of the F primer and R primer of the coding region):

[0048] ATGCAGTCGATGAAGGAAACAGCTTCAAACATCGCAGCTTCTGCCAAGTCTGGCATGGACAAGACCAAAGCCACCTTGGAGGAGAAGGCTGAGAAGATGACAACAAGAGACCCTCTTCAGAAAGAGATGGCTACACAGAAGAAAGAAGGGAGGATCAATGAGGCTGAGATGCAGAAGAGAGAAGCGCGCGAGCACAACGCTGTCATGAAAGAAGCCAGTGGAGCTGGAACTGGAACCGG TTTGGGAATGGGAACCGCCACTCACTCGACCACTGGACACGTTGGACACGGAACTGGGACCCATCAGATGTCGGCTTTGCCTGGTCACGGCACGGGACAACCAGCGGGCCACGTTGTGGATGGTACAGCCGTGACAGAACCGATAGGAACGAACACTGGAACTGGTAGGACCACCGCTCATAACACCCGCGTTGGTGGTGGCACCACTGGGTATGGAA CCGGTGGAGGATATACTGGATAA (SEQ ID NO. 9)

[0049] The correct recombinant plasmid was introduced into Agrobacterium strain GV3101 and transformed into Brassica napus recipient material westar using conventional rapeseed genetic transformation methods and cultured to obtain seedlings. The obtained seedlings were tested by real-time fluorescence quantitative PCR and protein immunoprecipitation experiments to ensure that positive plants were obtained (see attached). Figure 3 Similarly, CRISPR-Cas9 technology was used to construct a mutant of Brassica napus (see Appendix). Figure 3 A). After multiple generations of testing, homozygous overexpression and mutant plants were obtained for functional verification.

[0050] The transgenic T2 generation was subjected to drought tests to verify the function of the introduced candidate gene. The results are shown in the attached figure. Figure 3 As shown in D, after drought treatment, the overexpressing plants showed higher drought resistance, while the mutant showed reduced drought resistance. This proves that this gene is a functional drought resistance gene in Brassica napus. Figure 2 As shown in Figure C, haplotype analysis was performed using 10 synonymous mutations in the gene region and 13 variants 1 kb upstream, totaling 23 variants, resulting in 5 haplotypes. Combined with phenotypic analysis, it was found that hap1, hap2, and hap3 were drought-resistant haplotypes, corresponding to low stomatal conductance; while hap4 and hap5 were drought-sensitive haplotypes, corresponding to high stomatal conductance. There was a significant difference in the level of the two different haplotypes, as shown in the following figure. Figure 2 As shown in D.

[0051] Example 4 Development of molecular markers based on haplotypes of drought-resistant functional genes

[0052] This example designs and develops related molecular markers based on the sequences of the drought-resistant functional gene of Brassica napus and its haplotype verified in Example 3. The nucleotide sequences of the primers for the molecular markers are as follows:

[0053] Hap1

[0054] TTGATCAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAAG ATATTCGCCCATCAAACTAAGCACACTCTTCTTATCCTTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGTCATCAAAGATTTGGCGTTATGCTTTACCGTGTGGTTATCGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAG CGGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAATTAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATATAT TAATGGGACATG CTCACCGAGCAAAGCATCGAA CAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA

[0055] Hap2

[0056] TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAAGATATTCGCCCATCAAACTAAGCACACTCTTCTTATCCTTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACTGTGGTTATTGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATAT TAATGGGACATGCTCACCG AGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA

[0057] Hap3

[0058] TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAGAGATTCGCCCATCAAACTAAGCGCACTCTTCTTATCCTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACTGTGGTTATTGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAATCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAATTAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATATAT TAATGGGACATGCTC ACCGAGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA

[0059] Hap4

[0060] TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAGAGATTCGCCCATCAAACTAAGCGCACTCTTCTTATCCTTGGACATGTAAACAAACCGGAGAAGTACTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACCGTGTGGTTATCGTTAAATTTGCAACATGT GTAGAATCGGTGATGATG AGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAATTAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATAT TAATGGGACATG CTCACCGAGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAG A

[0061] Hap5

[0062] TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGAATAAAGAAAAGATATTCGCCCATCAAACTAAGCACACTCTTCTTATCCTTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACTGTGGTTATTGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATAT TAATGGGACATGCTCACCG AGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA

[0063] Note: The underlined primers are designed and developed molecular marker primers.

[0064] The genotype of the Brassica napus plant to be tested was identified using the above molecular markers. The identification process was as follows:

[0065] 1. Extraction of DNA from rapeseed leaves using the CTAB method

[0066] (1) Take 1 cm thick young leaves from each plant. 2 Place in a 2 mL centrifuge tube, add steel beads, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB to the centrifuge tube;

[0067] (2) Place the plant tissue homogenate in the centrifuge tube into a centrifuge tube box, then place it in a 65°C water bath for 60 minutes, shaking every 15 minutes;

[0068] (3) After cooling to room temperature, add a 24:1 volume ratio of chloroform to isoamyl alcohol mixture to the centrifuge tube, gently invert and mix for 15 minutes, and then centrifuge at 12,000 rpm for 10 minutes.

[0069] (4) Place the centrifuged tubes on the operating plate in order, and aspirate the supernatant into a new 1.5 mL centrifuge tube, with a volume of 500 μL;

[0070] (5) Add 50 μL of KAc solution to the supernatant, then add 500 μL of ice ethanol, cover the centrifuge tube, shake gently a few times to mix the ice ethanol and supernatant thoroughly, and then place it in a -20°C refrigerator for 20-30 minutes to allow the genomic DNA to precipitate;

[0071] (6) After standing, centrifuge the tube at 12,000 rpm for 6 minutes, discard the supernatant, add 500 μL of 75% ethanol and let it stand for another 5 minutes, discard the supernatant (sometimes centrifuge for 2 minutes and then discard the supernatant), repeat once, and the precipitate is genomic DNA;

[0072] (7) Invert the centrifuge tube containing DNA and dry it in a fume hood to obtain the genomic DNA of each plant;

[0073] (8) Add 200 μL of ddH2O to the dried centrifuge tube containing DNA to dissolve the DNA. After dissolution, store at -20°C.

[0074] 2. PCR Amplification of Molecular Markers

[0075] PCR amplification was performed using the aforementioned molecular markers as primers and genomic DNA from the Brassica napus plants to be tested, extracted using the CTAB method, as a template. Each 10 μL PCR amplification reaction system contained: 5 μL Vazyme 2× Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O.

[0076] Vazyme 2×Taq Plus Master Mix5 μL

[0077] 2 μL DNA template

[0078] 10 μM forward primer 0.25 μL

[0079] 10 μM reverse primer 0.25 μL

[0080] 2.5 μL ultrapure water

[0081] After mixing all the substances, they were covered with mineral oil. The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.

[0082] 3. Amplification Products and Electrophoresis Analysis

[0083] The amplified products of all the Brassica napus plants to be tested were electrophoresed on a 1.5% agarose gel, stained with the nucleic acid dye ethidium bromide, and imaged under ultraviolet light to obtain the genotype information of the tested samples. Figure [4 , using YX1 forward and reverse primers and one Sanger sequencing, five haplotypes can be distinguished. Next, the YX2-YX4 primers shown in Table 2 can be used to achieve genetic improvement of non-drought-resistant haplotype background materials. The specific operation is to determine the parent combination and then perform hybridization. The molecular marker detection of the hybrid offspring is performed using the YX2-YX4 primers shown in Table 2. The results are shown in Figure 2. Figure 5As shown, the banding patterns of hap1 and hap3 amplified with the YX2 forward and reverse primers were consistent, the banding patterns of hap2 and hap5 were consistent, and hap4 was a single band, which was consistent with expectations. The banding patterns of hap1 and hap4 amplified with the YX3 forward and reverse primers were consistent, and the banding patterns of hap2, hap3, and hap5 were consistent, which was consistent with expectations. The banding patterns of hap1 amplified with the YX4 forward and reverse primers were consistent, and the banding patterns of hap2, hap3, and hap5 were consistent, and hap4 was a single band, which was consistent with expectations. In the haplotype improvement of breeding materials, the haplotypes of the donor material and the recipient material were determined by combining YX1 with Sanger sequencing; the material with a non-drought-resistant haplotype was used as the recurrent parent and hybridized with the material with a drought-resistant haplotype; based on the haplotype identification results of the material, the plants with the drought-resistant haplotype in the offspring of the parental hybrid were identified using the YX2-YX4 primers shown in Table 2 and were continuously backcrossed with the non-drought-resistant parent, thereby introducing the drought-resistant haplotype into the haplotype material to be improved while keeping the genetic background basically consistent with that of the original parent; finally, through one self-pollination, the homozygous drought-resistant haplotype material was screened out in the self-pollinated offspring, thereby achieving the genetic improvement of drought resistance of the haplotype material to be improved.

[0084] Table 2. Improvement scheme for non-drought-resistant haplotypes using YX2, YX3, and YX4 primers

[0085]

[0086] Therefore, this molecular marker can be used to quickly and accurately detect drought resistance in Brassica napus materials with good reproducibility. Its application in molecular-assisted selection breeding for drought resistance in Brassica napus or genetic improvement of drought-sensitive materials could significantly improve the efficiency of breeding drought-resistant varieties and advance breeding progress.

[0087] The above embodiments are preferred implementation schemes of the present invention, and the present invention is not limited to the specific details in the above embodiments. Any modifications, equivalent replacements, improvements, etc. made under the functional and structural principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A molecular marker for identifying drought resistance in Brassica napus, wherein the primer nucleotide sequence of the molecular marker is: YX1 forward primer: GACCTGAGAATGAGTCTATTAC YX1 reverse primer: TCTTGTCCATGCCAGACTTG, The amplified fragments of the primers are 920-931 bp in length and contain mutation sites of five haplotypes, hap1, hap2, hap3, hap4, and hap5, as shown in DNA fragments of SEQ ID NOs. 10, 11, 12, 13, and 14. The amplified fragment lengths of these five haplotypes of rapeseed are 924, 920, 924, 931, and 920 bp, respectively. The five haplotypes of rapeseed can be distinguished by performing a single Sanger sequencing on the amplified products. Among them, haplotypes hap1, hap2, and hap3 are drought-resistant haplotypes, and haplotypes hap4 and hap5 are drought-sensitive haplotypes.

2. Use of the molecular marker according to claim 1 in identifying drought resistance of Brassica napus.

3. A method for identifying drought resistance of Brassica napus, characterized in that The following steps are involved: 1) Extracting genomic DNA from Brassica napus; 2) using the genomic DNA extracted in step 1) as a template, and performing PCR amplification using the molecular marker primers described in claim 1; 3) Perform Sanger sequencing on the PCR amplification product of step 2).

4. The method for identifying drought resistance of Brassica napus according to claim 3, wherein: The PCR amplification reaction system was 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O.

5. The method for identifying drought resistance of Brassica napus according to claim 3, wherein: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and extension at 72°C for 5 min, 1 cycle.

Images