Primer probe combination for simultaneously detecting different serotypes of aviadenoviruses, kit and application

Abstract

The invention provides a primer probe combination for simultaneously detecting different serotypes of aviadenoviruses, a kit and application. The different serotypes of aviadenoviruses comprise C4 type, E8a type, E8b type and D11 type. Wherein the sequences of the primer probes for the C4 type fowl adenovirus are respectively shown as SEQ ID NO.1-3, the sequences of the primer probes for the E8a type fowl adenovirus are respectively shown as SEQ ID NO.4-6, the sequences of the primer probes for the E8b type fowl adenovirus are respectively shown as SEQ ID NO.4-5 and SEQ ID NO.7, and the sequences of the primer probes for the D11 type fowl adenovirus are respectively shown as SEQ ID NO.8-10. The kit can be used for quickly and accurately detecting multiple serotypes of the fowl adenovirus, and is high in specificity and good in repeatability. In addition, only about one hour is needed for completing one-time sample detection and result interpretation, and the detection cost can be controlled to be 1-3 yuan / sample.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology detection, and in particular to a primer-probe combination, a kit and an application thereof for simultaneously detecting avian adenoviruses of different serotypes. Background Art

[0002] Avian adenovirus is a pathogen that seriously endangers the health of poultry. It can cause lesions in different organs of chickens, especially the thymus, liver, spleen and muscle tissues, leading to serious illness and death. Avian adenovirus shows obvious antigenic variability between different serotypes. Rapid, accurate and sensitive detection of avian adenovirus is a necessary means to ensure the health of poultry and the sustainable development of the breeding industry.

[0003] At present, multiplex fluorescence quantitative PCR technology has become one of the main means of detecting pathogens. And because the isolation and identification of viruses takes a long time, cell culture technology is required, the operation is cumbersome and the risk is high; serological tests such as ELISA technology have cross-reaction and false positive risks; immunoelectron microscopy methods have high operation requirements, high technical difficulty, high cost, and cannot perform quantitative detection of viruses; traditional PCR methods are difficult to simultaneously detect different serotypes of avian adenoviruses. Therefore, the continuous development of multiplex fluorescence quantitative PCR technology that can simultaneously detect multiple serotypes of avian adenoviruses has important application value.

[0004] In the prior art, CN201711094956.2 discloses a nano-multiplex PCR method for distinguishing four serotypes of avian adenovirus group I, namely type 4, 8a, 8b, and 11. The minimum detection concentrations of these four viruses are: 5.14×10-4 for FAdv-4 and 5.14×10-11 for FAdv-4. 6 Copies / uL, FAdV-8a is 2.87×10 4 Copies / uL, FAdV-8b is 1.71×10 4 Copies / uL, FAdV-11 is 4.35×10 5 Although the detection sensitivity has been greatly improved compared with the existing technology, it is still powerless for samples with smaller viral loads. CN202010585202.2 discloses a method for distinguishing four serotypes of avian adenovirus group I, namely E8a, E8b, C4 and D11. The minimum concentration of the designed multiple primers for detecting E8a, E8b, C4 and D11 is 10 -3 , 10 -4 , 10 -4 , 10 -3 μg / mL, and the patent is also unable to detect samples with a smaller viral load. In addition, the above two patents are both ordinary PCR technologies, which are mainly used for qualitative detection, have poor sensitivity, and still require gel electrophoresis to interpret the results, which is time-consuming and laborious. Summary of the invention

[0005] In view of the problems of low sensitivity, complicated operation, long time consumption and high cost in the existing methods for simultaneously detecting different serotypes of avian adenovirus, the present invention provides a primer probe combination, a kit and an application for simultaneously detecting different serotypes of avian adenovirus.

[0006] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0007] In a first aspect, the present invention provides a primer-probe combination for simultaneously detecting different serotypes of avian adenovirus, wherein the different serotypes of avian adenovirus include: C4, E8a, E8b, and D11; wherein the primer-probe sequences for C4 avian adenovirus are respectively shown in SEQ ID NOs.1 to 3, the primer-probe sequences for E8a avian adenovirus are respectively shown in SEQ ID NOs.4 to 6, the primer-probe sequences for E8b avian adenovirus are respectively shown in SEQ ID NOs.4 to 5 and SEQ ID NO.7, and the primer-probe sequences for D11 avian adenovirus are respectively shown in SEQ ID NOs.8 to 10.

[0008] Preferably, the probe fluorescent reporter group for C4 type avian adenovirus is ROX; and / or, the probe fluorescent reporter group for E8a type avian adenovirus is FAM; and / or, the probe fluorescent reporter group for E8b type avian adenovirus is CY5; and / or, the probe fluorescent reporter group for D11 type avian adenovirus is VIC.

[0009] In a second aspect, the present invention provides a kit for simultaneously detecting different serotypes of avian adenovirus, comprising the primer-probe combination described in the first aspect and other necessary reagents for realizing multiplex fluorescence quantitative PCR detection.

[0010] Preferably, in the primer-probe combination, the final concentration of the primers in the reaction system of multiplex fluorescence quantitative PCR detection is 0.2 μmol / L, and the final concentration of the probes is 0.1 μmol / L.

[0011] Preferably, the other necessary reagents include DNA polymerase, dNTP, and MgCl2. Preferably, the final concentration of the DNA polymerase in the reaction system of multiplex fluorescence quantitative PCR detection is 0.05U / μL, the final concentration of the dNTP in the reaction system of multiplex fluorescence quantitative PCR detection is 0.25mmol / L, and the final concentration of MgCl2 in the reaction system of multiplex fluorescence quantitative PCR detection is 4.125mmol / L.

[0012] In a third aspect, the present invention provides the use of the primer-probe combination described in the first aspect or the kit described in the second aspect for simultaneously identifying four serotypes of avian adenoviruses at a non-diagnostic destination, wherein the four serotypes of avian adenoviruses include: C4, E8a, E8b, and D11, and multiplex fluorescence quantitative PCR is used to detect whether a sample contains at least one Hexon protein gene of the four serotypes of avian adenoviruses.

[0013] Preferably, the standard plasmid for multiplex fluorescence quantitative PCR detection is a pMD18T vector plasmid, and the insertion sequence of the pMD18T vector plasmid is shown as SEQ ID NO.11.

[0014] Preferably, the reaction procedure of the multiplex fluorescence quantitative PCR detection is: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 10 sec, annealing and extension at 55°C for 30 sec, 40 cycles, and collecting the probe fluorescence signal after the end of the cycle at 55°C.

[0015] Preferably, the result of the multiplex fluorescence quantitative PCR test is determined as follows: when the Cq value of the test sample is ≤37, and the amplification curve shows an obvious exponential growth period, the test result is valid and the sample can be directly reported as positive; when the Cq value of the test sample is >37 or the sample Cq value cannot be detected, the sample can be reported as negative.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention can rapidly and accurately detect multiple serotypes of avian adenovirus, timely discover and diagnose virus infection, help take corresponding prevention and control measures, and effectively reduce the impact of the virus. This effective means improves the detection efficiency and accuracy of avian adenovirus, and has strong specificity and good repeatability. It can better grasp the current clinical epidemic rules, strengthen the prevention and control and treatment of avian adenovirus, reduce the morbidity and mortality of the poultry industry, and reduce economic losses. The detection specificity of the present invention can reach 100%, and the sensitivity can reach 7.82×10 1 copies / μL, 5.11×10 1 copies / μL, 6.67×10 1 copies / μL、8.11×10 1 It only takes about 1 hour to complete the detection and result interpretation of a sample, and the detection cost can be controlled at 1~3 yuan per sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0019] Figure 1 These are probe-labeled fluorescence curves of primers for four different serotypes of avian adenovirus in Example 1 of the present invention, wherein Figure A is a C4-type ROX fluorescence-labeled amplification curve; Figure B is an E8a-type FAM fluorescence-labeled amplification curve; Figure C is an E8b-type CY5 fluorescence-labeled amplification curve; and Figure D is a D11-type VIC fluorescence-labeled amplification curve.

[0020] Figure 2 This is a specificity experiment of primer probes of four different serotypes of avian adenovirus in Example 2 of the present invention, including type A-C4; type B-E8a; type C-E8b; and type D-D11.

[0021] Figure 3 These are the plasmid standard curves of the primer probes for the four different serotypes of avian adenovirus in Example 7 of the present invention, wherein Figure A is the C4 type ROX fluorescent labeling standard curve; Figure B is the E8a type FAM fluorescent labeling standard curve; Figure C is the E8b type CY5 fluorescent labeling standard curve; and Figure D is the D11 type CY5 fluorescent labeling standard curve. DETAILED DESCRIPTION

[0022] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0023] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed.

[0024] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, result or characteristic that may be included in at least one implementation of the present invention. The phrase "in another embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor is it a separate or selective embodiment that is mutually exclusive with other embodiments.

[0025] Example 1

[0026] This example establishes a multiplex fluorescence quantitative PCR detection method for simultaneously detecting four different serotypes of avian adenovirus, which includes the following steps:

[0027] 1) Genome preparation:

[0028] The DNA of four different serotypes of viruses were extracted according to the instructions of the Viral DNA / RNA Extraction Kit, and all DNAs were stored at -80°C for future use.

[0029] 2) Design and synthesis of primers and probes:

[0030] The gene sequences of four avian adenoviruses, C4, E8a, E8b, and D11, published in GenBank were compared respectively, and specific regions were selected for evaluation and screening of primers and probes using PrimerPremier5.0. Specific primers and probes were designed. The 5' end of the probe was labeled with FAM, CY5, VIC, or ROX fluorescent emission groups, and the 3' end was labeled with BHQ1 or BHQ2 fluorescent quenching groups. The primer and probe sequences are shown in SEQ ID NO.1-10 (Table 1). A standard pMD18T vector plasmid containing the target gene was designed. The primers, probes, and standard plasmids were synthesized by BGI.

[0031] Table 1 Primer table

[0032] Label Primer name Primer sequences 5' Fluorophore 3' quencher Remark SEQ ID NO.1 fadv4F ACACGAGCACCACCAAAG none none C4 type upstream primer SEQ ID NO.2 fadv4R AGGCACCGTAAGCGTAATT none none C4 type downstream primer SEQ ID NO.3 fadv4P TGACGAAGATTTCCGGCGTCT ROX BHQ-2 C4 type probe SEQ ID NO.4 fadv8abF GAGAACACGCGYCTGGCTTA none none E8a and E8b upstream primers SEQ ID NO.5 fadv8abR GTAAAGTCYTCTACCCCCAT none none E8a and E8b downstream primers SEQ ID NO.6 fadv8 CATGGACAGCGGGAGCACGAA FAM BHQ-2 E8a probe SEQ ID NO.7 fadv8 GTTAGACACCACCGCACAGAA CY5 BHQ-3 E8b type probe SEQ ID NO.8 fadv11F ACAAGTTCAGGCAGACG none none D11 upstream primer SEQ ID NO.9 fadv11R ACGCGGTAACTGTTGG none none D11 downstream primer SEQ ID NO.10 fadv11P ACTCGCAATGTCACCACCGA VIC BHQ-1 D11 type probe

[0033] The insertion sequence of the standard pMD18T vector plasmid is shown in SEQ ID NO.11:

[0034] ATGGCGCAGATGGCTAAGGCGCAAGAATTCTTTTACCGCGTGATGGAAGCCGTGTTAGACTTGGGAGTTCAGGTTGGGGTGTACAACAACCGTCCGGTGCGGTTCCGTCAGAAGCGCATCGGCGAGATCCCTCAGATGTCTGACGCGGAGAGAACACGCGTCTGGCTTACGGGGCGTACGTCAAGCCCCTGAAGAACGACGGCTCTCAGTCTCTGGTGCAAACACCTTACTACGTCATGGACAGCGGGAGCACGAAATATTTGGGTGTGATGGGGGTAGAGGACTTTACACAAGTTCAGGCAGACGGTAGTCGCGCCTACTCGCAATGTCACCACCGAGAAGGCCCAGAGGCTCCAGATCAGGTTTTACCCGACGCAGACCGACGACACGCCCAACAGTTACCGCGTATGGCGGCCCTCACGCCCGACCTGACTACCGCGACTCCGCGGCTCCAGTATTTTCACATCGCGGGCCCCGGGACGCGCGAATACCTCTCTGAGGACCTCCAACAGTTCATTTCCGCCACCACACGAGCACCACCAAAGACACGACGGCGGCGCAGGTGACGAAGATTTCCGGCGTCTTTCCCAACCCCAACCAGGGACCCGGAATAAATCCTCTGCGGCAGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGTCTCAGTACAATTACGCTTACGGTGCCT。

[0035] 3) Establishment of multiplex fluorescence quantitative PCR system:

[0036] The reaction system is 20 μL, including 10×taqbuffer (without Mg 2+) 2μL, TaqDNAPolymerase (ABclonal enzyme) (5U / μL) 0.2μL, dNTPmix (10mMeach) 0.5μL, MgCl2 (25mM) 3.3μL, upstream and downstream primers of each virus 0.4μL each, probe 0.2μL each, single virus DNA template 1μL, deionized water to make up 20μL; the reaction procedure is: 95℃ pre-denaturation for 4min; 95℃ denaturation for 10sec, 55℃ annealing and extension for 30sec, 40 cycles, and collect the probe fluorescence signal after the end of 55℃.

[0037] 4) According to the established multiplex fluorescence quantitative PCR method, the standard plasmids of the four serotypes of the virus were amplified respectively. The reaction system was 20 μL, including 10× taqbuffer (Mg-free 2+ ) 2μL, TaqDNAPolymerase (5U / μL) 0.2μL, dNTPmix (10mMeach) 0.5μL, MgCl2 (25mM) 3.3μL, upstream and downstream primers of each virus 0.4μL each, probe 0.2μL each, template 1μL, deionized water to 20μL; the reaction procedure is the same as above, and a blank control group of deionized water is set up at the same time. The amplification results are shown in Figure 1 shown.

[0038] Example 2

[0039] This example is to verify the specificity of the primer probe designed in Example 1

[0040] The standard plasmids (pMD18T vector plasmids) of 4 different serotypes of avian adenovirus were used as templates to amplify the corresponding target fragments. Each reaction system was 20 μL, including 10.0 μL of 2×TaqDNA Polymerase MIX enzyme (ABclonal enzyme), 0.4 μL of upper and lower primers, 0.2 μL of probe primer, 1 μL of viral plasmid template, and 20 μL of deionized water. The reaction procedure was: pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 10 seconds, annealing and extension at 55°C for 30 seconds, and 40 cycles. The experimental results are shown in the figure. Figure 2 As shown, it indicates that the obtained fluorescent signal is single and the primer specificity is 100%.

[0041] Example 3

[0042] Annealing temperature optimization

[0043] Annealing temperature determines PCR specificity and yield: high temperature leads to strong specificity, but too high temperature will prevent the primers from firmly binding to the template, and the DNA amplification efficiency will decrease; low temperature leads to high yield, but too low temperature can cause mismatch between primers and templates, and increase non-specific products. There are 3 pairs of primers and 4 probes in the quadruple fluorescent quantitative PCR reaction, and the appropriate annealing temperature of each primer is also different. For this reason, we explored the optimal annealing temperature for the quadruple fluorescent quantitative PCR reaction. According to the recommended annealing temperature of TaqDNA Polymerase MIX enzyme and the Tm value of the primer, the three annealing temperatures of 55°C, 58°C, and 62°C were used for fluorescent quantitative PCR reactions. Finally, it was found that at 55°C, the fluorescence signals of all probes were good and the stability was strong.

[0044] Example 4

[0045] Optimization of reaction system

[0046] According to the amplification efficiency of different commercial TaqDNA Polymerase MIX enzymes, ABclonal enzyme can reach 110%, which is the best effect, so ABclonal enzyme is used; and according to the different binding efficiencies of different primers and probes with templates, the amount of primers and probes is optimized. According to the recommended concentrations of primers and probes, we compared the combination of upstream and downstream primers with a final concentration of 0.2μmol / L or 0.4μmol / L in the reaction system and a probe final concentration of 0.1μmol / L or 0.2μmol / L, a total of 4 final concentration combinations. Finally, it was found that in 8 repeated tests of the same standard plasmid concentration, the effect of the primer final concentration of 0.2μmol / L in the reaction system of multiple fluorescence quantitative PCR detection and the probe final concentration of 0.1μmol / L was the smallest Cq value variance compared with other combination modes, and this combination is more cost-effective.

[0047] Example 5 Setting of fluorescence threshold

[0048] Negative control and positive control were added to the reaction system, among which the standard plasmid was used as the positive control and sterile double distilled water was used as the negative control. The fluorescence signal curve was taken for 3-15 cycles after the reaction, and the threshold line was set to just exceed the highest point of the irregular noise line of the amplification curve of the normal negative control and the negative sample, without any value and intersecting with the exponential period of the positive control. The final threshold value was determined to be 37.

[0049] Result determination: When the Cq value of the test sample is ≤37 and the amplification curve has an obvious exponential growth period, the test result is valid and the sample can be directly reported as positive; when the Cq value of the test sample is >37 or the sample Cq value cannot be detected, the sample can be reported as negative.

[0050] According to the optimization results of Examples 3 to 5, a multiplex fluorescence quantitative PCR reaction system was finally established, with a reaction system of 20 μL, plasmids of four viruses as templates, specific primers and probes of four viruses added respectively, the final concentration of primers was 0.2 μmol / L, and the final concentration of probes was 0.1 μmol / L; the optimized reaction procedure was: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 10 sec, annealing and extension at 55°C for 30 sec, and the collection of multiple fluorescence signals was performed after each extension. The standard plasmid was used as a positive control, sterile double distilled water was used as a negative control, and each reaction was repeated 3 times.

[0051] Example 6

[0052] Multiplex fluorescence quantitative PCR specific detection

[0053] According to the established multiplex fluorescence quantitative PCR method, the specificity of a single primer was verified. Four different serotypes of avian adenovirus DNA and other pathogenic cDNA or DNA were used as templates, including avian susceptible pathogens such as avian Marek's virus, avian leukosis virus, Escherichia coli, Salmonella, mycoplasma, etc. Each reaction system was 20 μL, including 1 μL of the above DNA template, 0.2 μL of different upstream and downstream primers of avian adenovirus, 0.1 μL of probe primer, 10.0 μL of 2×TaqDNA Polymerase MIX enzyme, and 20 μL of deionized water; the reaction procedure was: 95°C pre-denaturation for 2 minutes, 95°C denaturation for 10 seconds, 54°C annealing and extension for 30 seconds, and after 40 cycles, the collection of multiple fluorescence signals was carried out after each extension. The standard plasmid was used as a positive control, and sterilized double distilled water was used as a negative control. The experimental results show that the detection specificity of the multiplex fluorescence quantitative PCR of the present invention is 100%.

[0054] Example 7

[0055] Sensitivity evaluation of multiplex fluorescence quantitative PCR

[0056] Four single plasmids were used as templates, and the four serotype C4, E8a, E8b, and D11 virus standard plasmids were respectively diluted with sterile double distilled water at 7.82×10 6 copies / μL-7.82×10 2 copies / μL; 5.11×10 6 copies / μL-5.11×10 2 copies / μL; 6.67×10 6 copies / μL-6.67×10 2 copies / μL; 8.11×10 6 copies / μL-8.11×10 2The sensitivity of the multiplex fluorescence quantitative PCR method was determined by using 5 gradients of multiplex fluorescence quantitative PCR. A standard curve was made based on the relationship between plasmid concentration and Cq value. The sensitivity of this method can reach 7.82×10 1 copies / μL, 5.11×10 1 copies / μL, 6.67×10 1 copies / μL、8.11×10 1 copies / μL. Figure 3 The sensitivity of this method can reach the single copy nucleic acid content, which is higher than the two patents CN201711094956.2 and CN202010585202.2 recorded in the background technology.

[0057] Example 8

[0058] Clinical sample testing

[0059] Clinical sample testing and virus isolation. The established method was initially applied to test 60 clinical samples: chicken liver samples collected from Guangdong from January to March 2023 were used to detect and analyze the prevalence of avian adenovirus using a multiplex fluorescence quantitative PCR method.

[0060] The extracted viral DNA of 60 chicken liver samples was detected according to the method of Example 8. The results of multiple fluorescence quantitative PCR test showed that among the 60 diseased materials, 0 C4-type positive, 11 E8a-type positive, 7 E8b-type positive, and 3 D11-type positive were identified. This method can detect 94 samples at a time, and it only takes about 1 hour to complete the detection of a sample and the interpretation of the serotyping results. Compared with the ordinary PCR method, it can only detect 5 positive samples, and the whole process includes gel electrophoresis experiments that take about 3 hours, and the viral load of the sample cannot be measured, which is time-consuming and laborious. In addition, the calculated detection cost is about 1 to 3 yuan per sample.

[0061] The common PCR method refers to a common PCR method disclosed in CN202010585202.2 for distinguishing the four serotypes of avian adenovirus group I, E8a, E8b, C4 and D11. Gel electrophoresis is performed to verify the position and size of the bands, thereby judging whether the sample is positive.

[0062] From the above results, it can be seen that the multiplex fluorescence quantitative PCR detection method of the virus has the characteristics of short time and high sensitivity compared with the virus isolation method. The positive results of virus isolation are all positive in the multiplex PCR detection, and the detection accuracy is 100%.

[0063] It can be seen from the above examples that the C4, E8a, E8b, and D11 serotype avian adenovirus-specific primer probes designed by the present invention have strong specificity, and are negative for viruses other than these four serotypes of avian adenovirus, with a detection specificity of 100%; inter-batch and intra-batch experiments show that the constructed multiplex PCR detection method has good stability.

[0064] The design of the probe of the present invention is particularly important. The probe needs to cooperate with the primer, and the probe needs to bind to the template before the primer, otherwise the DNA polymerase will not be able to cut the probe, and the fluorescent signal will not be generated, resulting in detection failure. At the same time, the probe needs to ensure efficient binding with the template, otherwise it will not be able to effectively bind to the template, which will also result in the inability to generate fluorescent signals and cause detection failure. At the same time, it is necessary to ensure that polymerization and mismatch will not occur between probes and between probes and primers.

[0065] The invention has reasonable selection of target genes for detection, excellent design and combination of primers and probes, and can accurately, specifically and sensitively detect four different serotypes of avian adenoviruses at the same time, providing an effective detection method for understanding the epidemic law and prevention and control of avian adenoviruses, with high detection sensitivity, strong specificity and good repeatability. It can quantitatively detect pathogens and perform serotyping, which is fast, simple, time-saving and labor-saving.

[0066] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer-probe combination for simultaneously detecting different serotypes of avian adenovirus, wherein the different serotypes of avian adenovirus include: C4 type, E8a type, E8b type, D11 type; characterized in that the primer probe sequences for C4 type avian adenovirus are shown as SEQ ID NO.1~3, the primer probe sequences for E8a type avian adenovirus are shown as SEQ ID NO.4~6, the primer probe sequences for E8b type avian adenovirus are shown as SEQ ID NO.4~5 and SEQ ID NO.7, and the primer probe sequences for D11 type avian adenovirus are shown as SEQ ID NO.8~10.

2. The primer-probe combination according to claim 1, characterized in that: The probe fluorescent reporter group for C4 type avian adenovirus is ROX; and / or, the probe fluorescent reporter group for E8a type avian adenovirus is FAM; and / or, the probe fluorescent reporter group for E8b type avian adenovirus is CY5; and / or, the probe fluorescent reporter group for D11 type avian adenovirus is VIC.

3. A kit for simultaneously detecting different serotypes of avian adenovirus, characterized in that: The method comprises the primer-probe combination according to claim 1 or 2 and other necessary reagents for realizing multiplex fluorescence quantitative PCR detection.

4. The kit according to claim 3, characterized in that In the primer-probe combination, the final concentration of the primer in the reaction system of multiplex fluorescence quantitative PCR detection is 0.2 μmol / L, and the final concentration of the probe is 0.1 μmol / L.

5. The kit according to claim 3 or 4, characterized in that The other necessary reagents include DNA polymerase, dNTP, and MgCl2.

6. The kit according to claim 5, characterized in that The final concentration of the DNA polymerase in the reaction system of the multiplex fluorescence quantitative PCR detection is 0.05 U / μL, the final concentration of the dNTP in the reaction system of the multiplex fluorescence quantitative PCR detection is 0.25 mmol / L, and the final concentration of the MgCl2 in the reaction system of the multiplex fluorescence quantitative PCR detection is 4.125 mmol / L.

7. Use of the primer-probe combination of claim 1 or 2 or the kit of any one of claims 3 to 5 for simultaneously identifying four serotypes of avian adenoviruses in a non-diagnostic destination, wherein the four serotypes of avian adenoviruses include: Type C4, type E8a, type E8b, and type D11 are detected using multiplex fluorescence quantitative PCR to detect whether the sample contains at least one Hexon protein gene of these four serotypes of avian adenovirus.

8. The use according to claim 7, characterized in that: The standard plasmid for multiplex fluorescence quantitative PCR detection is a pMD18T vector plasmid, and the insertion sequence of the pMD18T vector plasmid is shown in SEQ ID NO.

11.

9. The use according to claim 7 or 8, characterized in that: The reaction procedure of the multiplex fluorescence quantitative PCR detection is: pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 10 seconds, annealing and extension at 55°C for 30 seconds, 40 cycles, and collecting the probe fluorescence signal after the end of the 55°C period.

10. The use according to claim 7, characterized in that: The result of the multiplex fluorescence quantitative PCR test is determined as follows: when the Cq value of the test sample is ≤37 and the amplification curve shows an obvious exponential growth period, the test result is valid and the sample can be directly reported as positive; when the Cq value of the test sample is >37 or the Cq value of the sample cannot be detected, the sample can be reported as negative.

Images