Field effect transistor biosensor, preparation method and detection method

Abstract

The invention provides a field effect transistor biosensor, a preparation method and a detection method. The biosensor includes: a first region that receives and absorbs a sample solution; the sample solution can flow through the second area from the first area due to capillary force, a nanoparticle-detection molecule-enzyme conjugate is arranged in the second area, and when a target molecule exists in the sample solution, the detection molecule is combined with the target molecule in the sample solution; the sample solution passing through the second area flows through the third area due to capillary force; the field effect transistor is arranged in the third region and comprises a grid electrode, a source electrode, a drain electrode and a channel layer, the third region is further provided with capture molecules, the capture molecules and target molecules are subjected to specific reaction, and based on an enzyme catalysis reaction product of enzyme in a conjugate, the grid electrode voltage of the grid electrode is changed; the current between the channel resistance, the source electrode and the drain electrode, and the output current are changed, and the target molecule is detected according to the change.

Description

Technical Field

[0001] The present application relates to a field effect transistor biosensor, a preparation method and a detection method. Background Art

[0002] In order to detect ultra-low concentration biomolecules, an amplification method is used. However, this method has a complicated process. The usual detection method is a detection method based on fluorescence or colorimetric labeling. At present, there is also a transistor method for detecting biomolecules, but because accurate detection requires washing on the transistor, the excess substances in the test solution are washed away, so that only the analyte antigen protein to be tested binds to the antibody on the surface of the transistor. The washing process introduces a large number of interference signals. These interference signals come from liquid washing, changes in fluid flow rate, slight changes in the pH of the solution, etc. The size of these interference signals is much larger than the signal change caused by the protein to be tested. It ignores the need for washing in the actual sample detection process and the influence of interference signals, so the current traditional methods cannot perform accurate actual sample detection. Summary of the invention

[0003] In order to solve one of the above technical problems, the present application provides a field effect transistor biosensor, a preparation method and a detection method.

[0004] According to one aspect of the present application, a field effect transistor biosensor is provided, comprising:

[0005] a first region, the first region receiving and absorbing a sample solution;

[0006] a second region, wherein the sample solution flows from the first region through the second region due to capillary force, a nanoparticle-detection molecule-enzyme conjugate is disposed in the second region, and when a target molecule exists in the sample solution, the detection molecule binds to the target molecule in the sample solution;

[0007] a third region through which the sample solution passing through the second region flows due to capillary force; and

[0008] a field effect transistor, the field effect transistor being arranged in the third region and comprising a gate, a source, a drain and a channel layer,

[0009] The third region is also provided with a capture molecule, which specifically reacts with the target molecule. Based on the enzyme-catalyzed reaction product of the enzyme in the conjugate, the gate voltage of the gate changes, causing the channel resistance, the current between the source and the drain, and the output current to change, and the target molecule is detected based on the change in the output current.

[0010] According to the biosensor of at least one embodiment of the present application, the target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a detection antibody or a detection antigen, and the capture molecule is a capture antibody or a capture antigen.

[0011] According to the biosensor of at least one embodiment of the present application, the target molecule is a DNA or RNA to be detected, the detection molecule is a detection DNA or a detection RNA, and the capture molecule is a capture DNA or a capture RNA.

[0012] According to the biosensor of at least one embodiment of the present application, the channel layer is made of carbon nanotubes.

[0013] According to the biosensor of at least one embodiment of the present application, the first area is a sample pad area, the second area is a conjugate pad area, and the third area is a detection line area.

[0014] According to the biosensor of at least one embodiment of the present application, the detection line region is composed of a porous membrane, wherein the capture molecule is immobilized to the porous membrane.

[0015] In the biosensor according to at least one embodiment of the present application, the channel layer of the field effect transistor is disposed on a substrate.

[0016] According to at least one embodiment of the biosensor of the present application, the biosensor further includes a fourth area, through which the liquid of the sample solution passing through the third area flows due to capillary force, and the fourth area is set as a quality control line area to verify that the transfer of the sample solution is completed.

[0017] The biosensor according to at least one embodiment of the present application further includes a fifth region, and liquid of the sample solution flowing through the fourth region can be absorbed by the fifth region due to capillary force.

[0018] According to another aspect of the present application, a method for preparing a field effect transistor biosensor is provided, wherein the biosensor can be used to detect target molecules in a sample solution, comprising:

[0019] A third region is provided, wherein a field effect transistor is provided in the third region, wherein the field effect transistor comprises a gate, a source, a drain and a channel layer, wherein a capture molecule that reacts specifically with the target molecule is fixed to the third region, and wherein the third region is configured so that the sample solution flows through the position of the field effect transistor due to capillary force;

[0020] A second region is provided, wherein a nanoparticle-detection molecule-enzyme conjugate is provided in the second region, and the second region is configured so that the sample solution flows from the second region through the third region due to capillary force, and when the sample solution flows through the second region, the detection molecule binds to the target molecule so as to carry the conjugate to the position of the field effect transistor in the third region; and

[0021] providing a first area, the first area being used to receive the sample solution and being configured to absorb the sample solution from the first area to the second area,

[0022] Wherein, the field effect transistor and the enzyme in the conjugate are configured such that: based on the enzyme-catalyzed reaction product of the enzyme in the conjugate, the gate voltage of the gate changes, so that the channel resistance, the current between the source and the drain, and the output current change, and the target molecule is detected according to the change of the output current.

[0023] According to the preparation method of at least one embodiment of the present application, the target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a detection antibody or a detection antigen, and the capture molecule is a capture antibody or a capture antigen.

[0024] According to the preparation method of at least one embodiment of the present application, the target molecule is a DNA to be detected or a RNA to be detected, the detection molecule is a detection DNA or a detection RNA, and the capture molecule is a capture DNA or a capture RNA.

[0025] According to the preparation method of at least one embodiment of the present application, the channel layer is composed of carbon nanotubes.

[0026] According to the preparation method of at least one embodiment of the present application, the third region is composed of a porous membrane, wherein the capture molecules are immobilized to the porous membrane.

[0027] According to at least one embodiment of the preparation method of the present application, a fourth area is further provided so that the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is provided as a quality control line area to verify that the transfer of the sample solution is completed.

[0028] According to at least one embodiment of the preparation method of the present application, the fifth area is further provided so that liquid of the sample solution flowing through the fourth area can be absorbed by the fifth area.

[0029] According to another aspect of the present application, a biological detection method using the above-mentioned biosensor is provided, comprising:

[0030] Dropping a sample solution into the first area;

[0031] measuring an output current between a source and a drain of the field effect transistor; and

[0032] The target molecule is detected according to the change of the output current. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings illustrate exemplary embodiments of the present application and together with the description are used to explain the principles of the present application. These drawings are included to provide a further understanding of the present application, and the drawings are included in and constitute a part of this specification.

[0034] Figure 1 It is a schematic structural diagram (stereoscopic diagram) of a biosensor according to one embodiment of the present application.

[0035] Figure 2 It is a schematic structural diagram (top view) of a biosensor according to one embodiment of the present application.

[0036] Figure 3 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0037] Figure 4 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0038] Figure 5 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0039] Figure 6 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0040] Figure 7 It is a schematic diagram of biological detection according to one embodiment of the present application.

[0041] Figure 8 It is a flow chart of a preparation method according to one embodiment of the present application.

[0042] Fig. 9 It is a flow chart of a preparation method according to one embodiment of the present application.

[0043] Fig.10 It is a flow chart of a preparation method according to one embodiment of the present application.

[0044] Figures 11 to 14 is a schematic diagram of a field effect transistor according to an embodiment of the present application. DETAILED DESCRIPTION

[0045] The present application is further described in detail below in conjunction with the accompanying drawings and implementation methods. It is to be understood that the specific implementation methods described herein are only used to explain the relevant content, rather than to limit the present application. It should also be noted that, for ease of description, only the parts related to the present application are shown in the accompanying drawings.

[0046] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments in the present application can be combined with each other. The technical solution of the present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0047] Unless otherwise specified, the exemplary embodiments / embodiments shown will be understood as providing exemplary features of various details of some ways in which the technical concept of the present application can be implemented in practice. Therefore, unless otherwise specified, the features of the various embodiments / embodiments can be combined, separated, interchanged and / or rearranged in addition without departing from the technical concept of the present application.

[0048] The use of cross-hatching and / or shading in the accompanying drawings is generally used to make the boundaries between adjacent components clear. As such, unless otherwise specified, the presence or absence of cross-hatching or shading does not convey or indicate any preference or requirement for the specific materials, material properties, dimensions, proportions, commonalities between the components shown, and / or any other characteristics, attributes, properties, etc. of the components. In addition, in the accompanying drawings, the sizes and relative sizes of the components may be exaggerated for clarity and / or descriptive purposes. When the exemplary embodiments can be implemented differently, the specific process sequence can be performed in a different order than described. For example, two successively described processes can be performed substantially simultaneously or in an order opposite to the described order. In addition, the same figure numbers represent the same components.

[0049] When a component is referred to as being "on" or "over," "connected to," or "coupled to" another component, the component may be directly on, directly connected to, or directly coupled to the other component, or intervening components may be present. However, when a component is referred to as being "directly on," "directly connected to," or "directly coupled to" another component, there are no intervening components. For this purpose, the term "connected" may refer to a physical connection, an electrical connection, etc., with or without intervening components.

[0050] For descriptive purposes, this application may use spatially relative terms such as "under", "beneath", "under", "down", "over", "upper", "above", "higher", and "side (e.g., as in "sidewall")" to describe the relationship of one component to another (other) component as shown in the accompanying drawings. The spatially relative terms are intended to encompass different orientations of the device in use, operation, and / or manufacture in addition to the orientation depicted in the accompanying drawings. For example, if the device in the accompanying drawings is turned over, components described as "under" or "beneath" other components or features would subsequently be positioned as "over" the other components or features. Thus, the exemplary term "under" can encompass both the "over" and "under" orientations. Furthermore, the device may be otherwise oriented (e.g., rotated 90 degrees or at other orientations), and the spatially relative descriptors used herein should be interpreted accordingly.

[0051] The terms used here are for the purpose of describing specific embodiments, and are not intended to be restrictive. As used here, unless the context clearly indicates otherwise, the singular forms "one (kind, person)" and "said (the)" are also intended to include plural forms. In addition, when the terms "comprise" and / or "include" and their variations are used in this specification, it is explained that there are stated features, integral bodies, steps, operations, parts, assemblies and / or their groups, but it is not excluded that there are or add one or more other features, integral bodies, steps, operations, parts, assemblies and / or their groups. It should also be noted that, as used here, the terms "substantially", "approximately" and other similar terms are used as approximate terms and not as degree terms, so that they are used to explain the inherent deviations of the measured values, calculated values ​​and / or the values ​​provided that will be recognized by those of ordinary skill in the art.

[0052] According to one embodiment of the present application, a carbon nanotube field effect transistor biosensor is provided.

[0053] The biosensor can be used to detect target molecules. Figure 1 and Figure 2 As shown, the biosensor may include a first region 100 , a second region 200 , a third region 300 and a carbon nanotube field effect transistor 310 .

[0054] The first region 100 can receive and absorb a sample solution having a target molecule, for example, the sample solution can be dripped into the first region 100 by dripping, etc., and the sample solution is absorbed by the first region 100. The sample solution can flow from the first region 100 through the second region 200 along the biosensor by capillary force. A nanoparticle-detection molecule-enzyme conjugate is arranged in the second region, wherein the detection molecule can be combined with the target molecule in the sample solution. In the present application, the size of the nanoparticle can be 20 nanometers to 300 nanometers, and the nanomaterial is not limited, and can include metal nanoparticles, high dielectric nanoparticles, semiconductor nanoparticles, insulating nanoparticles, etc., for example, gold nanoparticles, silver nanoparticles, copper nanoparticles, silicon dioxide particles, or copper calcium titanate nanoparticles.

[0055] The sample solution of the second region 200 flows through the third region 300 by capillary force. At the corresponding position of the third region, a carbon nanotube field effect transistor may be provided. For example, the carbon nanotube field effect transistor may be provided in the third region, and in the case where the third region has a porous membrane, the field effect transistor may be provided on the upper side or the lower side of the porous membrane. The carbon nanotube field effect transistor may include a gate, a source electrode, a drain electrode and a channel layer. Wherein the channel layer is deposited by carbon nanotubes. Capture molecules may be provided at appropriate positions in the third region, for example, in the case where the third region is composed of a porous membrane, the capture molecules may be fixed to the porous membrane. In addition, the third region may be the detection line region of a biosensor. After the target molecule carrying the conjugate arrives at the carbon nanotube field effect transistor, the capture molecule reacts specifically with the target molecule, so that the enzyme is introduced into the carbon nanotube field effect transistor such as the gate position, and the catalytic reaction product of the enzyme is passed through the gate voltage of the gate to change. Due to the change in the gate voltage, the channel resistance also changes, and the current between the source and the drain and the output current change at this time.

[0056] exist Figure 1 3 shows a case where the carbon nanotube field effect transistor 310 is disposed on the lower side of the porous membrane in the third region. For example, a recessed portion may be disposed on the substrate as described below to accommodate the carbon nanotube field effect transistor 310.

[0057] In the embodiments of the present application, an ultra-thin carbon nanotube channel can be used to make the amplification effect of the field effect transistor more significant. Therefore, a very small amount of biological molecules in the sample solution can combine to produce a significant electrical sensing signal output, thereby achieving rapid detection of ultra-low concentration biological molecules without amplification. The electrical signal can be amplified dozens of times, and the electrical signal generated by the combination of biological molecules is much larger than interference signals such as liquid flow, thereby achieving the purpose of accurate detection.

[0058] In the above description, it is assumed that the sample solution may include a target molecule, the second region includes a detection molecule combined with a nanoparticle-detection molecule-enzyme conjugate, and the third region includes a capture molecule that can specifically react with the target molecule. As an example, the target molecule may be an antigen to be detected, and the detection molecule may be an antibody that can bind to the antigen. The capture molecule may be an antibody that specifically reacts with the antigen to be detected. As another example, the target molecule may be an antibody, and the detection molecule may be an antigen that can bind to the antibody. The capture molecule may be an antigen to be detected that specifically reacts with the antibody.

[0059] According to a specific embodiment of the present application, the first region may be a sample pad region, the second region may be a conjugate pad region, and the third region may be a porous membrane region.

[0060] The sample solution is dripped into the sample pad and absorbed by the sample pad, and the amount of the sample solution is enough to soak the sample pad. Through the action of capillaries, the sample solution is attracted to the conjugate pad. The conjugate pad is provided with a conjugate of nanoparticle-detection molecule-enzyme. In the present application, in order to prevent interference with the detection of the target molecule, the detection molecule is arranged at a position different from the position where the capture molecule is located and combines with the target molecule. That is to say, the second area and the third area are arranged to be in different positions. The sample solution can continue to flow along the biosensor (for example, along a porous membrane), and in the process of flowing, the sample solution arrives at the third area, wherein a carbon nanotube field effect transistor is arranged in the third area, and capture molecules can be fixed at the corresponding position of the third area corresponding to the carbon nanotube field effect transistor, when the sample solution flowing into the third area includes the target molecule, the target molecule will react specifically with the capture molecule, thereby affecting the gate voltage of the carbon nanotube field effect transistor based on the catalytic reaction product of the enzyme in the conjugate of nanoparticle-detection molecule-enzyme, changing the channel resistance of the carbon nanotube channel, thereby changing the current between the source and drain and the output current. In this way, the target molecules in the liquid solution can be detected accordingly according to the changes in the output current.

[0061] The concentration of the detection molecule in the sample is proportional to the amount of enzyme. The enzyme catalyzes the substrate to produce a product, and the product generates an increase in the electrical signal on the transistor, so the detection molecule in the sample and the increase in the electrical signal are positively correlated. Alternatively, the concentration of the detection molecule in the sample is proportional to the amount of enzyme. The substrate generates a signal on the transistor, and the enzyme reaction consumes the substrate, so the detection molecule in the sample and the decrease in the electrical signal are positively correlated.

[0062] Figure 3 A specific embodiment according to the present application is shown. Figure 3As shown, a sample solution containing a target antigen can be dripped into the first region, and the sample solution is attracted to the second region, wherein a conjugate of nanoparticles-detection antibodies-enzymes is preset in the second region. In the second region, the target antigen is combined with the detection antibody. The conjugate and the antigen are attracted to the third region, wherein a carbon nanotube field effect transistor is provided in the third region, and the carbon nanotube field effect transistor can be fixed with a capture antibody, and the fixed capture antibody will react specifically with the antigen. In this way, the enzyme catalytic reaction product in the conjugate will cause the gate voltage to change, because the gate voltage changes, the channel resistance of the channel will be changed, so that the current between the source and the drain changes. Accordingly, the output current changes, and the detection of the target antigen is achieved by detecting the change in the output current. As described above, the first region can be a sample pad, the second region can be a conjugate pad, and the third region can be a part of the porous membrane different from the second region.

[0063] like Figure 3 As shown, the enzyme described above can be an enzyme-labeled biotin combined with biotin, the detection antibody can be a biotinylated antibody combined with biotin, and the enzyme-labeled biotin and the biotinylated antibody can be bound to avidin and attached to the surface of the nanoparticles. In this way, after the detection antibody is bound to the target antigen, it reaches the third region, and the target antigen can be bound to the capture antibody in the porous membrane arranged in the third region. In addition, the enzyme can be horseradish peroxidase or catalase.

[0064] Figure 3 A specific implementation method according to the present application is shown. Figure 4 Another embodiment of the present application is shown. Figure 4 As shown, the detection antibody can be a biotinylated antibody bound to biotin, bound to avidin, and the enzyme is also bound to avidin, thereby forming an enzyme-avidin-biotin-detection antibody complex, which is adsorbed to the nanoparticles to bind to the capture antibody set in the porous membrane of the third region. As another example, Figure 5 As shown, the detection antibody can be a biotinylated antibody that binds to biotin and is linked to the nanoparticles via avidin, and the enzyme is bound to biotin and is linked to the nanoparticles via avidin.

[0065] In conventional detection using transistors, a label-free method is adopted. In order to accurately detect, washing needs to be performed on the transistor, and this washing step is necessary, that is, the excess substances in the sample solution to be tested (such as blood, urine) are washed away, so that only the antigen protein and antibody of the analyte to be tested are combined. The washing process introduces a large number of interference signals. These interference signals come from liquid washing, changes in fluid flow rate, slight changes in the pH of the solution, etc. The size of these interference signals is much larger than the signal changes caused by the analyte to be tested. In other words, conventional detection ignores the need for washing processes and the influence of interference signals in the actual detection process, so the current conventional methods cannot perform accurate detection.

[0066] According to this embodiment, the antibody may be a cardiac troponin I antibody, and the antigen may be cardiac troponin I. According to tests, the electrical signal caused by the gate voltage can be amplified dozens of times, and the signal is much larger than the interference signal generated by the liquid flow, thereby achieving the purpose of accurate measurement.

[0067] Figure 6 Another specific implementation according to the present application is given. Figure 6 As shown, the target molecule can be a DNA or RNA to be tested, the detection molecule can be a detection DNA or RNA to be tested, and the capture molecule can be a capture DNA or RNA to be captured. A sample solution containing the DNA or RNA to be tested can be dripped into the first region, and the sample solution is attracted to the second region, and a nanoparticle-detection DNA or RNA-enzyme conjugate is arranged in the second region, and the DNA or RNA to be tested is combined with the detection DNA or RNA to be tested in the second region, so that the conjugate and the DNA or RNA to be tested enter the third region, and in the third region, the DNA or RNA to be tested can react specifically with the capture DNA or RNA to be tested, so that the DNA or RNA to be tested is captured in the gate region of the carbon nanotube field effect transistor, so that the catalytic reaction product of the enzyme of the conjugate can cause the gate voltage to change, so that the channel resistance and the current between the source and the drain change, so that the output current can change. The DNA or RNA to be tested is detected according to the change of the output current.

[0068] like Figure 6As shown, the enzyme described above can be an enzyme-labeled biotin combined with biotin, the particles can be gold particles, the detection DNA or detection RNA can be DNA or RNA combined with sulfhydryl groups, and the enzyme-labeled biotin can be bound to the gold particle avidin, and the detection DNA or detection RNA can be bound to the surface of the gold particle through the sulfhydryl group. In this way, after the detection DNA or detection RNA is combined with the target DNA or RNA, it reaches the third area, and the target DNA or RNA can be combined with the capture DNA or RNA in the porous membrane set in the third area. In addition, the enzyme can be horseradish peroxidase or catalase. For example, in Figure 6 The method of binding the detection DNA or detection RNA to the gold nanoparticles is shown in FIG. 1 . However, for other nanoparticles, the biotinylated DNA or RNA bound to the detection DNA or detection RNA can be bound to avidin and then bound to the nanoparticles, and the following Figure 7 similar.

[0069] Figure 6 A specific implementation method according to the present application is shown. Figure 7 Another embodiment of the present application is shown. Figure 7 As shown, the detection DNA or detection RNA can be a biotinylated DNA or RNA bound to biotin, bound to avidin, and the enzyme is also bound to avidin to form an enzyme-avidin-biotin-detection DNA or RNA complex, which is adsorbed to the nanoparticles and thus binds to the captured DNA or RNA in the porous membrane set in the third area.

[0070] Likewise, Figure 6 and Figure 7 The embodiment does not require the washing step of conventional detection, thereby eliminating the influence of interference signals during the washing process, and ultimately achieving accurate detection. Figure 6 and Figure 7 In the embodiment, the analyte may be "microRNA-133a", the sequence is UUUGGUCCCCUUCAACCAGCUG, the sequence AAACCAGGGGA may be fixed in the field effect transistor, and the sequence of the detection antibody in the binding substance at the second region is AGTTGGTCGAC. After testing, the electrical signal of the output current can be amplified by dozens of times.

[0071] As described above, the first region may be a sample pad region. The second region may be a conjugate pad region and is located downstream of the first region, and the sample solution may be absorbed from the first region to the second region. The third region may be a detection line region and is located downstream of the second region, and the sample solution in the second region may flow from the second region along the porous membrane into the detection line region. Figure 1 and Figure 2The biosensor may further include a fourth region 400, which may be located downstream of the third region 300. The fourth region 400 may be a quality control line region, and the purpose of setting the quality control line region is to indicate that the transfer of the sample solution along the porous membrane has been completed, that is, it has reached the quality control line region. The biosensor may further include a fifth region 500, which may be located downstream of the fourth region 400. The fifth region 500 may be an absorption pad for absorbing the remaining sample solution. In addition, as Figure 1 As shown, each region may be disposed on a substrate 600 , for example, the substrate may be a plastic substrate or the like.

[0072] According to the idea of ​​the present application, a nanoparticle-detection antibody-enzyme conjugate is arranged in the second region between the first region and the third region, wherein the catalytic reaction product or catalytic reaction substrate of the enzyme should have electrical properties. In the second region, when the target molecule combines with the detection molecule and reaches the third region, the electrical properties of the catalytic reaction product or catalytic reaction substrate of the enzyme will affect the electrical properties of the carbon nanotube field effect transistor, thereby causing the output current to change, so as to achieve the purpose of detecting the target molecule.

[0073] In addition, in the present application, the channel formed by the carbon nanotubes can be disposed on the silicon substrate, or can be directly attached to the porous membrane material of the third region.

[0074] According to a further embodiment of the present application, a method for preparing a field effect transistor biosensor is also provided. The process of the preparation method will be mainly described below. It should be noted that the corresponding content of the biosensor described above can be incorporated into the description of the preparation method, and for the sake of brevity, it will not be repeated here. In addition, it should be noted that the various steps described in this article are not limited to being implemented in the order of description, and those skilled in the art can perform each step according to actual conditions.

[0075] Figure 8 A flow chart of a preparation method according to an embodiment of the present application is shown. Figure 7 As described above, the preparation method M100 may include steps S102 to S106.

[0076] In step S102, a third region is provided. As described above, the third region may be provided on a substrate, and the material may be a porous membrane material. A field effect transistor may be provided in the third region, and the field effect transistor includes a gate, a source electrode, a drain electrode, and a channel layer. Capture molecules are fixed to the third region, and the third region is configured so that the sample solution is absorbed to the position of the field effect transistor.

[0077] In step S104, a second region is set. The second region can be set in the form of a binding pad as above. The second region is provided with an enzyme catalytic reaction product, and the second region is configured so that the sample solution is absorbed from the second region to the third region, and when the sample solution flows through the second region, the detection molecule binds to the target molecule so as to carry the conjugate to the position of the field effect transistor in the third region.

[0078] In step S106, a first region is set. The first region may be set in the form of a sample pad. The first region is used to receive a sample solution and is configured to absorb the sample solution from the first region to the second region.

[0079] In the present application, the field effect transistor and the enzyme are configured such that: the capture molecule reacts specifically with the target molecule, and the enzyme catalyzes the reaction product to change the gate voltage of the gate, so that the channel resistance, the current between the source and the drain, and the output current change. Alternatively, the substrate changes the gate voltage of the gate, and the enzyme catalyzes the substrate to reduce the change amplitude, so that the channel resistance, the current between the source and the drain, and the output current change.

[0080] In addition, if Fig. 9 As shown, step S108 and step S110 may also be included.

[0081] In step S108, a fourth area may be set so that the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is set as a quality control line area to verify that the transfer of the sample solution is completed. The specific content of the fourth area can be referred to the above description, and will not be repeated here.

[0082] In step S110, a fifth area may be provided so that the liquid of the sample solution flowing through the fourth area can be absorbed by the fifth area. The fifth area 500 may be an absorption pad for absorbing the remaining liquid of the sample solution.

[0083] In addition, as described above, the method may also include steps such as setting a substrate. It should be noted that the method described in this application may not be performed in the order described.

[0084] According to a further embodiment of the present application, a method for manufacturing the carbon nanotube field effect transistor biosensor described in the present application is also provided. Fig.10 It should be noted that in the method description of the present application, each step is described only for the convenience of description, but the description order is not used to limit the execution order of the method.

[0085] In step S202, a shell is prepared, for example, by 3D printing, wherein the shell can be used as the substrate described above. Figure 1 As shown, in the present application, the carbon nanotube field effect transistor can be preferably placed on the lower side of the porous membrane. At this time, a recessed portion can be provided at a position corresponding to the third region in the prepared shell to accommodate the carbon nanotube field effect transistor.

[0086] In step S204, a carbon nanotube field effect transistor may be prepared, wherein the specific structure of the carbon nanotube field effect transistor may refer to the above description. Capture molecules are fixed on the prepared carbon nanotube field effect transistor and then arranged in the above-mentioned recessed portion.

[0087] In step S206, a porous membrane, a sample pad, a conjugate pad, an absorption pad, etc. are placed in the prepared shell to form the first region, the second region, the third region, the fourth region, the fifth region, etc. described above. A nanoparticle-detection molecule-enzyme conjugate is formed in the second region, and the third region is arranged on the upper side of the placed carbon nanotube field effect transistor. According to a further embodiment of the present application, a biological detection method of a biosensor is also provided. The detection method may include: dripping a sample solution into the first region; measuring the output current between the source and the drain of the field effect transistor; and detecting the target molecule according to the change in the output current.

[0088] After the sample solution is dripped into the first area, the sample solution is absorbed into the second area. In the second area, the target molecule in the sample solution is combined with the detection molecule of the nanoparticle-detection molecule-enzyme conjugate preset in the second area. In the third area, the enzyme of the conjugate performs a catalytic reaction, and the enzyme catalytic reactant has an electrical characteristic that can affect the gate voltage of the field effect transistor. Then the sample solution is absorbed into the position of the field effect transistor in the third area, and the target molecule is captured by the capture molecule, so that the enzyme catalytic reactant affects the electrical characteristics of the gate voltage, thereby causing the output current to change, and finally the detection of the target molecule is achieved according to the change in the output current.

[0089] In the present application, a nanoparticle-detection molecule-enzyme combination can be introduced in the second region, and the enzyme-catalyzed reactant in the third region amplifies the detection signal of the field effect transistor, and the entire detection process is fast and easy to operate, without any pumps or valves. In addition, according to the biosensor of the present application, the electrical signal does not require an optical conversion unit (fluorescence and other methods require it), and the detection equipment will be smaller and simpler, which is convenient for portable or bedside detection.

[0090] According to the embodiments of the present application, a field effect transistor in the form of a liquid gate may be used, and the liquid gate may be arranged in the region where the solution is located. Fig.11 As shown, the field effect transistor uses carbon nanotubes as its channel layer, and a dielectric layer can be arranged between the channel layer and the liquid gate. Fig.12 Another embodiment of a liquid gate field effect transistor is shown, and the liquid gate can be arranged on a substrate or a dielectric layer. In the present application, the liquid gate can be an Ag / AgCl electrode or an Au electrode, or a Pt electrode. In addition, a liquid gate can be arranged on the basis of a bottom gate field effect transistor, such as Fig.13 As shown, the liquid gate can be arranged in the area where the solution is located, a dielectric layer can be arranged under the carbon nanotube channel layer, and a gate can be arranged under the dielectric layer. In addition, a dielectric layer can be further arranged between the liquid gate and the carbon nanotube channel layer. In this case, the capture molecules can be assembled into the dielectric layer. Fig.14 As shown, the liquid gate can be set on the substrate or the dielectric layer.

[0091] In the description of this specification, the description with reference to the terms "one embodiment / method", "some embodiments / methods", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment / method or example are included in at least one embodiment / method or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment / method or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments / methods or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments / methods or examples described in this specification and the features of the different embodiments / methods or examples, unless they are contradictory.

[0092] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In the description of this application, the meaning of "plurality" is at least two, such as two, three, etc., unless otherwise clearly and specifically defined.

[0093] Those skilled in the art should understand that the above embodiments are only for the purpose of clearly illustrating the present application, and are not intended to limit the scope of the present application. For those skilled in the art, other changes or modifications may be made based on the above disclosure, and these changes or modifications are still within the scope of the present application.

Claims

1. A field effect transistor biosensor, characterized in that: include: a first region, the first region receiving and absorbing a sample solution; a second region, wherein the sample solution flows from the first region through the second region due to capillary force, a nanoparticle-detection molecule-enzyme conjugate is disposed in the second region, and when a target molecule exists in the sample solution, the detection molecule binds to the target molecule in the sample solution; a third region, through which the sample solution passing through the second region flows due to capillary force; as well as a field effect transistor, the field effect transistor being arranged in the third region and comprising a gate, a source, a drain and a channel layer, The third region is also provided with a capture molecule, which specifically reacts with the target molecule. Based on the enzyme-catalyzed reaction product of the enzyme in the conjugate, the gate voltage of the gate changes, causing the channel resistance, the current between the source and the drain, and the output current to change, and the target molecule is detected based on the change in the output current.

2. The biosensor according to claim 1, wherein The target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a detection antibody or a detection antigen, and the capture molecule is a capture antibody or a capture antigen.

3. The biosensor according to claim 1, wherein The target molecule is a DNA to be detected or a RNA to be detected, the detection molecule is a detection DNA or a detection RNA, and the capture molecule is a capture DNA or a capture RNA.

4. The biosensor according to claim 1, wherein The channel layer is made of carbon nanotubes.

5. The biosensor according to any one of claims 1 to 4, characterized in that The first area is a sample pad area, the second area is a conjugate pad area, and the third area is a detection line area.

6. The biosensor according to claim 5, characterized in that The detection line region is constituted by a porous membrane, wherein the capture molecules are immobilized to the porous membrane.

7. The biosensor according to claim 6, wherein The channel layer of the field effect transistor is arranged on a substrate.

8. The biosensor according to claim 1, wherein It also includes a fourth area, the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is set as a quality control line area to verify that the transfer of the sample solution is completed; Optionally, a fifth region is further included, and liquid of the sample solution flowing through the fourth region can be absorbed by the fifth region due to capillary force.

9. A method for preparing a field effect transistor biosensor, wherein the biosensor can be used to detect target molecules in a sample solution, characterized in that: include: A third region is provided, wherein a field effect transistor is provided in the third region, wherein the field effect transistor comprises a gate, a source, a drain and a channel layer, wherein a capture molecule that reacts specifically with the target molecule is fixed to the third region, and wherein the third region is configured so that the sample solution flows through the position of the field effect transistor due to capillary force; A second region is provided, wherein a nanoparticle-detection molecule-enzyme conjugate is provided in the second region, and the second region is configured so that the sample solution flows from the second region through the third region due to capillary force, and when the sample solution flows through the second region, the detection molecule binds to the target molecule so as to carry the conjugate to the position of the field effect transistor in the third region; as well as providing a first area, the first area being used to receive the sample solution and being configured to absorb the sample solution from the first area to the second area, Wherein, the field effect transistor and the enzyme in the conjugate are configured such that: based on the enzyme catalytic reaction product of the enzyme in the conjugate, the gate voltage of the gate changes, so that the channel resistance, the current between the source and the drain, and the output current change, and the target molecule is detected according to the change of the output current; Optionally, the target molecule is an antigen to be detected or an antibody to be detected, the detection molecule is a detection antibody or a detection antigen, and the capture molecule is a capture antibody or a capture antigen; Optionally, the target molecule is a DNA to be detected or a RNA to be detected, the detection molecule is a detection DNA or a detection RNA, and the capture molecule is a capture DNA or a capture RNA; Optionally, the channel layer is composed of carbon nanotubes; Optionally, the third region is composed of a porous membrane, wherein the capture molecules are fixed to the porous membrane; Optionally, a fourth area is further provided so that the liquid of the sample solution passing through the third area flows through the fourth area due to capillary force, and the fourth area is provided as a quality control line area to verify that the transfer of the sample solution is completed; Optionally, a fifth area is provided so that liquid of the sample solution flowing through the fourth area can be absorbed by the fifth area.

10. A biological detection method using the biosensor according to any one of claims 1 to 8, characterized in that: include: Dropping a sample solution into the first area; measuring an output current between a source and a drain of the field effect transistor; as well as The target molecule is detected according to the change of the output current.

Images