Field effect transistor biosensor, preparation method and detection method

Abstract

The invention provides a field effect transistor biosensor, a preparation method and a detection method. The biosensor includes: a first region that receives and absorbs a sample solution; the sample solution can flow through the second area from the first area due to capillary force, detection molecules combined with the detection medium are arranged, and under the condition that the target molecules exist in the sample solution, the detection molecules are combined with the target molecules in the sample solution; the sample solution passing through the second area flows through the third area due to capillary force; the field effect transistor is arranged in the third region and comprises a grid electrode, a source electrode, a drain electrode and a channel layer, capture molecules are fixed on the field effect transistor, the capture molecules and the target molecules are subjected to specific reaction, and the grid voltage of the grid electrode is changed based on the detection medium carried by the detection molecules combined with the target molecules. The current between the channel resistance, the source electrode and the drain electrode and the output current are changed, and the target molecule is detected according to the change of the output current.

Description

Technical Field

[0001] The present application relates to a field effect transistor biosensor, a preparation method and a detection method. Background Art

[0002] In order to detect ultra-low concentration biomolecules, an amplification method is used. However, this method has a complicated process. The usual detection method is a detection method based on fluorescence or colorimetric labeling. At present, there is also a transistor method for detecting biomolecules, but because accurate detection requires washing on the transistor, the excess substances in the test solution are washed away, so that only the analyte antigen protein to be tested binds to the antibody on the surface of the transistor. The washing process introduces a large number of interference signals. These interference signals come from liquid washing, changes in fluid flow rate, slight changes in the pH of the solution, etc. The size of these interference signals is much larger than the signal change caused by the protein to be tested. It ignores the need for washing in the actual sample detection process and the influence of interference signals, so the current traditional methods cannot perform accurate actual sample detection. Summary of the invention

[0003] In order to solve one of the above technical problems, the present application provides a field effect transistor biosensor, a preparation method and a detection method.

[0004] According to one aspect of the present application, a field effect transistor biosensor is provided, comprising:

[0005] a first region, the first region receiving and absorbing a sample solution;

[0006] a second region, wherein the sample solution can flow from the first region through the second region due to capillary force, and a detection molecule combined with a detection medium is arranged in the second region, and when a target molecule exists in the sample solution, the detection molecule combines with the target molecule in the sample solution;

[0007] a third region through which the sample solution passing through the second region flows due to capillary force; and

[0008] a field effect transistor, the field effect transistor being arranged in the third region and comprising a gate, a source, a drain and a channel layer,

[0009] The field effect transistor is fixed with capture molecules, which react specifically with the target molecules. Based on the detection medium carried by the detection molecules bound to the target molecules, the gate voltage of the gate changes, causing the channel resistance, the current between the source and the drain, and the output current to change, and the target molecules are detected based on the change in the output current.

[0010] According to at least one embodiment of the biosensor of the present application, the biosensor further includes a fourth area, through which the liquid of the sample solution passing through the third area flows due to capillary force, and the fourth area is set as a quality control line area to verify that the transfer of the sample solution is completed.

[0011] The biosensor according to at least one embodiment of the present application further includes a fifth region, and liquid of the sample solution flowing through the fourth region can be absorbed by the fifth region due to capillary force.

[0012] According to the biosensor of at least one embodiment of the present application, the target molecule is an antigen or an antibody to be detected, the detection molecule is a complex of a detection antibody and a detection medium or a complex of a detection antigen and a detection medium, and the capture molecule is a capture antibody or a capture antigen.

[0013] According to the biosensor of at least one embodiment of the present application, the target molecule is the DNA / RNA to be detected or the DNA / RNA to be detected, the detection molecule is a complex of the detection DNA / RNA and the detection medium or a complex of the detection DNA / RNA and the detection medium, and the capture molecule is capture DNA / RNA or capture DNA / RNA.

[0014] According to the biosensor of at least one embodiment of the present application, the channel layer is made of carbon nanotubes.

[0015] According to the biosensor of at least one embodiment of the present application, the detection medium is metal nanoparticles or high dielectric nanoparticles, including gold nanoparticles, silver nanoparticles, copper nanoparticles and / or copper calcium titanate nanoparticles.

[0016] According to the biosensor of at least one embodiment of the present application, the first region is a sample pad region, the second region is a conjugate pad region, and the third region is a porous membrane region.

[0017] In the biosensor according to at least one embodiment of the present application, the channel layer of the field effect transistor is disposed on a substrate.

[0018] According to another aspect of the present application, a method for preparing a field effect transistor biosensor is provided, wherein the biosensor can be used to detect target molecules in a sample solution, comprising:

[0019] A third region is provided, wherein a field effect transistor is provided in the third region, wherein the field effect transistor comprises a gate, a source, a drain and a channel layer, and a capture molecule is fixed to the field effect transistor, and the third region is configured so that the sample solution flows through the position of the field effect transistor due to capillary force;

[0020] A second region is provided, wherein the second region is provided with detection molecules combined with a detection medium, and the second region is configured so that the sample solution flows from the second region through the third region due to capillary force, and when the sample solution flows through the second region, the detection molecules combine with the target molecules so as to carry the detection medium to the position of the field effect transistor in the third region; and

[0021] A first area is provided, the first area is used to receive the sample solution, and is configured to allow the sample solution to flow from the first area to the second area.

[0022] Wherein, the field effect transistor and the detection medium are configured such that when the capture molecule reacts with the target molecule, based on the detection medium carried by the detection molecule bound to the target molecule, the gate voltage of the gate changes, causing the channel resistance, the current between the source and the drain, and the output current to change.

[0023] According to at least one embodiment of the preparation method of the present application, a fourth area is further provided so that the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is provided as a quality control line area to verify that the transfer of the sample solution is completed.

[0024] According to at least one embodiment of the preparation method of the present application, the fifth area is further provided so that liquid of the sample solution flowing through the fourth area can be absorbed by the fifth area.

[0025] According to the preparation method of at least one embodiment of the present application, the target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a complex of a detection antibody and a detection medium or a complex of a detection antigen and a detection medium, and the capture molecule is a capture antibody or a capture antigen.

[0026] According to the preparation method of at least one embodiment of the present application, the target molecule is the DNA / RNA to be detected or the DNA / RNA to be detected, the detection molecule is a complex of the detection DNA / RNA combined with a detection medium or a complex of the detection DNA / RNA combined with a detection medium, and the capture molecule is capture DNA / RNA or capture DNA / RNA.

[0027] According to the preparation method of at least one embodiment of the present application, the channel layer is composed of carbon nanotubes, and / or the detection medium is metal nanoparticles or high dielectric nanoparticles, including gold nanoparticles, silver nanoparticles, copper nanoparticles and / or copper calcium titanate nanoparticles.

[0028] According to another aspect of the present application, a biological detection method using the above-mentioned biosensor is provided, comprising:

[0029] Dropping a sample solution into the first area;

[0030] measuring an output current between a source and a drain of the field effect transistor; and

[0031] The target molecule is detected according to the change of the output current. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings illustrate exemplary embodiments of the present application and together with the description are used to explain the principles of the present application. These drawings are included to provide a further understanding of the present application, and the drawings are included in and constitute a part of this specification.

[0033] Figure 1 It is a schematic structural diagram (side view) of a biosensor according to one embodiment of the present application.

[0034] Figure 2 It is a schematic structural diagram (top view) of a biosensor according to one embodiment of the present application.

[0035] Figure 3 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0036] Figure 4 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0037] Figure 5 It is a flow chart of a preparation method according to one embodiment of the present application.

[0038] Figure 6 It is a flow chart of a preparation method according to one embodiment of the present application.

[0039] Figure 7 It is a flow chart of a preparation method according to one embodiment of the present application.

[0040] Figures 8 to 12 is a schematic diagram of a field effect transistor according to an embodiment of the present application. DETAILED DESCRIPTION

[0041] The present application is further described in detail below in conjunction with the accompanying drawings and implementation methods. It is to be understood that the specific implementation methods described herein are only used to explain the relevant content, rather than to limit the present application. It should also be noted that, for ease of description, only the parts related to the present application are shown in the accompanying drawings.

[0042] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments in the present application can be combined with each other. The technical solution of the present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0043] Unless otherwise specified, the exemplary embodiments / embodiments shown will be understood as providing exemplary features of various details of some ways in which the technical concept of the present application can be implemented in practice. Therefore, unless otherwise specified, the features of the various embodiments / embodiments can be combined, separated, interchanged and / or rearranged in addition without departing from the technical concept of the present application.

[0044] The use of cross-hatching and / or shading in the accompanying drawings is generally used to make the boundaries between adjacent components clear. As such, unless otherwise specified, the presence or absence of cross-hatching or shading does not convey or indicate any preference or requirement for the specific materials, material properties, dimensions, proportions, commonalities between the components shown, and / or any other characteristics, attributes, properties, etc. of the components. In addition, in the accompanying drawings, the sizes and relative sizes of the components may be exaggerated for clarity and / or descriptive purposes. When the exemplary embodiments can be implemented differently, the specific process sequence can be performed in a different order than described. For example, two successively described processes can be performed substantially simultaneously or in an order opposite to the described order. In addition, the same figure numbers represent the same components.

[0045] When a component is referred to as being "on" or "over," "connected to," or "coupled to" another component, the component may be directly on, directly connected to, or directly coupled to the other component, or intervening components may be present. However, when a component is referred to as being "directly on," "directly connected to," or "directly coupled to" another component, there are no intervening components. For this purpose, the term "connected" may refer to a physical connection, an electrical connection, etc., with or without intervening components.

[0046] For descriptive purposes, this application may use spatially relative terms such as "under", "beneath", "under", "down", "over", "upper", "above", "higher", and "side (e.g., as in "sidewall")" to describe the relationship of one component to another (other) component as shown in the accompanying drawings. The spatially relative terms are intended to encompass different orientations of the device in use, operation, and / or manufacture in addition to the orientation depicted in the accompanying drawings. For example, if the device in the accompanying drawings is turned over, components described as "under" or "beneath" other components or features would subsequently be positioned as "over" the other components or features. Thus, the exemplary term "under" can encompass both the "over" and "under" orientations. Furthermore, the device may be otherwise oriented (e.g., rotated 90 degrees or at other orientations), and the spatially relative descriptors used herein should be interpreted accordingly.

[0047] The terms used here are for the purpose of describing specific embodiments, and are not intended to be restrictive. As used here, unless the context clearly indicates otherwise, the singular forms "one (kind, person)" and "said (the)" are also intended to include plural forms. In addition, when the terms "comprise" and / or "include" and their variations are used in this specification, it is explained that there are stated features, integral bodies, steps, operations, parts, assemblies and / or their groups, but it is not excluded that there are or add one or more other features, integral bodies, steps, operations, parts, assemblies and / or their groups. It should also be noted that, as used here, the terms "substantially", "approximately" and other similar terms are used as approximate terms and not as degree terms, so that they are used to explain the inherent deviations of the measured values, calculated values ​​and / or the values ​​provided that will be recognized by those of ordinary skill in the art.

[0048] According to one embodiment of the present application, a carbon nanotube field effect transistor biosensor is provided.

[0049] The biosensor can be used to detect target molecules. Figure 1 and Figure 2 As shown, the biosensor may include a first region 100 , a second region 200 , a third region 300 and a carbon nanotube field effect transistor 310 .

[0050] The first region 100 can receive and absorb a sample solution with a target molecule, for example, the sample solution can be dripped into the first region 100 by dripping, and the sample solution is absorbed by the first region 100. The sample solution can flow from the first region 100 through the second region 200 along the biosensor by capillary force. Detection molecules are arranged in the second region, wherein the detection molecules can be a complex of a detection antibody combined with a detection medium or a complex of a detection antigen combined with a detection medium, wherein the detection molecules can be combined with the target molecule in the sample solution. In addition, a detection medium, such as colloidal gold, etc., can be arranged in the second region, and the detection medium is pre-combined with the detection molecule. For the detection medium, gold particles will be used as an example to be described in detail below, and for other types of detection media, the same principle can be adopted, wherein these detection media need to have electrical properties, which will be described in detail below. In the present application, the detection medium can be metal nanoparticles, high dielectric nanoparticles, including gold nanoparticles, silver nanoparticles, copper nanoparticles, or copper calcium titanate nanoparticles. The size of the nanoparticles can be between 20 nanometers and 300 nanometers.

[0051] The sample solution in the second region 200 flows through the third region 300 by capillary force. A carbon nanotube field effect transistor may be provided at a corresponding position in the third region. For example, the carbon nanotube field effect transistor may be provided in the third region. In the case where the third region has a porous membrane, the field effect transistor may be provided on the upper side or the lower side of the porous membrane. Figure 1 , the carbon nanotube field effect transistor 310 is arranged on the lower side of the porous membrane in the third region. For example, a recessed portion can be provided on the substrate described below to accommodate the carbon nanotube field effect transistor 310. The carbon nanotube field effect transistor may include a gate, a source electrode, a drain electrode and a channel layer. Wherein the channel layer is deposited by carbon nanotubes. Capture molecules may be provided at positions such as the gate of the carbon nanotube field effect transistor. After the target molecule carrying the detection medium arrives at the carbon nanotube field effect transistor, the capture molecule reacts specifically with the target molecule, so that gold particles are introduced into the carbon nanotube field effect transistor such as the gate position, so that the gate voltage of the gate changes. Due to the change in the gate voltage, the channel resistance also changes, and now the current between the source and the drain and the output current change.

[0052] In the embodiments of the present application, an ultra-thin carbon nanotube channel can be used to make the amplification effect of the field effect transistor more significant. Therefore, a very small amount of biological molecules in the sample solution can combine to produce a significant electrical sensing signal output, thereby achieving rapid detection of ultra-low concentration biological molecules without amplification. The electrical signal can be amplified dozens of times, and the electrical signal generated by the combination of biological molecules is much larger than interference signals such as liquid flow, thereby achieving the purpose of accurate detection.

[0053] In the above description, it is assumed that the sample solution may include a target molecule, the second region includes a detection molecule combined with a detection medium, and the third region includes a capture molecule that can specifically react with the target molecule. As an example, the target molecule may be an antigen to be detected, and the detection molecule may be an antibody that can bind to the antigen. The capture molecule may be an antibody that specifically reacts with the antigen to be detected. As another example, the target molecule may be an antibody, and the detection molecule may be an antigen that can bind to the antibody. The capture molecule may be an antigen to be detected that specifically reacts with the antibody.

[0054] According to a specific embodiment of the present application, the first region may be a sample pad region, the second region may be a conjugate pad region, and the third region may be a porous membrane region.

[0055] The sample solution is dripped into the sample pad and absorbed by the sample pad, and the amount of the sample solution is enough to soak the sample pad. Through the action of capillary force, the sample solution is attracted to the conjugate pad. The conjugate pad is provided with an antibody combined with a detection medium. In the present application, in order to prevent interference with the detection of the target molecule, the detection molecule is arranged at a position different from the position where the capture molecule is located and combines with the target molecule. That is to say, the second area and the third area are arranged to be in different positions. The sample solution can continue to flow along the biosensor (for example, along a porous membrane), and in the process of flowing, the sample solution arrives at the third area, wherein a carbon nanotube field effect transistor is arranged in the third area, and capture molecules can be fixed on the gate of the carbon nanotube field effect transistor, when the sample solution flowing into the third area includes the target molecule, the target molecule will react specifically with the capture molecule, thereby affecting the gate voltage of the carbon nanotube field effect transistor based on the detection medium carried by the target molecule, changing the channel resistance of the carbon nanotube channel, thereby changing the current between the source and the drain and the output current. In this way, the target molecule in the liquid solution can be detected accordingly according to the change of the output current.

[0056] Figure 3 A specific embodiment according to the present application is shown. Figure 3As shown, a sample solution containing a target antigen can be dripped into the first region, and the sample solution flows from the first region through the second region due to capillary force, wherein a detection antibody combined with gold particles (circle representation, detection medium) is preset in the second region. In the second region, the target antigen is combined with the detection antibody. The detection antibody and antigen carrying gold particles flow from the second region through the third region due to capillary force, wherein a carbon nanotube field effect transistor is provided in the third region, and the carbon nanotube field effect transistor can be fixed with a capture antibody, and the fixed capture antibody will react specifically with the antigen. The gold particles carried in this way will cause the gate voltage to change, because the gate voltage changes, the channel resistance of the channel will be changed, so that the current between the source and the drain changes. Accordingly, the output current changes, and the detection of the target antigen is realized by detecting the change of the output current. As described above, the first region can be a sample pad, the second region can be a conjugate pad, and the third region can be a part of the porous membrane different from the second region.

[0057] In conventional detection using transistors, a label-free method is adopted. In order to accurately detect, washing needs to be performed on the transistor, and this washing step is necessary, that is, the excess substances in the sample solution to be tested (such as blood, urine) are washed away, so that only the antigen protein and antibody of the analyte to be tested are combined. The washing process introduces a large number of interference signals. These interference signals come from liquid washing, changes in fluid flow rate, slight changes in the pH of the solution, etc. The size of these interference signals is much larger than the signal changes caused by the analyte to be tested. In other words, conventional detection ignores the need for washing processes and the influence of interference signals in the actual detection process, so the current conventional methods cannot perform accurate detection.

[0058] According to this embodiment, the antibody may be a cardiac troponin I antibody, and the antigen may be cardiac troponin I. According to tests, the electrical signal caused by the gate voltage can be amplified dozens of times, and the signal is much larger than the interference signal generated by the liquid flow, thereby achieving the purpose of accurate measurement.

[0059] In addition, according to the specific characteristics of the target antigen, only the detection medium can be set in the second area. When the target antigen reaches the second area, it combines with the detection medium and flows into the third area with the detection medium, where the target antigen reacts specifically with the capture antibody.

[0060] Figure 4 Another specific implementation according to the present application is given. Figure 4As shown, the target molecule can be a DNA or RNA to be tested, the detection molecule can be a complex of a detection DNA / RNA combined with a detection medium or a complex of a detection DNA / RNA combined with a detection medium, and the capture molecule can be a capture DNA or capture RNA. A sample solution containing a DNA or a DNA to be tested can be dripped into the first region, the sample solution flows through the second region, a detection DNA or a detection RNA combined with gold particles is arranged in the second region, and in the second region, the DNA or the RNA to be tested is combined with the detection DNA or the detection RNA, so that the gold particles can be carried into the third region, and in the third region, the DNA or the RNA to be tested can react specifically with the capture DNA or the capture RNA, so that the DNA or the RNA to be tested can be captured in the gate region of the carbon nanotube field effect transistor, so that the gold particles carried can change the gate voltage, so that the channel resistance and the current between the source and the drain change, so that the output current can be changed. The DNA or the RNA to be tested is detected according to the change in the output current.

[0061] Likewise, Figure 4 The embodiment does not require the washing step of conventional detection, thereby eliminating the influence of interference signals during the washing process, and ultimately achieving accurate detection. Figure 4 In the embodiment, the test substance may be "microRNA-133a", the sequence is UUUGGUCCCCUUCAACCAGCUG, the sequence AAACCAGGGGA may be fixed in the field effect transistor, and the sequence bound to the gold particles in the second region is AGTTGGTCGAC. After testing, the electrical signal of the output current can be amplified dozens of times.

[0062] As described above, the first region may be a sample pad region. The second region may be a conjugate pad region and is located downstream of the first region, and the sample solution may be absorbed from the first region to the second region. The third region may be a detection line region and is located downstream of the second region, and the sample solution in the second region may flow from the second region along the porous membrane into the detection line region. Figure 1 and Figure 2 The biosensor may further include a fourth region 400, which may be located downstream of the third region 300. The fourth region 400 may be a quality control line region, and the purpose of setting the quality control line region is to indicate that the transfer of the sample solution along the porous membrane has been completed, that is, it has reached the quality control line region. The biosensor may further include a fifth region 500, which may be located downstream of the fourth region 400. The fifth region 500 may be an absorption pad for absorbing the remaining sample solution. In addition, as Figure 1 As shown, each region may be disposed on a substrate 600 , for example, the substrate may be a plastic substrate or the like.

[0063] According to the idea of ​​the present application, a combined detection molecule and a detection medium (such as gold particles, etc.) are arranged in the second area between the first area and the third area, wherein the detection medium should have electrical properties. In the second area, when the target molecule combines with the detection molecule and carries the detection medium to the third area, the electrical properties of the detection medium will affect the electrical properties of the carbon nanotube field effect transistor, thereby causing the output current to change, so as to achieve the purpose of detecting the target molecule.

[0064] In addition, in the present application, the channel formed by the carbon nanotubes can be disposed on the silicon substrate, or can be directly attached to the porous membrane material of the third region.

[0065] According to a further embodiment of the present application, a method for preparing a field effect transistor biosensor is also provided. The process of the preparation method will be mainly described below. It should be noted that the corresponding content of the biosensor described above can be incorporated into the description of the preparation method, and for the sake of brevity, it will not be repeated here. In addition, it should be noted that the various steps described in this article are not limited to being implemented in the order of description, and those skilled in the art can perform each step according to actual conditions.

[0066] Figure 5 A flow chart of a preparation method according to an embodiment of the present application is shown. Figure 5 As described above, the preparation method M100 may include steps S102 to S106.

[0067] In step S102, a third region is provided. As described above, the third region may be provided on a substrate, and the material may be a porous membrane material. A field effect transistor may be provided in the third region, the field effect transistor including a gate, a source, a drain and a channel layer, the field effect transistor having a capture molecule fixed thereto, and the third region is configured such that the sample solution is absorbed to the position of the field effect transistor.

[0068] In step S104, a second region is set. The second region can be set in the form of a binding pad as above. A detection molecule combined with a detection medium is set in the second region, and the second region is configured so that the sample solution is absorbed from the second region to the third region. When the sample solution flows through the second region, the detection molecule combines with the target molecule to carry the detection medium to the position of the field effect transistor in the third region.

[0069] In step S106, a first region is set. The first region may be set in the form of a sample pad. The first region is used to receive a sample solution and is configured to absorb the sample solution from the first region to the second region.

[0070] In the present application, the field effect transistor and the detection medium are configured such that when the capture molecule reacts with the target molecule, the gate voltage of the gate changes based on the detection medium carried by the detection molecule bound to the target molecule, causing the channel resistance, the current between the source and the drain, and the output current to change.

[0071] In addition, if Figure 6 As shown, step S108 and step S110 may also be included.

[0072] In step S108, a fourth area may be set so that the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is set as a quality control line area to verify that the transfer of the sample solution is completed. The specific content of the fourth area can be referred to the above description, and will not be repeated here.

[0073] In step S110, a fifth area may be provided so that the liquid of the sample solution flowing through the fourth area can be absorbed by the fifth area. The fifth area 500 may be an absorption pad for absorbing the remaining liquid of the sample solution.

[0074] In addition, as described above, the method may also include steps such as setting a substrate. It should be noted that the method described in this application may not be performed in the order described.

[0075] According to a further embodiment of the present application, a method for manufacturing the carbon nanotube field effect transistor biosensor described in the present application is also provided. Figure 7 It should be noted that in the method description of the present application, each step is described only for the convenience of description, but the description order is not used to limit the execution order of the method.

[0076] In step S202, a shell is prepared, for example, by 3D printing, wherein the shell can be used as the substrate described above. Figure 1 As shown, in the present application, the carbon nanotube field effect transistor can be preferably placed on the lower side of the porous membrane. At this time, a recessed portion can be provided at a position corresponding to the third region in the prepared shell to accommodate the carbon nanotube field effect transistor.

[0077] In step S204, a carbon nanotube field effect transistor may be prepared, wherein the specific structure of the carbon nanotube field effect transistor may refer to the above description. Capture molecules are fixed on the prepared carbon nanotube field effect transistor and then arranged in the above-mentioned recessed portion.

[0078] In step S206, a porous membrane, a sample pad, a binding pad, an absorption pad, etc. are placed in the prepared shell to form the first region, the second region, the third region, the fourth region, and the fifth region, etc. described above. A detection molecule is formed in the second region, and the third region is arranged on the upper side of the placed carbon nanotube field effect transistor. According to a further embodiment of the present application, a biological detection method of a biosensor is also provided. The detection method may include: dripping a sample solution into the first region; measuring the output current between the source and the drain of the field effect transistor; and detecting the target molecule according to the change in the output current.

[0079] After the sample solution is dripped into the first area, the sample solution is absorbed into the second area. In the second area, the target molecules in the sample solution are combined with the detection molecules preset in the second area, wherein the detection molecules here are combined with the detection medium, and the detection medium has electrical characteristics that can affect the gate voltage of the field effect transistor. Then the sample solution is absorbed into the position of the field effect transistor in the third area, and the target molecules are captured by the capture molecules, so that the detection medium carried affects the electrical characteristics of the gate voltage, thereby causing the output current to change, and finally the detection of the target molecules is achieved according to the change of the output current.

[0080] In the present application, detection molecules with electrical properties can be introduced at the second region to amplify the detection signal of the field effect transistor, and the entire detection process is fast and easy to operate, without the need for any pumps or valves and other components. In addition, according to the biosensor of the present application, the electrical signal does not require an optical conversion unit (which is required by fluorescence and other methods), and the detection equipment will be smaller and simpler, making it easier to use for portable or bedside detection.

[0081] According to the embodiments of the present application, a field effect transistor in the form of a liquid gate may be used, and the liquid gate may be arranged in the region where the solution is located. Figure 8 As shown, carbon nanotubes are used as the channel layer of the field effect transistor, and a dielectric layer may be provided between the channel layer and the liquid gate, wherein the capture molecules may be fixed to the dielectric layer. Fig. 9 Another embodiment of a liquid gate field effect transistor is shown, the liquid gate can be arranged on a substrate or a dielectric layer, wherein the capture molecule can be fixed to the dielectric layer. In the present application, the liquid gate can be an Ag / AgCl electrode or an Au electrode, or a Pt electrode. In addition, a liquid gate can be arranged on the basis of a bottom gate field effect transistor, such as Fig.10 As shown, the liquid gate can be arranged in the area where the solution is located, wherein the capture molecules are fixed in the carbon nanotube channel layer, a dielectric layer can be arranged under the carbon nanotube channel layer, and a gate can be arranged under the dielectric layer. In addition, a dielectric layer can be further arranged between the liquid gate and the carbon nanotube channel layer, in which case the capture molecules can be assembled to the dielectric layer. Fig.11 As shown, the liquid gate can be arranged on the substrate or the dielectric layer. Fig.12 As shown, a bottom-gate field effect transistor can also be used, in which the capture molecules can be assembled into the carbon nanotube channel layer.

[0082] In the description of this specification, the description with reference to the terms "one embodiment / method", "some embodiments / methods", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment / method or example are included in at least one embodiment / method or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment / method or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments / methods or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments / methods or examples described in this specification and the features of the different embodiments / methods or examples, unless they are contradictory.

[0083] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In the description of this application, the meaning of "plurality" is at least two, such as two, three, etc., unless otherwise clearly and specifically defined.

[0084] Those skilled in the art should understand that the above embodiments are only for the purpose of clearly illustrating the present application, and are not intended to limit the scope of the present application. For those skilled in the art, other changes or modifications may be made based on the above disclosure, and these changes or modifications are still within the scope of the present application.

Claims

1. A field effect transistor biosensor, characterized in that: include: a first region, the first region receiving and absorbing a sample solution; a second region, wherein the sample solution can flow from the first region through the second region due to capillary force, and a detection molecule combined with a detection medium is arranged in the second region, and when a target molecule exists in the sample solution, the detection molecule combines with the target molecule in the sample solution; a third region, through which the sample solution passing through the second region flows due to capillary force; as well as a field effect transistor, the field effect transistor being arranged in the third region and comprising a gate, a source, a drain and a channel layer, The field effect transistor is fixed with capture molecules, which react specifically with the target molecules. Based on the detection medium carried by the detection molecules bound to the target molecules, the gate voltage of the gate changes, causing the channel resistance, the current between the source and the drain, and the output current to change, and the target molecules are detected based on the change in the output current.

2. The biosensor according to claim 1, wherein It also includes a fourth area, and the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force. The fourth area is set as a quality control line area to verify that the transfer of the sample solution is completed.

3. The biosensor according to claim 2, wherein: A fifth region is further included, and liquid of the sample solution flowing through the fourth region can be absorbed by the fifth region due to capillary force.

4. The biosensor according to claim 1, wherein The target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a complex of a detection antibody and a detection medium or a complex of a detection antigen and a detection medium, and the capture molecule is a capture antibody or a capture antigen.

5. The biosensor according to claim 1, wherein The target molecule is the DNA / RNA to be detected or the DNA / RNA to be detected, the detection molecule is a complex of the detection DNA / RNA and the detection medium or a complex of the detection DNA / RNA and the detection medium, and the capture molecule is capture DNA / RNA or capture DNA / RNA.

6. The biosensor according to claim 1, wherein The channel layer is made of carbon nanotubes.

7. The biosensor according to any one of claims 1 to 6, characterized in that The detection medium is metal nanoparticles or high dielectric nanoparticles, including gold nanoparticles, silver nanoparticles, copper nanoparticles, or copper calcium titanate nanoparticles.

8. The biosensor according to any one of claims 1 to 6, characterized in that The first area is a sample pad area, the second area is a conjugate pad area, and the third area is a porous membrane area; Optionally, the channel layer of the field effect transistor is arranged on a substrate.

9. A method for preparing a field effect transistor biosensor, wherein the biosensor can be used to detect target molecules in a sample solution, characterized in that: include: A third region is provided, wherein a field effect transistor is provided in the third region, wherein the field effect transistor comprises a gate, a source, a drain and a channel layer, and a capture molecule is fixed to the field effect transistor, and the third region is configured so that the sample solution flows through the position of the field effect transistor due to capillary force; A second region is provided, wherein the second region is provided with detection molecules combined with a detection medium, and the second region is configured so that the sample solution flows from the second region through the third region due to capillary force, and when the sample solution flows through the second region, the detection molecules combine with the target molecules, so as to carry the detection medium to the position of the field effect transistor in the third region; as well as A first area is provided, the first area is used to receive the sample solution, and is configured to allow the sample solution to flow from the first area to the second area. Wherein, the field effect transistor and the detection medium are configured such that: when the capture molecule reacts with the target molecule, based on the detection medium carried by the detection molecule bound to the target molecule, the gate voltage of the gate changes, so that the channel resistance, the current between the source and the drain, and the output current change; Optionally, a fourth area is further provided so that the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is provided as a quality control line area to verify that the transfer of the sample solution is completed; Optionally, the method further comprises setting a fifth area so that the liquid of the sample solution flowing through the fourth area can be absorbed by the fifth area; Optionally, the target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a complex of a detection antibody and a detection medium or a complex of a detection antigen and a detection medium, and the capture molecule is a capture antibody or a capture antigen; Optionally, the target molecule is a DNA / RNA to be detected or a DNA / RNA to be detected, the detection molecule is a complex of a detection DNA / RNA combined with a detection medium or a complex of a detection DNA / RNA combined with a detection medium, and the capture molecule is a capture DNA / RNA or a capture DNA / RNA; Optionally, the channel layer is composed of carbon nanotubes, and / or the detection medium is metal nanoparticles or high dielectric nanoparticles, including gold nanoparticles, silver nanoparticles, copper nanoparticles and / or copper calcium titanate nanoparticles.

10. A biological detection method using the biosensor according to any one of claims 1 to 8, characterized in that: include: Dropping a sample solution into the first area; measuring an output current between a source and a drain of the field effect transistor; as well as The target molecule is detected according to the change of the output current.

Images