Bacillus velezensis BL-LM and application thereof in preparation of daqu for special-flavor liquor
By introducing Bacillus vesiculus BL-LM into the baijiu daqu (a type of starter culture), the problem of insufficient enhancement of flavor substances in the daqu of special-aroma baijiu was solved, achieving stability of daqu quality and significant improvement of flavor, thus enhancing the aroma and taste of baijiu.
Patent Information
- Application Number
- CN202411761100.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-12-03
AI Technical Summary
The existing microorganisms used to prepare special-aroma baijiu have a low effect on enhancing the characteristic aroma substances of baijiu, and the quality of the baijiu is unstable, making it difficult to achieve efficient flavor composition and quality control.
Using Bacillus velezensis BL-LM as a functional microorganism, added to the fermentation process of Daqu raw materials for special aroma-type Baijiu, significantly increases the content of pyrazines, aromatics and organic acids in Daqu, enhancing the soy sauce aroma and rich aroma of Daqu.
It significantly improves the content and quality of flavor substances in Daqu (a type of starter culture), enhances liquefaction and saccharification power, extends the top-fire temperature, and ensures the stability of Daqu and the flavor quality of Baijiu (Chinese liquor).
Smart Images

Figure CN119490938B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of liquor brewing technology, and more specifically, relates to Bacillus vesiculosus BL-LM and its application in the preparation of special aroma type liquor daqu. Background Technology
[0002] The production and fermentation of Daqu (a type of starter culture) for Chinese Baijiu (white liquor) play an extremely important role in the brewing process. They not only influence the flavor and quality of Baijiu but are also key steps in the brewing process. Microorganisms accumulate and evolve during Daqu production, and the Daqu microbial community is related to specific Daqu-making techniques and raw materials. Through specific Daqu-making processes and raw material ratios, suitable microbial communities for brewing can be selected. During Daqu production, the metabolic activities of microorganisms produce various enzymes, which catalyze chemical reactions in the raw materials, further promoting the formation of flavor compounds. This is irreplaceable in the production and fermentation of Daqu, affecting the flavor and quality of Baijiu and making it a crucial link in the brewing process. Therefore, the optimization and innovation of Daqu production and fermentation processes must be highly valued in Baijiu brewing.
[0003] The types and quantities of microorganisms directly affect the flavor composition of medium- and high-temperature koji, determining the quality of special-aroma baijiu. However, due to the open nature of the raw material koji-making process, the complexity and diversity of the multi-enzyme and multi-strain solid-state mixed fermentation system, and the difficulty in monitoring and controlling solid-state fermentation, the quality of special-aroma koji often becomes unstable.
[0004] The types and quantities of functional microorganisms contained in Daqu (a type of starter culture) are crucial to determining its quality, influencing the yield and premium product rate of Baijiu (Chinese liquor). Therefore, to improve the quality and stability of Daqu for special aroma types, it is essential to add pure-culture functional microorganisms during the Daqu production process, optimizing the types and quantities of functional microorganisms in Daqu prepared using existing traditional methods, and thus stabilizing and enhancing Daqu quality. However, the existing microorganisms used in preparing Daqu for special aroma types have a relatively low effect on enhancing the characteristic aroma substances in Baijiu, and the types of substances enhanced are limited. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides Bacillus vesiculosus BL-LM and its application in the preparation of special-aroma baijiu daqu (a type of starter culture).
[0006] The present invention specifically adopts the following technical solution:
[0007] In a first aspect, the present invention provides Bacillus velezensis BL-LM, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 30130 and deposit date of March 25, 2024.
[0008] The application isolates a bacillus velezensis from a special-flavor type Daqu sample, adds the bacillus velezensis to raw material fermentation of special-flavor type Daqu, significantly increases the content of 15 kinds of pyrazines and precursor compounds, 5 kinds of aromatic compounds and 5 kinds of organic acid compounds in the Daqu, enhances the content of Daqu flavor substances, and makes the Daqu cake have obvious Maotai flavor and rich Daqu aroma.
[0009] In a second aspect, the application provides application of the bacillus velezensis BL-LM in preparation of special-flavor type Daqu, and the bacillus velezensis BL-LM is used to increase the content of pyrazines and precursor compounds, aromatic compounds and volatile organic acid compounds in special-flavor type Daqu.
[0010] The pyrazines and precursor compounds include 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 2,3-dimethylpyrazine, 2,3,5-trimethyl-6-ethylpyrazine, 2-isobutyl-3,5,6-trimethylpyrazine, 2,3,5-trimethyl-6-propylpyrazine, 2,6-dimethylpyrazine, 2-ethyl-6-methylpyrazine, 5-isobutyl-2,3-dimethylpyrazine, 3,5-diethyl-2-methylpyrazine, 3-ethyl-2,5-dimethylpyrazine, 2-acetyl-3,4,6-trimethylpyrazine, 2,5-dimethyl-3-propylpyrazine, 2-methyl-5-propylpyrazine and diacetylmethyl.
[0011] The aromatic compounds include benzaldehyde, phenethyl alcohol, guaiacol methyl ether, guaiacol and 4-vinylguaiacol.
[0012] The organic acid compounds include acetic acid, L-malic acid, 2-methylbutyric acid, 3-methylbutyric acid and 2-methylhexanoic acid.
[0013] In a third aspect, the application provides a method for preparing special-flavor type Daqu by using the bacillus velezensis BL-LM, and the method comprises the following steps:
[0014] S1, activating the bacillus velezensis BL-LM to obtain a first-level seed solution;
[0015] S2, expanding culture of the first-level seed solution to obtain a second-level seed solution with a bacterial concentration of 1×10 8 -5×10 8 CFU / mL;
[0016] S3, diluting the second-level seed solution to a bacterial concentration of 1×10 6 -1×10 7 CFU / mL, uniformly mixing the diluted second-level seed solution with flour, wheat bran and spent grains, molding by compression, and fermenting to obtain the special-flavor type Daqu.
[0017] The mass ratio of the flour, wheat bran, spent grains, and the diluted secondary seed liquid is 40-50:40-60:5-10:45-60.
[0018] The present application has the following beneficial effects:
[0019] The quality of the Daqu base prepared from the Bacillus velezensis BL-LM is greatly improved, the top fire temperature of the Daqu during the koji-making period is high and the temperature maintaining time is long, the liquefaction and saccharification capacities are significantly enhanced, the koji base has a distinct sauced aroma, and the koji aroma is rich.
[0020] The Daqu for special-flavor liquor prepared from the Bacillus velezensis BL-LM has high content and rich types of pyrazine and aromatic flavor compounds, and the organic acids are also improved, which is very beneficial to the fermentation of the liquor Daqu and the improvement of the quality of the Daqu. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0022] Figure 2 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0023] Figure 3 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0024] Figure 4 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0025] Figure 5 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0026] Figure 6 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0027] Figure 7 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0028] Figure 8 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM.
[0029] Figure 9 Figure A is a plate colony morphology diagram, and figure B is a scanning electron microscope morphology diagram of the Bacillus velezensis BL-LM. DETAILED DESCRIPTION
[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.
[0031] Example 1: Isolation and identification of Bacillus belye BL-LM
[0032] Heat treatment of 1 Daqu sample
[0033] Weigh 2g of the pulverized special-fragrant Daqu sample into a 250mL Erlenmeyer flask in a clean bench, add 50mL of sterile physiological saline, seal the flask, and place the sample in a 37℃ constant temperature shaker for 30min to obtain the Daqu suspension. Place the suspension in a 55℃ water bath for 2 days.
[0034] Preliminary screening of 2 strains
[0035] Take 100 μL of the treated Daqu suspension and aspirate it into a centrifuge tube containing 900 μL of sterile water. Shake to mix thoroughly. This yields 10 μL of Daqu suspension. -1 The diluted Daqu suspension was then further diluted by transferring 100 μL of the bacterial suspension from the first centrifuge tube into a second centrifuge tube containing 900 μL of sterile water, resulting in a 10:1 ratio. -2 The dilution of the Daqu suspension is further reduced to 10. -8 Dilution. Take 10 -8 100 μL of the diluted Daqu suspension was inoculated onto LB agar plates and spread evenly, with three replicates. After the suspension was fully absorbed, the plates were incubated at 50°C. Single bacterial colonies were preserved on LB slant agar and the bacterial species were identified.
[0036] Morphological identification of 3 strains
[0037] The fastest-growing strain on LB agar, selected through the above steps, was then subjected to colony and microscopic morphological identification. Figure 1 The colonies of Bacillus belye BL-LM are transparent, nearly round, moist, and glossy with smooth edges. Under a scanning electron microscope, the single-cell morphology of this bacterium is short rod-shaped, solitary, with a cell length of 1-3 μm and a thickness of 0.5-1.0 μm.
[0038] Molecular biological identification of 4 strains
[0039] The single colony on the LB solid plate was inoculated into LB liquid medium, cultured overnight at 37°C in a shaking incubator, and the next day the bacterial cells were collected by centrifugation. The total genomic DNA of the bacterial cells was extracted using a gram-positive bacterial DNA extraction kit Solarbio Bacteria DNA Kit. Universal primers 27F and 1492R were used for amplification, and the extracted total DNA was used as a template for PCR amplification of 16s rDNA.
[0040] The 16s rDNA universal primers are as follows:
[0041] Primer name Primer sequence (5'-3') SEQ ID NO. 27F AGAGTTTGATCCTGGCTCAG 2 1492R TACGGYTACCTTGTTAYGACTT 3
[0042] The amplified PCR product was subjected to agarose gel electrophoresis and the PCR product was recovered. The PCR product was sent to Beijing Qikang Biotechnology Co., Ltd. for sequencing. The sequencing identification result: the size of the PCR product is 1517 bp, and the 16s rDNA sequence of the strain is shown as SEQ ID NO. 1. The sequence was compared with the rRNA / ITS databases in NCBI online, and the most similar 16s rDNA sequence species information of the identified strain was obtained: Bacillus velezensis FZB42 strain, therefore the strain was identified as Bacillus velezensis, named BL-LM.
[0043]
[0044] Example 2: Logarithmic growth phase determination of Bacillus velezensis BL-LM
[0045] Bacillus velezensis BL-LM was inoculated into a triangular flask containing an appropriate amount of LB medium and cultured at 37°C with shaking at 180 r / min. Samples were taken at regular intervals, and the absorbance (OD 600 ) of the samples at 600 nm was determined using a spectrophotometer. Three replicates were set up for the experiment. The growth curve of the BL-LM strain was plotted with time as the horizontal coordinate and the bacterial concentration OD600 value as the vertical coordinate. As shown in Figure 2 , the logarithmic growth phase of Bacillus velezensis BL-LM was 1-10 h, and it entered the stationary phase after 10 h.
[0046] Example 3: Analysis of physicochemical indicators in Daqu for special-flavor liquor prepared by Bacillus velezensis BL-LM
[0047] (1) Preparation method of Daqu
[0048] The production of Bacillus velezensis BL-LM enhanced Daqu is shown in Figure 3 . The strain was streaked on a plate and incubated overnight at 37°C. The next day, a single colony was picked and cultured in a 250 mL triangular flask at 37°C with shaking at 180 r / min for 5-6 h to reach the mid-logarithmic growth phase, which was the first-stage seed liquid. The bacterial concentration was approximately 10 8 CFU / mL after 16 h of culture in a 5 L fermenter at an inoculation amount of 1%, which was the second-stage seed liquid. The solid culture medium was prepared according to the formula for special-flavor Daqu production. The bacterial cells of the second-stage seed liquid were diluted with tap water to prepare a bacterial solution with a concentration of 10 6 CFU / mL. The production materials were mixed and stirred according to the mass ratio of flour: wheat bran: distiller's grains: bacterial solution = 45:50:7.25:53 and the amount of bacterial solution per piece of Daqu (1060 mL). The Daqu material was then molded into a rectangular solid with dimensions of 210 mm x 80 mm x 120 mm. The prepared enhanced Daqu was placed in a Daqu room for fermentation. The ordinary non-enhanced control (CK) Daqu was prepared by replacing the seed liquid with the same volume of water, and the other production processes were the same.
[0049] The solid fermentation conditions of Daqu were as follows: The traditional method of solid fermentation in a Daqu room was used, and the Daqu was placed on the ground with single or double substrates covered with straw. After 2 times of turning, the Daqu substrate reached the peak temperature, and the substrate was packed after 10-12 d in the room. After about 25-30 d of solid fermentation culture, the Daqu substrate temperature decreased to room temperature, and the solid fermentation in the Daqu room was completed. The Daqu was taken out of the room.
[0050] Bacillus velezensis BL-LM strong Daqu and ordinary Daqu were randomly sampled at 0d, 5d, 10d, 15d, 20d, 30d, respectively. The Daqu samples were crushed, mixed, sieved, weighed 200g, and the physicochemical indexes and enzyme activity of the Daqu were determined.
[0051] (2) Test
[0052] 1) Temperature determination of Daqu
[0053] Insert the thermometer into the Daqu about 2cm deep, randomly measure the temperature of 3 Daqu, measure once a day. Calculate the average of the measured temperature as the Daqu temperature.
[0054] 2) Determination of moisture content of Daqu
[0055] The direct drying method was used to detect the moisture content of Daqu. A clean weighing bottle was placed in a 105℃ drying oven until it reached a constant weight. 10g of sample was placed in the weighing bottle and dried in the drying oven until it reached a constant weight. The moisture content was calculated.
[0056] 3) Determination of acidity of Daqu
[0057] 10g of sample was added to 100mL of neutral water, stirred and mixed, and extracted for 30min. The filtrate was obtained by filtering with filter paper and collected for use. 10mL of filtrate was taken and titrated with 0.1M NaOH standard solution. The volume of NaOH solution consumed was recorded as V1 (pH=7.0 as the titration endpoint). Distilled water was used as a control, and the steps of the experimental group were repeated. The volume of NaOH standard solution consumed was V0.
[0058] The calculation formula is as follows:
[0059] Acidity (mmol / 10g) = c0×(V1-V0)×10×m×(1-W).
[0060] Where: c0 is the concentration of sodium hydroxide standard solution (0.1mol / L); V1 is the volume of NaOH solution consumed by the experimental group (mL); V0 is the volume of NaOH solution consumed by the blank group (mL); 10 is the ratio of sample dilution volume to titration volume; m is the mass of dry Daqu; W is the moisture content of the sample (%).
[0061] 4) Determination of liquefaction power of Daqu
[0062] The liquefaction amylase activity was determined by spectrophotometry. One enzyme unit (U / g) was defined as the amount of enzyme required to liquefy 1g of soluble starch at 60℃, pH 6.0 for 1h.
[0063] Sample processing, 200 mL of preheated to 40℃ sodium phosphate dibasic-citric acid buffer was added to the beaker with 10 g of Daqu powder, water bath leaching for 1 h (40℃) and filtered with filter paper to take the filtrate for use.
[0064] Put 20 mL of starch solution (20 g / L) and 5 mL of sodium phosphate dibasic-citric acid buffer (pH 6.0) in a 50 mL cuvette, 60℃ water bath for 10 min. Add 1 mL of filtrate to the cuvette, shake well and count the reaction time for 5 min. Take 1 mL of reaction solution and add it to a test tube containing 5 mL of dilute iodine solution and shake well. With dilute iodine solution as blank, measure the absorbance at 660 nm on the spectrophotometer.
[0065] The calculation formula is as follows:
[0066]
[0067] In the formula, c is the enzyme solution concentration, unit U / mL; 200 is the total volume of enzyme leaching liquid; m is the mass of dry koji; 5 is the reaction time; 60 is the conversion coefficient in hours.
[0068] 5) Determination of Daqu saccharifying power
[0069] Refer to the determination method of "GB8276-2006 Food Additive Saccharifying Enzyme Preparation". Defined as the milligrams of glucose generated by 1 g of Daqu under the condition of 40℃, pH 4.6 for 1 h.
[0070] Sample processing, take 5 g of Daqu powder and place it in a beaker, add 90 mL of water and 10 mL of acetic acid sodium acetate buffer (pH 4.6) and water bath leaching for 1 h at 30℃, then filter with filter paper to take the filtrate for use.
[0071] Put 25 mL of starch solution (20 g / L) and 5 mL of acetic acid sodium acetate buffer in a test tube, water bath for 5 min (40℃), then add 2 mL of filtrate to the 40℃ water bath for 30 min, after the reaction is completed, add 0.2 mL of NaOH (200 g / L) and shake well to stop the reaction. Each group of Daqu samples has 3 parallel samples, and the blank control is added with NaOH and then supplemented with filtrate.
[0072] Take 5 mL of the above saccharifying liquid and place it in an iodine flask, add 10 mL of iodine solution (0.1 mol / L) and then add 15 mL of NaOH solution (0.1 mol / L) and react in the dark for 15 min. After the reaction is completed, add 2 mL of sulfuric acid solution (2 mol / L), immediately titrate with sodium thiosulfate standard solution (0.05 mol / L), and the blue color disappears as the end point.
[0073] The calculation formula is as follows:
[0074]
[0075] In the formula, c is the concentration of Na2S2O3 standard solution; Vo, V are the volumes of Na2S2O3 standard solution consumed by the blank and sample, respectively; 90.05 is the mass of glucose in grams corresponding to 1 mL of Na2S2O3 standard solution; 32.2 is the total volume of the reaction solution; 5 is the volume of saccharified liquid; 1 / 2 is the volume of enzyme solution, 2 mL, counted as 1.00 mL; n is the sample dilution factor; 2 is the reaction time, 0.5 h; m is the dry koji mass; and 100 is the total volume of the sample extract.
[0076] 2. Test results
[0077] (1) Koji temperature detection results
[0078] The change in koji temperature during the koji-making fermentation process is a key physicochemical indicator reflecting the solid fermentation process. Koji temperature affects the types and quantities of microbial flora, biochemical reactions, and biological enzyme activity of the koji, thereby affecting the koji fermentation performance and the generation of characteristic flavor substances. The change in koji temperature during the fermentation process is shown in Figure 4 . Before the BL-LM strain is used to strengthen the koji, the temperature rises slowly in the early stage, the temperature in the middle stage is higher than that of the control koji, and the temperature remains above 45°C for a long time after the koji is stacked. The koji temperature drops more slowly in the late stage, 15-17 d after fermentation, and has the characteristics of "slow in the early stage" and "slow in the late stage". The koji temperature of the BL-LM strain-strengthened koji drops to the same temperature as the control koji in the late stage. The high temperature maintained for a long time in the BL-LM strain-strengthened koji can increase the biochemical reaction rate, which is conducive to the formation of characteristic flavor substances, such as pyrazines and their precursor compound 3-hydroxy-2-butanone (acetoin), which have higher contents in high-temperature koji.
[0079] (2) Koji moisture content determination results
[0080] The change in koji moisture content during the fermentation process is shown in Figure 5 . The change in the moisture content of the BL-LM strain-strengthened koji is the same as that of the control koji, and the moisture content gradually decreases with the fermentation time, but the moisture content of the BL-LM strain-strengthened koji is significantly higher than that of the control koji and decreases more slowly in the late stage of the fermentation process, which is closely related to the higher koji temperature maintained in the late stage of the solid fermentation. The moisture content of the BL-LM strain-strengthened koji is about 25% in the terminal stage of fermentation, which is higher than that of the control koji.
[0081] (3) Koji acidity determination results
[0082] The change in koji acidity during the fermentation process is shown in Figure 6As shown. The acidity of Daqu (a type of starter culture) mainly originates from the organic acid metabolism and degradation of fats, starches, and proteins by acid-producing microorganisms; it is the result of the combined action of Daqu microorganisms. Suitable acidity can inhibit the growth of some harmful bacteria in Daqu, while also providing nutrients for beneficial microorganisms and enabling them to participate in esterification reactions to produce aroma substances. From... Figure 6 It can be seen that the acidity change patterns of *Bacillus belyssiensis* BL-LM enhanced Daqu and the control Daqu are roughly the same: gradually decreasing from 10 to 15 days, and slightly increasing from 15 to 20 days, with the highest increase observed in *Bacillus belyssiensis* BL-LM enhanced Daqu, reaching a peak of 1.7 mmol / 10g. This may be because the enhancement bacteria initially inhibited the growth of other acid-producing bacteria, resulting in minimal acidity changes, while the subsequent proliferation of acid-producing bacteria led to an increase in acidity. The volatile matter detection results of *Bacillus belyssiensis* BL-LM enhanced Daqu revealed a significant amount of volatile acids such as acetic acid, 2-methylbutyric acid, and 3-methylbutyric acid, indicating that *Bacillus belyssiensis* BL-LM can increase acidity during Daqu fermentation.
[0083] (4) Results of Daqu Liquefaction Capacity Measurement
[0084] Changes in liquefaction force during the fermentation of Daqu (a type of starter culture) are as follows: Figure 7 As shown in the figure. The degradation of raw materials during the fermentation of Daqu (a type of starter culture) is due to the action of amylase and saccharifying enzymes. These two enzymes are relatively important in Daqu, and their activity directly affects the degradation rate of the raw materials. Liquefaction power, i.e., α-amylase, plays a role in degrading the starch in the raw materials during fermentation, providing nutrients for various microorganisms and playing a key role in the production of aroma substances. The changes in amylase activity during the fermentation of Bacillus belyssioides BL-LM enhanced Daqu and control Daqu are shown in the figure. Figure 7 As shown, the amylase activity of the enhanced Daqu (a type of starter culture) significantly increased from 5 to 10 days, while that of the ordinary Daqu decreased. The BL-LM strain's enhanced Daqu reached its highest point at 66.93 U / g. From 10 to 15 days, the amylase activity of the BL-LM strain's enhanced Daqu showed a decreasing trend, while that of the control Daqu showed an increasing trend. From 15 to 20 days, the amylase activity of both the BL-LM strain's enhanced Daqu and the control Daqu showed the same trend, initially increasing and then decreasing. Throughout the entire Daqu fermentation cycle, the amylase activity of the Bacillus belyssiensis BL-LM enhanced Daqu was significantly higher than that of the control Daqu. At the end of the 30-day fermentation period, the liquefaction capacity of the Bacillus belyssiensis BL-LM enhanced Daqu was 40%-50% higher than that of the control Daqu, which is related to the strong amylase secretion capacity of Bacillus belyssiensis BL-LM. This also indicates that the sugar degradation rate in the Bacillus belyssiensis BL-LM enhanced Daqu is faster, which is conducive to the growth of various microorganisms.
[0085] (5) Results of Daqu saccharification power determination
[0086] Changes in saccharification power during the fermentation of Daqu (a type of starter culture) are as follows:Figure 8 Glucoamylase, also known as glucoamylase or γ-amylase, is an exocellulase with exo-enzyme activity. The main role of glucoamylase is to hydrolyze α-1, 4 glycosidic bonds from the non-reducing end of starch, dextrin, glycogen and other carbon chains, cut off glucose units one by one, and make the hydrolyzed glucose change in configuration to form β-D-glucose. Figure 8 As shown in the table, the glucoamylase activity of the Bacillus velezensis BL-LM enhanced Daqu is higher than that of the control Daqu during the entire fermentation period. At the end of fermentation, the saccharifying power of the Bacillus velezensis BL-LM enhanced Daqu and the control Daqu is 3719.25 U / g and 2761.80 U / g respectively, which is conducive to the later fermentation and improves the liquor yield in the brewing stage.
[0087] Example 4: Detection and analysis of flavor substances in Luzhou-flavor liquor Daqu prepared by Bacillus velezensis BL-LM
[0088] The Bacillus velezensis BL-LM and the Daqu prepared therefrom, the preparation method of the Daqu and the experimental grouping method are as described in Example 3. The headspace solid-phase microextraction technology is combined with gas chromatography-mass spectrometry to analyze the types and contents of volatile flavor substances in the Daqu starter.
[0089] Pretreatment of sample: 0.5 g of Daqu sample was accurately weighed, ground thoroughly and then added into a headspace sampling bottle, 5 mL of deionized water was added to soak for 10 min, and then NaCl was added until saturation. The sample was treated by ultrasonic wave for 30 min. The headspace solid-phase microextraction used a 50 / 30DVB / CAR / PDMS extraction head to insert into the headspace bottle at a position 2-3 mm above the liquid surface for headspace adsorption, the extraction temperature was 55℃, and the headspace adsorption time was 30 min. The extraction head was quickly removed and immediately inserted into the gas chromatograph inlet (temperature 250℃) for pyrolysis and adsorption for 4 min. The volatile components were detected by an Agilent gas chromatograph (GC 6890N) / mass spectrometer (MS 5975) combination instrument, the chromatographic column was DB-Wax (30 m x 0.25 mm x 0.25 mm), the inlet and detector temperatures were 250℃, the carrier gas was He, and the flow rate was 2 mL / min. The gas detection program was as follows: the initial temperature was 50℃, maintained for 2 min, then increased to 85℃ at a rate of 2℃ / min, maintained for 0.1 min, then increased to 230℃ at a rate of 5℃ / min, and maintained for 2 min. The volatile components were detected in full scan mode, and the mass spectrometry conditions were as follows: electron impact energy 70 eV, ion source temperature 230℃. The volatile flavor substances in the enhanced Daqu and the control Daqu prepared by solid-state fermentation for 30 days were identified and analyzed by headspace solid-phase microextraction technology combined with gas chromatography-mass spectrometry, and the results are shown in Table 1 and Figure 9 As shown in the table, alcohols, aldehydes, ketones, organic acids and other
[0090] Table 1 Flavoring substances of Daqu
[0091]
[0092]
[0093] Note: "+" represents low content but can be detected, "-" represents not detected.
[0094] Table 1 shows that 62 kinds of flavoring substances are identified, and the main flavoring substances are: 15 kinds of pyrazines, 8 kinds of aromatic compounds, 12 kinds of esters, 10 kinds of alcohols, 6 kinds of aldehydes, 5 kinds of ketones and 5 kinds of acids. Among them, 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 3-methyl-1-butanol, guaiacol, phenethyl alcohol and ethyl hexanoate have relatively high content, and these Daqu flavoring components play an important role in the formation of the flavor of liquor in the later period.
[0095] The pyrazine compounds in Chinese liquor are derived from microorganisms, mainly the metabolism of Bacillus, and the precursor is methylglyoxal and ammonia. From the data in Table 1, it can be seen that the content of pyrazine flavor compounds and the content of precursor methylglyoxal in the Bacillus BL-LM fortified Daqu are significantly higher than those in the control Daqu, and the types of pyrazine compounds detected in the fortified Daqu are also more abundant. Therefore, it is predicted that Bacillus BL-LM has good potential for producing pyrazine compounds.
[0096] Aromatic compounds are another important class of compounds in liquor and Daqu, and although the content of aromatic compounds is small, the threshold is low, the flavor intensity is high, and the retention time is long. The main aromatic compounds include phenethyl alcohol, benzaldehyde and 3-phenylpropionic acid ethyl ester, etc. In addition, high-boiling aromatic compounds such as guaiacol, 4-ethyl guaiacol and 4-vinyl guaiacol are related to the Maotai flavor. From the data in Table 1 and Figure 9 , it can be seen that the content of aromatic flavor compounds in the Bacillus BL-LM fortified Daqu is significantly higher than that in the control Daqu, and the types are also more abundant. Therefore, it can be predicted that Bacillus BL-LM has good potential for producing aromatic flavor compounds.
[0097] From the comparison of the overall volatile flavor compound composition spectrum in Table 1 and Figure 9 , it can be seen that the types of volatile flavor compounds detected in the Bacillus BL-LM strain fortified Daqu are rich and the relative content is high.
[0098] It should be noted that when the present application claims involving numerical ranges, it should be understood that each numerical range has two endpoints and any number between the two endpoints can be selected. In order to prevent repetition, the present application describes the preferred embodiments.
[0099] While the preferred embodiments of the application have been described, additional variations and modifications can be made to these embodiments by those skilled in the art once they have the benefit of the present disclosure without departing from the spirit and scope of the application. Accordingly, it is intended that the appended claims include all such modifications and variations as fall within the scope of the present application.
[0100] It is apparent that those skilled in the art can make various changes and modifications to the application without departing from the spirit and scope of the application. It is therefore intended that the present application cover all such changes and modifications that are within its scope.
Claims
1. A type of Bacillus belesii ( Bacillus velezensis The application of BL-LM in the preparation of special aroma type baijiu daqu is characterized by, The *Bacillus belales* BL-LM is used to increase the content of pyrazines and their precursor compounds, aromatic compounds, and volatile organic acids in the Daqu (fermentation starter) of special-aroma baijiu. The pyrazines and their precursor compounds are 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 2,3-dimethylpyrazine, 2,3,5-trimethyl-6-ethylpyrazine, 2-isobutyl-3,5,6-trimethylpyrazine, and acetoin. The aromatic compounds are phenethyl alcohol, guaiacol methyl ether, guaiacol, and 4-vinylguaiacol. The organic acids are acetic acid, 2-methylbutyric acid, and 3-methylbutyric acid. The *Bacillus belales* BL-LM is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 30130 and deposit date of March 25, 2024.
2. A method for preparing a special-aroma type of baijiu (Chinese liquor) starter, characterized in that, Includes the following steps: S1. The Bacillus BL-LM of claim 1 is activated to obtain a primary seed solution; S2. Expand the primary seed culture to a cell concentration of 1×10⁻⁶. 8 -5×10 8 CFU / mL was used to obtain a secondary seed culture; S3. Dilute the secondary seed culture to a cell concentration of 1×10⁻⁶. 6 -1×10 7 The diluted secondary seed liquid (CFU / mL) is mixed evenly with flour, wheat bran, and lees, molded, and fermented to obtain the special aroma type of baijiu daqu.
3. The method for preparing a special aroma type of Baijiu daqu according to claim 2, characterized in that, The mass ratio of flour, wheat bran, lees, and diluted secondary seed liquid is 40-50:40-60:5-10:45-60.
Citation Information
Patent Citations
Medium-temperature alpha-amylase as well as gene and application thereof
CN118086256A
Bacillus velezensis and application thereof
CN118931790A