In-vitro induction of blastocyst-like embryo and application thereof

Abstract

The invention relates to blastocyst-like embryos obtained through in-vitro induction and also relates to application of the obtained blastocyst-like embryos.

Description

Technical Field

[0001] The invention belongs to the field of cell differentiation and regenerative medicine, and specifically relates to the construction of blastocyst-like cells. Background Art

[0002] Early embryonic development is an important research field in life sciences. Analyzing the laws of early human embryonic development and the regulatory principles of cell fate determination is of great significance for the development of assisted reproductive technology and the prevention of development-related diseases such as miscarriage and birth defects. However, the small number of embryos available for research and their difficulty in obtaining, as well as the ethical restrictions on human embryo research, have greatly hindered basic research on early embryonic development. Recently, blastocyst-like reconstruction technology has provided a new research method for studying early embryos.

[0003] Blastocysts (thylakoids, blastoid) refer to embryo-like structures that are obtained by self-assembly using cell materials, especially stem cells, and have similar structural, molecular and developmental characteristics to normal embryos. Thylakoids can simulate the formation and development process of real human embryos to a certain extent, providing a good in vitro model for the study of early human embryonic development. The existing human thylakoid construction has a complex construction system, which requires gradual induction through a multi-step method; and the problem of low efficiency. In addition, the proportion of hypoblast (HYP) cells in the constructed human thylakoids is low, which to a certain extent limits the post-implantation development of human thylakoids. Therefore, exploring new methods for the construction of human thylakoids and their synthesis mechanisms is of great significance for the application of human thylakoid technology and basic research on early human embryonic development. Summary of the invention

[0004] The present invention is achieved by The present invention induces hypoblast (HYP)-like cells by overexpressing GATA6 in human naive pluripotent stem cells. After mixing human naive pluripotent stem cells overexpressing GATA6 with wild-type human naive pluripotent stem cells, doxycycline is added for induction, and a human blastocyst-like cell containing three cell types, EPI, TE and HYP, is synthesized using a spontaneous assembly method. Compared with the previous spontaneous blastocyst-like cell, the synthetic blastocyst-like cell has higher efficiency, a structure more similar to a real embryo, and better post-implantation development ability.

[0005] In a first aspect, the present invention provides a method for inducing the formation of hypoblast (HYP)-like cells, the method comprising the following steps:

[0006] (1) obtaining pluripotent stem cells overexpressing the GATA6 gene; and

[0007] (2) Inducing the pluripotent stem cells that overexpress the GATA6 gene to form HYP-like cells.

[0008] In some embodiments, the pluripotent stem cells are human-derived pluripotent stem cells or non-human mammal-derived pluripotent stem cells.

[0009] In some embodiments, the pluripotent stem cells are naive pluripotent stem cells. In some embodiments, the pluripotent stem cells are human naive pluripotent stem cells.

[0010] In some embodiments, the method further comprises: introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells to prepare GATA6-overexpressing pluripotent stem cells. rTTA3 and exogenous doxycycline (Dox) jointly activate TetO, and the purpose of inducing GATA6 gene expression can be achieved by controlling Dox.

[0011] In some embodiments, the wild-type pluripotent stem cell is a wild-type naive pluripotent stem cell.

[0012] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing stem cells.

[0013] In some embodiments, the stem cells are selected from primed stem cells.

[0014] In some embodiments, the primed stem cells are selected from primed stem cells of human or non-human mammalian origin.

[0015] In some embodiments, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells.

[0016] In some embodiments, the human embryonic stem cells are commercial human embryonic stem cell lines. In some embodiments, the human embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0017] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by inducing primed human embryonic stem cells.

[0018] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor.

[0019] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different.

[0020] In some embodiments, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3βinhibitor 1. One or more of KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin.

[0021] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

[0022] In some embodiments, the concentration of the first GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM. In some embodiments, the concentration of the second GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM.

[0023] In some embodiments, DMEM / F-12 medium or DMEM / F-12 modified medium or Neurobasal medium is used as the basal medium for inducing stem cells to form wild-type naive pluripotent stem cells.

[0024] In some embodiments, the basal medium is supplemented with N2, B27 and other auxiliary components and induction factors; preferably, the other auxiliary components are selected from at least one of KnockOut SR, GlutaMAX non-essential amino acids, trace elements, 2-mercaptoethanol and bovine serum albumin; preferably, the induction factor is selected from at least one of MEK / ERK inhibitors, BRAF inhibitors, SRC inhibitors, ROCK inhibitors, leukemia inhibitory factor, activin A and fibroblast growth factor. In some embodiments, the trace elements include antibiotics. In some embodiments, the antibiotics are double-antibodies. In some embodiments, the double-antibodies are penicillin-streptomycin double-antibodies. In some embodiments, the MEK / ERK inhibitors include PD0325901. In some embodiments, the BRAF inhibitors include SB5900885. In some embodiments, the SRC inhibitors include WH-4-023. In some embodiments, the ROCK inhibitors include Y-27632. In some embodiments, the fibroblast growth factor includes FGF2.

[0025] In some embodiments, the culture medium can be a culture medium that stably maintains the original state of stem cells, such as 5iLA culture medium or PXGL culture medium. In some embodiments, 5iLA culture medium includes five chemical small molecule inhibitors (inhibitors of BRAF, MEK, SRC, GSK3β and ROCK) and leukemia inhibitory factors LIF and Activin A. In some embodiments, PXGL culture medium includes MEK inhibitor PD0325901, WNT signaling pathway antagonist XAV939, protein kinase C inhibitor and LIF.

[0026] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by inducing and culturing primed human embryonic stem cells in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 and in 5iLAF medium containing the GSK3 inhibitor IM-12, respectively.

[0027] In some embodiments, the stem cells are cultured in a medium containing a first GSK3 inhibitor for 9-13 days before being passaged; on day 3-4 of passage 3 (P3) and subsequent passages, the medium is replaced with a medium containing a second GSK3 inhibitor and cultured for 3-5 days to obtain wild-type naive pluripotent stem cells.

[0028] In some embodiments, the induced stem cells are dissociated before passaging. Preferably, the dissociation comprises dissociating the stem cells with an enzyme or a non-enzymatic digestion solution; preferably, the enzyme is selected from Accutase, Dispase, collagenase or trypsin; preferably, the non-enzymatic digestion solution is selected from EDTA, NO-ZYME reagent, Non-enzymatic digestion solution.

[0029] In some embodiments, the primed embryonic stem cells are cultured in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 for 9-13 days before being passaged; on day 3-4 of the third passage (P3) and subsequent passages, the 5iLAF-C medium is replaced with 5iLAF medium containing the GSK3 inhibitor IM-12 and cultured for 3-5 days before establishing a cell line to obtain wild-type primed pluripotent stem cells.

[0030] In some embodiments, the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

[0031] In some embodiments, the wild-type pluripotent stem cells express the pluripotency marker molecule NANOG.

[0032] In some embodiments, in step (2), doxycycline is used for the induction. In some embodiments, the concentration of doxycycline is 0.5-2 μg / mL, preferably 1 μg / mL.

[0033] In some embodiments, the induction time is 10-40 hours, preferably 20-28 hours.

[0034] In a second aspect, the present invention provides HYP-like cells obtained by the method of the first aspect.

[0035] In some embodiments, the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

[0036] In a third aspect, the present invention provides a method for inducing the formation of blastocyst-like embryos, the method comprising the following steps:

[0037] (1) obtaining GATA6-overexpressing pluripotent stem cells; and

[0038] (2) Inducing cells containing the GATA6-overexpressing pluripotent stem cells to form blastocysts.

[0039] In some embodiments, the GATA6-overexpressing pluripotent stem cells are mixed with wild-type pluripotent stem cells and then induced to form blastocysts.

[0040] In some embodiments, the ratio of the number of GATA6-overexpressing pluripotent stem cells to the number of wild-type pluripotent stem cells is 1:(5-20), preferably 1:(8-12), and further preferably 1:10.

[0041] In some embodiments, the culture medium used in the mixed culture is a pluripotent stem cell maintenance medium, preferably a 5iLA medium or a PXGL medium, and more preferably a 5iLAF medium.

[0042] In some embodiments, the mixed culture time is 48-72 hours, preferably 45-50 hours, for example 48 hours.

[0043] In some embodiments, the mixed culture is a 3D cell culture.

[0044] In some embodiments, the pluripotent stem cells are human-derived pluripotent stem cells or non-human mammal-derived pluripotent stem cells.

[0045] In some embodiments, the pluripotent stem cells are naive pluripotent stem cells.

[0046] In some embodiments, GATA6-overexpressing pluripotent stem cells are prepared by introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells. rTTA3 and exogenous doxycycline (Dox) jointly activate TetO, and the purpose of inducing GATA6 gene expression can be achieved by controlling Dox.

[0047] In some embodiments, the wild-type pluripotent stem cell is a wild-type naive pluripotent stem cell.

[0048] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing stem cells.

[0049] In some embodiments, the stem cells are selected from primed stem cells.

[0050] In some embodiments, the primed stem cells are selected from primed stem cells of human or non-human mammalian origin.

[0051] In some embodiments, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells.

[0052] In some embodiments, the human embryonic stem cells are commercial human embryonic stem cell lines. In some embodiments, the human embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0053] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by inducing primed human embryonic stem cells.

[0054] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor.

[0055] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different.

[0056] In some embodiments, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3βinhibitor 1. One or more of KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin.

[0057] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

[0058] In some embodiments, the concentration of the first GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM. In some embodiments, the concentration of the second GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM.

[0059] In some embodiments, DMEM / F-12 medium or DMEM / F-12 modified medium or Neurobasal medium is used as the basal medium for inducing stem cells to form wild-type naive pluripotent stem cells.

[0060] In some embodiments, the basal medium is supplemented with N2, B27 and other auxiliary components and induction factors; preferably, the other auxiliary components are selected from at least one of KnockOut SR, GlutaMAX non-essential amino acids, trace elements, 2-mercaptoethanol and bovine serum albumin; preferably, the induction factor is selected from at least one of MEK / ERK inhibitors, BRAF inhibitors, SRC inhibitors, ROCK inhibitors, leukemia inhibitory factor, activin A and fibroblast growth factor. In some embodiments, the trace elements include antibiotics. In some embodiments, the antibiotics are double-antibodies. In some embodiments, the double-antibodies are penicillin-streptomycin double-antibodies. In some embodiments, the MEK / ERK inhibitors include PD0325901. In some embodiments, the BRAF inhibitors include SB5900885. In some embodiments, the SRC inhibitors include WH-4-023. In some embodiments, the ROCK inhibitors include Y-27632. In some embodiments, the fibroblast growth factor includes FGF2.

[0061] In some embodiments, the culture medium can be a culture medium that stably maintains the original state of stem cells, such as 5iLA culture medium or PXGL culture medium. In some embodiments, 5iLA culture medium includes five chemical small molecule inhibitors (inhibitors of BRAF, MEK, SRC, GSK3β and ROCK) and leukemia inhibitory factors LIF and Activin A. In some embodiments, PXGL culture medium includes MEK inhibitor PD0325901, WNT signaling pathway antagonist XAV939, protein kinase C inhibitor and LIF.

[0062] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by inducing and culturing primed human embryonic stem cells in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 and in 5iLAF medium containing the GSK3 inhibitor IM-12, respectively.

[0063] In some embodiments, the stem cells are cultured in a medium containing a first GSK3 inhibitor for 9-13 days before being passaged; on day 3-4 of passage 3 (P3) and subsequent passages, the medium is replaced with a medium containing a second GSK3 inhibitor and cultured for 3-5 days to obtain wild-type naive pluripotent stem cells.

[0064] In some embodiments, the induced stem cells are dissociated before passaging. Preferably, the dissociation comprises dissociating the stem cells with an enzyme or a non-enzymatic digestion solution; preferably, the enzyme is selected from Accutase, Dispase, collagenase or trypsin; preferably, the non-enzymatic digestion solution is selected from EDTA, NO-ZYME reagent, Non-enzymatic digestion solution.

[0065] In some embodiments, the primed embryonic stem cells are cultured in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 for 9-13 days before being passaged; on day 3-4 of the third passage (P3) and subsequent passages, the 5iLAF-C medium is replaced with 5iLAF medium containing the GSK3 inhibitor IM-12 and cultured for 3-5 days before establishing a cell line to obtain wild-type primed pluripotent stem cells.

[0066] In some embodiments, the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

[0067] In some embodiments, the wild-type pluripotent stem cells express the pluripotency marker molecule NANOG.

[0068] In some embodiments, doxycycline is used for the induction. In some embodiments, the concentration of doxycycline is 0.5-2 μg / mL, preferably 1 μg / mL.

[0069] In some embodiments, the induction time is 10-40 hours, preferably 20-28 hours.

[0070] In some embodiments, the method further comprises performing assembly culture after induction. Preferably, the assembly culture uses 5iLAF medium. Preferably, the assembly culture time is 100-140 hours. Preferably, thylakoids are obtained about 120 hours after inoculation. The obtained thylakoids have a large number of HYP cells.

[0071] The present invention synthesizes pre-implantation thylakoids, but uses iGATA6 induced pluripotent stem cells and wild-type pluripotent stem cells for assembly and has a large number of HYP cells, which greatly promotes the post-implantation embryo development ability of the model. In addition, the present invention significantly improves the assembly efficiency of blastocysts, even as high as 87.8%, while the assembly efficiency of other synthetic embryo models in the prior art is usually less than 25%.

[0072] In a fourth aspect, the present invention provides a blastocyst obtained by the method of the third aspect.

[0073] In some embodiments, the blastocyst is a preimplantation blastocyst.

[0074] In some embodiments, the blastocyst is a human blastocyst.

[0075] In some embodiments, the blastocysts contain three types of cell subpopulations: EPI-like cells, HYP-like cells, and TE-like cells.

[0076] In some embodiments, the EPI-like cells express epidermal marker molecules NANOG, OCT4 (POU5F1), and SOX2.

[0077] In some embodiments, the HYP-like cells express hypodermal marker molecules GATA6, GATA4, SOX17 and PDGFRA.

[0078] In some embodiments, the TE-like cells express trophectoderm marker molecules GATA3, GATA2, and NR2F2.

[0079] In some embodiments, HYP-like cells account for about 6-8% of the total cells in the blastocyst, which is close to the proportion of iGATA6 hnESCs in the starting cells.

[0080] In some embodiments, the HYP-like cell subpopulation contains 68-70% GATA6-overexpressing pluripotent stem cells and 28-32% wild-type pluripotent stem cells, indicating that after iGATA6-overexpressing pluripotent stem cells are induced into HYP-like cells, it will also affect the transformation of some wild-type pluripotent stem cells to HYP cell fate.

[0081] In some embodiments, the blastocyst is a preimplantation blastocyst.

[0082] In a fifth aspect, the present invention provides the use of the HYP-like cells obtained by the method described in the first aspect, the HYP-like cells of the second aspect, the blastocyst-like cells obtained by the method described in the third aspect, or the blastocyst-like cells of the fourth aspect in preparing cells or organoids for treating diseases related to early embryonic development, or in preparing cell models or organoid models for studying diseases related to early embryonic development, or in studying pre-implantation and post-implantation early embryogenesis, or in screening key genes for early embryonic development defects.

[0083] In a sixth aspect, the present invention provides a pharmaceutical preparation, comprising the HYP-like cells obtained by the method of the first aspect, the HYP-like cells of the second aspect, the blastocyst-like cells obtained by the method of the third aspect, or the blastocyst-like cells of the fourth aspect.

[0084] In a seventh aspect, the present invention provides a method for screening therapeutic or preventive drugs, wherein the method comprises: a step of contacting the blastocyst obtained by the method described in the third aspect or the blastocyst of the fourth aspect with a candidate molecule.

[0085] The present invention finds that the proportion of HYP-like cells in human blastocysts can be increased by overexpressing the GATA6 gene, thereby promoting the post-implantation developmental ability of blastocysts.

[0086] The present invention uses iGATA6 induced pluripotent stem cells to induce HYP cells in the spontaneous assembly of human embryo-like cells, which belongs to a synthetic embryo model.

[0087] Compared with the prior art, the construction method of the present invention significantly increases the proportion of HYP cells in human blastocysts and significantly improves the assembly efficiency of human blastocysts; in addition, it also improves the in vitro development ability of human blastocysts to a certain extent.

[0088] Glossary:

[0089] Blastocystoids (thylakoids) are embryo-like structures that are obtained by self-assembly of cell materials, especially stem cells, and have similar structural, molecular and developmental characteristics to normal embryos. Blastocystoids can simulate the formation and development process of real human embryos to a certain extent, providing a good in vitro model for the study of early human embryonic development.

[0090] Embryonic development in mammals is a strictly programmed cell lineage specialization process. After the formation of the fertilized egg, the embryo begins to cleave, and then the first cell lineage separation occurs in the blastocyst period. The inner cell mass (ICM) maintains pluripotency, while the outer cells differentiate to form the trophectoderm (TE). The trophectoderm will develop into structures such as the placenta outside the embryo, and the inner cell mass will further form the epiblast (EPI) that eventually develops into the fetus and the hypoblast (HYP) that develops into the yolk sac. Among them, EPI-like cells express epiblast marker molecules NANOG, OCT4 (POU5F1) and SOX2, HYP-like cells express hypoblast marker molecules GATA6, GATA4, SOX17 and PDGFRA, and TE-like cells express trophectoderm marker molecules GATA3, GATA2 and NR2F2.

[0091] Inner cell mass cells and epiblast cells can be cultured in vitro to obtain the original state ( The naive pluripotent stem cells (ESCs) are divided into two types: embryonic stem cells (ESCs) and embryonic stem cells (ESCs) in the primed state. The naive pluripotent stem cells have similar gene expression characteristics, epigenetic modification characteristics and developmental potential to pre-implantation embryonic cells, and are a good model for studying embryonic cells in vitro. Under appropriate culture conditions, naive pluripotent stem cells can assemble into blastocyst-like cells.

[0092] Currently, methods for synthesizing mouse thylakoids using pluripotent stem cells have been realized, while mouse naive ESCs cannot form thylakoids alone and must be supported by other types of cells. Unlike mouse naive pluripotent stem cells, human naive pluripotent stem cells have the ability to differentiate into trophectoderm cells, which gives human naive pluripotent stem cells a unique advantage in self-assembly when constructing human thylakoids. That is, without the support of other types of cells, a single human naive pluripotent stem cell line can be used under specific culture conditions to obtain thylakoids that are highly similar to human blastocyst structure, gene expression characteristics, and cell lineage specialization in vitro.

[0093] Human pluripotent stem cells The culture system of pluripotent stem cells (hnPSCs) can be a 5iLA culture system or a PXGL culture system. The 5iLA culture system includes five chemical small molecule inhibitors (inhibitors of BRAF, MEK, SRC, GSK3β and ROCK) and leukemia inhibitory factors LIF and Activin A. The PXGL culture system includes a MEK inhibitor PD0325901, a WNT signaling pathway antagonist XAV939, a protein kinase C inhibitor hnPSCs cultured in 5iLA or PXGL could stably maintain the original state of stem cells and could be induced to form human thylakoids.

[0094] 5iLAF medium will produce different sub-culture media based on the content or composition of the induction factors, such as the 5iLAF medium and 5iLAF-C medium in the present application. Of course, it should be understood that for the 5iLAF medium, its basic composition formula can be adjusted based on actual usage requirements, or reasonably replaced with ingredients with similar effects.

[0095] In some embodiments, the 5iLAF medium is selected from a 5iLAF-C medium containing CHIR99021 and a conventional 5iLAF medium containing IM-12. Among them, the specific composition of the 5iLAF-C medium is: DMEM / F-12 medium and Neurobasal medium as the basal medium, and also contains N2 supplement and B27 supplement. The auxiliary components in the medium are: KnockOut serum replacement (SR), GlutaMAX additive, MEM Non-Essential AminoAcids Solution, penicillin-streptomycin, 2-mercaptoethanol, bovine serum albumin (BSA). The induction factors in the medium are: PD0325901, CHIR99021, SB590885, WH-4-023, Y-27632, recombinant human leukemia inhibitory factor, activin A, FGF2. In some embodiments, the volume ratio of the DMEM / F-12 medium and the Neurobasal medium is 1:1. In some embodiments, the added mass of the N2 supplement and the B27 supplement is 1%-2% of the total mass, respectively. Of course, those skilled in the art can reasonably adjust the amount of the basal medium and the amount of N2 and B27 added according to actual use requirements to meet the culture requirements under different environments. In some embodiments, the added mass of the N2 supplement is 1% of the total mass, and the added mass of the B27 supplement is 2% of the total mass. In some embodiments, the amount of auxiliary components and induction factors added can be reasonably adjusted according to the type of stem cells actually induced and cultured. In some specific embodiments of the present invention, the amount of auxiliary components added is: based on the total mass of the culture medium, 0.5% of the total mass of KnockOut serum replacement (SR), 1 mM GlutaMAX additive, 1% of the total mass of MEM Non-Essential Amino Acids Solution, 1% of the total mass of penicillin-streptomycin, 0.1 mM 2-mercaptoethanol, and 50 μg / mL of bovine serum albumin (BSA).In some specific embodiments of the present invention, the amount of induction factors added is: PD0325901 with a final concentration of 1 μM, CHIR99021 with a final concentration of 1 μM, SB590885 with a final concentration of 0.5 μM, WH-4-023 with a final concentration of 1 μM, Y-27632 with a final concentration of 10 μM, recombinant human leukemia inhibitory factor with a final concentration of 20 ng / mL (recombinant human LIF, purchased from Qkine), activin A with a final concentration of 20 ng / mL, and fibroblast growth factor (FGF2) with a final concentration of 8 ng / mL.

[0096] In some embodiments, the specific composition of the conventional 5iLAF culture medium containing IM-12 is: DMEM / F-12 culture medium and Neurobasal culture medium as the basal culture medium, and also contains N2 supplement and B27 supplement. The auxiliary components in the culture medium are: KnockOut serum replacement (SR), GlutaMAX additive, MEM Non-EssentialAmino Acids Solution, penicillin-streptomycin, 2-mercaptoethanol, bovine serum albumin (BSA). The induction factors in the culture medium are: PD0325901, IM-12, SB590885, WH-4-023, Y-27632, recombinant human leukemia inhibitory factor, activin A, FGF2. In some embodiments, in the conventional 5iLAF culture medium containing IM-12, the volume ratio of DMEM / F-12 culture medium and Neurobasal culture medium is 1:1. In some embodiments, in the conventional 5iLAF medium containing IM-12, the added mass of N2 supplement and B27 supplement is 1%-2% of the total mass, respectively. Of course, those skilled in the art can reasonably adjust the amount of basal medium and the addition of N2 and B27 according to actual use requirements to meet the culture requirements under different environments. In some embodiments, the added mass of N2 supplement is 1% of the total mass, and the added mass of B27 supplement is 2% of the total mass. In some embodiments, the amount of auxiliary components and induction factors added can be reasonably adjusted according to the type of stem cells actually induced and cultured. In some specific embodiments of the present invention, the amount of auxiliary components added is: based on the total mass of the culture medium, 0.5% of the total mass of KnockOut serum replacement (SR), 1 mM GlutaMAX additive, 1% of the total mass of MEM Non-Essential Amino Acids Solution, 1% of the total mass of penicillin-streptomycin, 0.1 mM 2-mercaptoethanol, and 50 μg / mL of bovine serum albumin (BSA).In some specific embodiments of the present invention, the amount of induction factors added is: PD0325901 with a final concentration of 1 μM, IM-12 with a final concentration of 1 mM, SB590885 with a final concentration of 0.5 mM, WH-4-023 with a final concentration of 1 μM, Y-27632 with a final concentration of 10 μM, recombinant human leukemia inhibitory factor with a final concentration of 20 ng / mL (recombinant human LIF, purchased from Qkine), activin A with a final concentration of 20 ng / mL, and fibroblast growth factor 2 (FGF2) with a final concentration of 8 ng / mL.

[0097] Conventional 5iLAF medium containing IM-12 differs from 5iLAF-C medium in that IM-12 is used to replace CHIR99021 in 5iLAF-C medium. "Induce" relates to a process or action that causes a specific effect on the phenotype of a cell. Such an effect can be in the form of causing a phenotypic change, for example, differentiation to another cell phenotype; or it can be to maintain the cell in a specific cell form, for example, to prevent dedifferentiation or promote cell survival.

[0098] "Pluripotent stem cells" are multipotent cells with the ability to self-renew and self-replicate, and can differentiate into a variety of cell types under certain conditions.

[0099] The term "stem cell" in the present invention refers to a multipotent or lineage-uncommitted progenitor cell that has the potential to undergo an unlimited number of mitotic divisions to renew itself or to differentiate into daughter cells of a desired cell type.

[0100] In the present invention, the DMEM / F12 can also be replaced by a mixture of one or more of William's E cell culture medium, NeurobasalMedium cell culture medium, MEM cell culture medium, DMEM cell culture medium, 1640RPMI cell culture medium, or F12 cell culture medium. The DMEM / F12 culture medium comprises a mixture of DMEM and Ham's F-12 in a 1:1 ratio. The DMEM / F12 includes a DMEM / F-12 modified culture medium prepared by adjusting the ingredients according to actual applications. The DMEM / F12 modified culture medium includes but is not limited to DMEM-low sugar-pyruvate-glutamine-free-phenol red-free, DMEM / F-12-GlutaMAX TM, DMEM / F-12-HEPES (DMEM / F-12 with HEPES), DMEM-low glucose-pyruvate-HEPES. The DMEM / F12 is a DMEM / F12+HEPES medium, and the DMEM / F12+HEPES medium contains L-glutamine, HEPES, and phenol red.

[0101] In the present invention, 3D cell culture is three-dimensional cell culture. Taking the common scaffold three-dimensional culture model as an example, the model allows the interaction between cells and matrix, can better simulate the real growth environment of cells in the human body, and cells can migrate and grow in the three-dimensional spatial structure of the carrier to form a three-dimensional cell carrier complex. In addition, 3D cell culture allows cells to grow in all directions in vitro, similar to their growth mode in vivo. There are many 3D cell culture technologies, which can be summarized into three categories: 3D hydrogel, cell aggregation, and culture scaffold. Hydrogels are composed of a network of cross-linked polymer chains or complex natural or synthetic protein molecules. Since hydrogels contain a large amount of water, hydrogels have biophysical properties very similar to natural tissues, so they can be used as efficient 3D cell culture matrix. Cell aggregation is the phenomenon that several cells gather together to form a bacterial mass. Cell aggregation is related to the physiological characteristics of cells, especially the material structure of the cell wall. The culture scaffold can provide a physical support, and cells can enter the scaffold to grow and function. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 The figure shows GATA6 overexpression-induced HYP-like cells, where A shows the construction of iGATA6 hnESCs; BD respectively show the relative expression levels of the target gene GATA6, the pluripotency gene NANOG, and the HYP marker genes GATA4, SOX17, and PDGFRA in iGATA6 hnESCs at different time points under Dox induction.

[0103] Figure 2 The construction and characterization of EiG6 synthetic blastocysts are shown, wherein A shows a schematic diagram of the construction of EiG6 synthetic blastocysts; B shows a representative picture of EiG6 synthetic blastocysts in AggreWell on the fifth day after inoculation; C shows the efficiency of EiG6 blastocysts and spontaneous blastocysts using only hnES; DG show the immunofluorescence staining characterization results of EiG6 synthetic blastocysts on the fifth day.

[0104] Figure 3The number and proportion of HYP-like cells in blastocysts are shown. A shows the number of HYP-like cells in each spontaneous thylakoid (ES formed alone) or EiG6-synthesized thylakoid; B shows the proportion of TE, EPI and HYP-like cells in EiG6-synthesized thylakoids.

[0105] Figure 4 The transcriptome characterization and analysis of EiG6 blastocyst-like cells are shown. A shows the clustering analysis of the transcriptome sequencing of EiG6 synthetic blastocyst-like cells; B shows the expression enrichment of human embryonic epiblast cell markers (NANOG, POU5F1, SOX2), hypoblast markers (GATA6, SOX17, PDGFRA) and trophectoderm markers (GATA3, GATA2, NR2F2) in EiG6 synthetic blastocyst-like cells; C shows the distribution of ZeoR+ and ZeoR- cells in blastocyst-like cell subpopulations; DE shows the joint clustering analysis and correlation analysis of the transcriptome of EiG6 synthetic blastocyst-like cells and single-cell sequencing data of early real embryos (Petropoulos et al., Cell, 2016; Xiang et al., Nature, 2020) and other human induced blastocyst-like cells (Yanagida et al., Cell Stem Cell, 2021; Kagawa et al., Nature, 2022;).

[0106] Figure 5 The in vitro culture and characterization of EiG6 blastocysts after implantation are shown. A shows a schematic diagram of the in vitro culture of EiG6 synthetic blastocysts after implantation; B shows a representative immunofluorescence staining of spontaneous EiG6 synthetic thylakoids and spontaneous thylakoids (ES formed alone) after in vitro implantation; C shows a single-cell sequencing cluster analysis of EiG6 synthetic blastocysts after 3 days of in vitro implantation; D shows the enriched expression of marker molecules of each cell lineage of the embryo after implantation in EiG6 synthetic blastocysts.

[0107] Figure 6 The results of characterization of blastocysts synthesized at different ratios of WT hnESCs and iGATA6 hnESCs are shown. A and B show the immunofluorescence staining characterization results of blastocysts synthesized at a ratio of 5:1 and 20:1 of WT hnESCs and iGATA6 hnESCs, respectively, and C shows the statistical results of the number of HYP-like cells in the synthetic thylakoids at different ratios. Specific implementation plan

[0108] In order to make the above-mentioned purpose, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below. The technology involved in the following examples, unless otherwise specified, is the conventional technology in various fields such as cell biology, biochemistry, molecular biology, etc. well known to those skilled in the art.

[0109] The following are preferred embodiments of the present invention, and the protection of the present invention is not limited to the following preferred embodiments. It should be pointed out that for those skilled in the art, several modifications and improvements made on the basis of this invention conception all belong to the protection scope of the present invention.

[0110] The culture media used in the following experiments are as follows:

[0111] (1) 5iLAF medium formula:

[0112] 1:1 DMEM / F-12 (Gibco, C11330500CP) and Neurobasal (Gibco, 21103049), 1% N2supplement (Gibco, 17502048), 2% B27 supplement (Gibco, 17504044), 0.5% KnockOut SR (Gibco, 10828010), 1mM GlutaMAX (Gibco, 35050061), 1% MEM Non-Essential AminoAcids (Gibco, 11140050), 1% penicillin-streptomycin (Gibco, 10378016), 0.1mM 2-mercaptoethanol (Gibco, 21985023), 50μg / mL bovine serum albumin (Sigma, B2064), and the following small molecules or cytokines were added: 1μM PD0325901 (Selleck, S1036), 1μM IM-12 (Selleck, S7566), 0.5μM SB590885 (Selleck, S2220), 1μM WH-4-023 (Selleck, S7565), 10μM Y-27632 (Selleck, S1049), 20ng / mL recombinant human LIF (Qkine, Qk036), 20ng / mL activin A (Qkine, Qk001), 8ng / mL FGF2 (Healthgen Biotechnology Corp, HYC005M01).

[0113] (2) 5iLAF-C medium formula:

[0114] 1:1 DMEM / F-12 (Gibco, C11330500CP) and Neurobasal (Gibco, 21103049), 1% N2supplement (Gibco, 17502048), 2% B27 supplement (Gibco, 17504044), 0.5% KnockOut SR (Gibco, 10828010), 1mM GlutaMAX (Gibco, 35050061), 1% MEM Non-Essential AminoAcids (Gibco, 11140050), 1% penicillin-streptomycin (Gibco, 10378016), 0.1mM 2-mercaptoethanol (Gibco, 21985023), 50μg / mL bovine serum albumin (Sigma, B2064), and the following small molecules or cytokines were added: 1 μM PD0325901 (Selleck, S1036), 1 μM CHIR99021 (Selleck, S2924), 0.5 μM SB590885 (Selleck, S2220), 1 μM WH-4-023 (Selleck, S7565), 10 μM Y-27632 (Selleck, S1049), 20 ng / mL recombinant human LIF (Qkine, Qk036), 20 ng / mL activin A (Qkine, Qk001), 8 ng / mL FGF2 (Healthgen Biotechnology Corp, HYC005M01);

[0115] (3) IVC1 culture medium formula: DMEM / F12 (Gibco, C11330500CP) was supplemented with 2 mM Glutamax (Gibco, 35050061), 1% ITS-X (Gibco, 51500056), 0.5% penicillin-streptomycin (Gibco, 10378016), 10 μM Y-27632 (Selleck, S1049), 20% fetal bovine serum heat-inactivated at 56°C for 30 minutes (Gibco, 10099141C), 8 nM β-estradiol (Sigma-Aldrich, E8875), 200 ng / mL Progesterone (Sigma-Aldrich, P0130) and 25 μM N-acetyl-L-cysteine ​​(Sigma-Aldrich, A7250).

[0116] (4) IVC2 culture medium formula: DMEM / F12 (Gibco, C11330500CP) was supplemented with 2 mM Glutamax (Gibco, 35050061), 1% ITS-X (Gibco, 51500056), 0.5% penicillin-streptomycin (Gibco, 10378016), 30% fetal bovine serum heat-inactivated at 56°C for 30 minutes (Gibco, 10099141C), 8 nM β-estradiol (Sigma-Aldrich, E8875), 200 ng / mL Progesterone (Sigma-Aldrich, P0130) and 25 μM N-acetyl-L-cysteine ​​(Sigma-Aldrich, A7250).

[0117] The reagents and instruments used in the present invention are all commercially available and can be purchased on the market.

[0118] The detection methods used in the following experiments are as follows:

[0119] The operations of fluorescence quantitative PCR experiment, immunofluorescence staining and single cell transcriptome sequencing in the present invention will be described below. The experimental methods involved in the present invention are the same as described below, and the specific processes involved in these experiments will not be repeated below.

[0120] (I) Fluorescence quantitative PCR:

[0121] Total RNA extraction kit: Kangwei Century, CW0581M

[0122] Reverse transcription kit: Applied Biological Materials Inc, G490

[0123] Fluorescence quantitative PCR kit TB Premix Ex Taq TM II:Takara,RR820A

[0124] (1) 2x10 6 The iGATA6 hnESCs cells treated with Dox were lysed with 1 mL of T RIzon Reagent (CW0580) and reacted at room temperature for 5 minutes.

[0125] (2) Add chloroform at a ratio of 200 μL, cover the tube, shake vigorously for 15 seconds, and leave at room temperature for 2 minutes;

[0126] (3) Centrifuge at 4°C and 12,000 rpm (~13,400 × g) for 10 min. The sample is then separated into three layers: a red organic phase, an intermediate layer, and an upper colorless aqueous phase. The RNA is mainly in the upper aqueous phase. Transfer the upper aqueous phase to a new RNase-Free centrifuge tube.

[0127] (4) Add an equal volume of 70% ethanol (prepared with RNase-free water) to the aqueous phase solution and mix by inversion;

[0128] (5) Add all the solution obtained in the previous step to the adsorption column (Spin Columns RM) in the collection tube, centrifuge at 12,000 rpm for 20 seconds, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0129] (6) Add 700 μL of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0130] (7) Add 500 μL of Buffer RW2 to the adsorption column (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 20 seconds, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube; repeat once;

[0131] (8) Centrifuge at 12,000 rpm for 2 minutes and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes and dry it thoroughly. Place the adsorption column in a new RNase-free centrifuge tube, add 30 μL RNase-Free Water to the middle part of the adsorption column, place it at room temperature for 1 minute, centrifuge at 12,000 rpm for 1 minute, collect the RNA solution and measure the RNA concentration;

[0132] (9) Take 2 μg of the obtained RNA and perform reverse transcription using a reverse transcription kit (Applied Biological Materials Inc, G490). Add 4 μL of 5X All-In-One RT MasterMix and add Nuclease-free water to a total volume of 20 μL. After thorough mixing, incubate at 25°C for 10 minutes, incubate at 42°C for 45 minutes, and then incubate at 85°C for 5 minutes to obtain reverse transcribed cDNA.

[0133] (10) Using the fluorescent quantitative PCR kit TB Premix Ex Taq TMII (Takara, RR820A) was used for qPCR to perform relative quantification of the target gene GATA6, the pluripotency marker gene NANOG, the HYP marker gene GATA4, SOX17 and PDGFRA. GAPDH was used as the internal reference gene, and the primer sequences used were as follows:

[0134] GAPDH-qF:GTCTCCTCTGACTTCAACAGCG(SEQ ID NO:1)

[0135] GAPDH-qR:ACCACCCTGTTGCTGTAGCCAA(SEQ ID NO:2)

[0136] GATA6-qF:GGTAATAGCAATAATTCCATTCC(SEQ ID NO:3)

[0137] GATA6-qR:GCTGTAGGTTGTGTTGTG (SEQ ID NO:4)

[0138] GATA4-qF:CGACACCCCAATCTCGATATG(SEQ ID NO:5)

[0139] GATA4-qR:GTTGCACAGATAGTGACCCGT(SEQ ID NO:6)

[0140] SOX17-qF:GACATGAAGGTGAAGGGCGA(SEQ ID NO:7)

[0141] SOX17-qR: TAGCCCACACCATGAAAGCG (SEQ ID NO:8)

[0142] NANOG-qF: GCAGAAGGCCTCAGCACCTA (SEQ ID NO:9)

[0143] NANOG-qR: AGGTTCCCAGTCGGGTTCA (SEQ ID NO: 10)

[0144] PDGFRA-qF: TGCCTGACATTGACCCTGT (SEQ ID NO:11)

[0145] PDGFRA-qR: CCGTCTCAATGGCACTCTC (SEQ ID NO: 12).

[0146] (II) Immunofluorescence staining:

[0147] (1) Use a mouth pipette to transfer the EiG6 blastocyst-like structure into a U-bottom culture well containing Dulbecco's phosphate buffered saline (DPBS, BasalMedia, B210KJ) and briefly wash to remove residual culture medium; then transfer to 4% paraformaldehyde (PFA, Beyotime, P0099) and fix at room temperature for 30 minutes or at 4°C overnight;

[0148] (2) After washing three times with DPBS to remove residual PFA, the cells were permeabilized with 0.75% Triton X-100 (Sigma, T8787) for 1 hour, and then blocked with blocking buffer containing 3% BSA and 0.1% Triton X-100 (DPBS) at room temperature for 1 hour;

[0149] (3) The blastocysts were then transferred into a blocking buffer containing diluted primary antibodies (anti-SOX2, 1:200 dilution, Invitrogen, 14-9811-80; anti-GATA3, 1:250 dilution, Abcam, ab199428; anti-SOX17, 1:40 dilution, R&D systems, AF1924; anti-GATA4, 1:200 dilution, Cell Signaling Technology, 36966; anti-OCT4, 1:50 dilution, Santa Cruz Biotechnology, sc-5279) and incubated overnight at 4°C;

[0150] (4) Wash three times with DPBS containing 0.1% Triton X-100 to remove residual primary antibody, and transfer the blastocysts into the blocking buffer containing diluted secondary antibody (Donkey anti-Rat IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluo 594, Invitrogen, A21209; Donkey anti-Goat IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Invitrogen, A11055; Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647, Invitrogen, A31573; Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluo 555, Invitrogen, A31570; 1:1000 dilution) and incubate at room temperature in the dark for 1 hour;

[0151] (5) After washing three times with DPBS to remove residual secondary antibody, the cells were incubated with nuclear staining solution (DAPI, Sigma, D9542) at room temperature for 20 minutes.

[0152] (6) The stained blastocysts were imaged using a Zeiss LSM800 laser scanning confocal microscope.

[0153] (III) Single-cell transcriptome sequencing:

[0154] (1) Using a mouth pipette, approximately 200 EiG6 blastocysts on the fifth day were picked from the AggreWell and washed once with DPBS, and then digested with 0.25% trypsin-EDTA (Gibco, 25300054) in a 20% O2, 5% CO2, 37°C incubator for 30 minutes.

[0155] (2) Then, 1 mL of DPBS containing 0.04% BSA was added for neutralization. After centrifugation of the cell digestion solution at 300 g for 5 minutes, the cell pellet was resuspended in DPBS containing 0.04% BSA, and then the cell suspension was filtered using a cell filter with a pore size of 40 μm. The cell number and density were measured using the Countstar Mira FL fluorescent staining method, and the cell viability was evaluated in combination with the AOPI fluorescent staining method.

[0156] (3) Take 1.7×10 5 The single-cell transcriptome library was constructed according to the instructions of 10×Genomics (Chromium Single Cell 3'Reagent Kits, V3.1). The qualified library was sent to the Illumina Novaseq platform of Novogene for sequencing, and paired reads with a length of 150 bp were obtained.

[0157] (4) The obtained 10×Genomics single-cell RNA-seq data were preprocessed using Trimmomatic software to remove reads containing adapters, low quality, or less than 26 bp in length. Bioinformatics analysis such as alignment, annotation, removal of duplicate reads, and gene expression quantification was then performed using STARsolo and STAR (v.2.7.9a) algorithm tools.

[0158] Example 1 Preparation of wild-type naive embryonic stem cells

[0159] (1) Obtaining wild-type hnESCs

[0160] 2×10 4 Primed human embryonic stem cells (pESCs) were inoculated on feeder cells (inactivated mouse embryonic fibroblasts, feeders) and induced into pluripotent stem cells using 5iLAF-C medium containing GSK3 inhibitor CHIR99021. The primed human embryonic stem cells were primed STiPS 0-XX1 iPSCs (purchased from Howard Hughes Medical Institute, USA), and the feeder cells were embryonic fibroblasts of ICR strain mice (purchased from the cell bank of the Type Culture Collection Committee) treated with Mitomycin C for 3 hours;

[0161] After 9-13 days of induction, the cells were digested with Accutase (Invitrogen, 00455556) and passaged at a ratio of 1:2 (denoted as P1). The resulting cells were naive pluripotent stem cells. Six days after passage, the cells were again passaged at a ratio of 2×10 5 Cells / 35 mm culture dish passage (denoted as P2);

[0162] On the third or fourth day of P3 (and later) passage, the 5iLAF-C medium was replaced with 5iLAF medium containing the GSK3 inhibitor IM-12;

[0163] On the fourth day after changing to 5iLAF medium, dome-shaped cell clones were picked for cell line establishment and named WThnESCs.

[0164] (2) WT nESCs spontaneously form ES-like blastocysts

[0165] After digestion, the stably established WT nESCs were seeded on a culture plate coated with Gelatin (Stemcell, 07903) and cultured at 37°C for 1 hour to remove the feeder cells. 4 The feeder-free nESCs were seeded in a 24-well AggreWell (Stemcell, 34411) 3D culture system and cultured for 6 days using 5iLAF medium. 40-60% of human spontaneous blastocyst-like structures were obtained, which are called ES blastocyst-like structures. WT nES cell lines that can spontaneously form blastocyst-like structures were used for subsequent steps.

[0166] Example 2: GATA6 overexpression induces HYP-like cells

[0167] 1. Plasmids PB-TetO-GATA6-Zeo (GATA6 gene accession number NM_005257.6), PB-CAG-IRES-rTTA3-Bsd and pBase were constructed by the laboratory. PB refers to the PiggyBac backbone; TetO refers to the inducible promoter; PGK, CAG and IRES are conventional expression promoters; Zeo is the resistance gene for zeocin; Bsd is the resistance gene for blasticidin; pBase is a plasmid expressing the PiggyBac transposase, which is used to stably insert the target gene in the PB plasmid into the host cell genome. rTTA3 and exogenous doxycycline (Dox) jointly activate TetO, and the purpose of inducing GATA6 gene expression can be achieved by controlling Dox.

[0168] 2. Add 2 μg of PB-TetO-GATA6-Zeo, 2 μg of PB-CAG-IRES-rTTA3-Bsd and 2 μg of pBase plasmid to 2x10 5The WT hnESCs obtained in the examples were mixed and electroporated using a Neon electroporator and a kit (TheroFisher, MPK10025) under the conditions of 1300V, 20ms, and 3 pulses. After electroporation, the cells were immediately planted on feeder cells (inactivated mouse embryonic fibroblasts, feeders) and continued to be cultured using 5iLAF medium. After 6-7 days, the cells were passaged 1:2. After 48 hours of cell attachment, 50 μg / mL bleomycin (Invitrogen, R25001) and 3 μg / mL blasticidin (ThermoFisher Scientific, A1113903) were added to the 5iLAF medium for positive cell screening. After 5-7 days of drug screening, the surviving clones were picked to establish a cell line, named iGATA6 hnESCs ( Figure 1 A).

[0169] 3. GATA6 overexpression and induction were verified by fluorescence quantitative PCR. qPCR results showed that the expression of GATA6 in iGATA6hnESCs increased significantly 1 hour after Dox induction ( Figure 1 B). This indicates that the iGATA6 hnESCs cell line constructed and screened in this example has stably integrated the iGATA6 plasmid and the rtTA3 plasmid, and can conditionally overexpress the target gene GATA6 with the help of Dox. The expression levels of the hypoblast (HYP) marker genes GATA4, SOX17, and PDGFRA also increased significantly with the increase in GATA6 expression, while the pluripotency marker NANOG of hnESCs was significantly downregulated ( Figure 1 C and Figure 1 D). This indicates that GATA6 can induce hnESCs to generate HYP-like cells, and that 24 hours of induction is sufficient to induce the molecular characteristics of HYP cells.

[0170] Example 3: Construction of human synthetic blastocysts

[0171] 1. The WT hnESCs obtained in Example 1 and the iGATA6 hnESCs stably established in Example 2 were digested and seeded in culture plates coated with Gelatin (Stemcell, 07903) and cultured at 37°C for 1 hour to remove feeder cells. 4 WT hnESCs and 4×10 3iGATA6 hnESCs were mixed thoroughly in 1 mL of 5iLAF medium and then seeded in 24-well AggreWell (Stemcell, 34411) for 3D culture; fresh 5iLAF medium was replaced every day;

[0172] 2. 48 hours after inoculation, Dox was added at a final concentration of 1 μg / mL when the culture medium was replaced to induce the expression of GATA6 and the generation of HYP cells ( Figure 2 A);

[0173] 3. After 24 hours of Dox addition, the medium was replaced with 5iLAF medium to remove Dox induction;

[0174] 4. On the 5th day after inoculation (~120 hours), human blastocyst-like structures can be obtained in more than 80% of the microwells; called EiG6 blastocyst-like structures ( Figure 2 B). Compared with using only WT hnESCs, the efficiency of blastocyst formation was significantly improved after adding iGATA6 hnESCs (from ∼55.5% to ∼87.8%, Figure 2 C).

[0175] 5. Immunofluorescence staining was performed on the fifth day EiG6 blastocysts to identify the expression of human embryo-specific markers, and laser scanning confocal microscopy was used to image the stained blastocysts ( Figure 2 DG). The staining results showed that the EiG6 blastocyst-like cells synthesized in this example were very similar to real human embryos, with epiblast-like cells expressing SOX2 and OCT4 inside the structure, some hypoblast cells expressing GATA4 and SOX17 on the surface of the internal cells, and trophectoderm-like cells expressing GATA3 outside the structure.

[0176] Compared with spontaneous blastocysts derived from WT hnESCs alone (ES blastocysts), EiG6 blastocysts contain more HYP-like cells and their proportion is close to that of real human embryos ( Figure 3 A and Figure 3 B) These results indicate that the addition of iGATA6 hnESCs greatly improves the HYP cells in blastocysts, making them more accurately mimic real human embryos in vitro.

[0177] 6. Single-cell transcriptome sequencing was performed on the fifth-day EiG6 blastocysts. The analysis results showed that there were mainly three types of cell subpopulations in the EiG6 synthetic blastocysts ( Figure 4 A and Figure 4B). Among them, the cell subpopulation enriched with high expression of epiblast marker molecules NANOG, OCT4 (POU5F1) and SOX2 is called EPI-like cells, the cell subpopulation expressing hypoblast marker molecules GATA6, SOX17 and PDGFRA is called HYP-like cells, and the cells expressing trophectoderm marker molecules such as GATA3, GATA2 and NR2F2 are called TE-like cells. HYP-like cells account for about 6.98% of the total cells, which is close to the proportion of iGATA6 hnESCs in the starting cells. Since the iGATA6 plasmid expresses the Zeocin resistance gene (ZeoR) in tandem, WT and iGATA6 hnESCs can be distinguished by the expression of ZeoR. The results showed that ZeoR+ iGATA6 hnESCs accounted for about 5.29% of the total number of cells, and the vast majority of ZeoR+ were induced into HYP-like cells ( Figure 4 C). The HYP-like cell subpopulation contained 69.83% ZeoR+ and 30.17% ZeoR- cells, indicating that after iGATA6 hnESCs were induced into HYP-like cells, some WT hnESCs were also affected to transform into HYP cell fate.

[0178] Compared with the single-cell data of human early embryos (Petropoulos et al., Cell, 2016; Xiang et al., Nature, 2020) and other human induced blastocysts (Yanagida et al., Cell Stem Cell, 2021; Kagawa et al., Nature, 2022), this example further confirmed the molecular characteristics of EPI-like, TE-like and HYP-like cell subpopulations in EiG6 blastocysts at the transcriptome level. The cells in these blastocysts are very similar to the corresponding cells in human embryos ( Figure 4 DE). These results indicate that the addition and induction of iGATA6 hnESCs can significantly increase the proportion of HYP-like cell components in synthetic blastocysts. Synthetic blastocysts more accurately simulate real blastocysts in the human body in terms of morphological structure, cell space composition and transcriptome molecular characteristics.

[0179] Example 4: In vitro post-implantation culture of human EiG6 synthetic blastocysts

[0180] The fifth day EiG6 blastocysts were transferred into suspension culture dishes (Greiner, 657160) and cultured in embryonic in vitro culture medium in a vertical carbon dioxide oscillator (Zhichu Instruments, ZCLY-180N) to simulate the post-implantation development of the embryos ( Figure 5A). In vitro culture (IVC) culture medium is divided into IVC1 and IVC2.

[0181] 1. Use a mouth pipette to pick up a single EiG6 blastocyst with obvious intraembryonic structure and cavity, and not attached to other blastocysts, and transfer it to a suspension culture dish (Greiner, 657160), and continue to culture it in a vertical carbon dioxide shaker (Zhichu Instrument, ZCLY-180N) for 24 hours with 4 ml IVC1 medium. The culture conditions are 20% O2, 5% CO2, 37°C, 60rpm;

[0182] 2. After 24 hours, discard 2 mL of culture medium and add 2 mL of fresh IVC2 medium, and continue culturing under the same culture conditions as above;

[0183] 3. After 48 hours, discard 2 mL of culture medium and add 2 mL of fresh IVC2 medium, and continue culturing under the same culture conditions as above;

[0184] 4. After 72 hours, the samples were subjected to immunofluorescence staining analysis and single-cell transcriptome analysis. The immunofluorescence staining method was as described above, where the GATA6 antibody was anti-GATA6, diluted 1:40, R&D systems, AF1700. The single-cell transcriptome sequencing analysis method was as described above.

[0185] Immunofluorescence staining results showed that EiG6 blastocysts developed into egg column-like structures after 3 days of in vitro implantation ( Figure 5 AB). It is mainly manifested as a bipolar structure composed of GATA3+ trophectoderm cells and SOX2+ epiblast cells on the inside, surrounded by GATA6+ visceral endoderm (VE) cells on the outside. However, in the blastocysts (ES blastocysts) spontaneously formed by WThnESCs without iGATA6, the outer VE-like cell structure cannot be formed due to the lack of HYP components ( Figure 5 B, below).

[0186] The results of single-cell transcriptome sequencing showed that cluster 1 and 4 cells in the EiG6 blastocyst-like embryo expressed embryonic epiblast marker factors, among which cluster 4 cells began to express the primed epiblast marker molecule ZIC2, indicating that the epiblast-like cells in the EiG6 blastocyst-like embryo further developed from the original state to the primed state in vitro. Cluster 2 expressed VE marker molecules such as APOA2 and APOB, but did not express the endoderm marker molecule TBXT, indicating that the epiblast-like cells in the EiG6 blastocyst-like embryo further developed into VE structures in vitro. Cells in cluster 3 began to express trophectoderm cell marker factors of human post-implantation embryos such as TEAD3, TACSTD2 and CGA ( Figure 5 CD).

[0187] These results indicate that HYP cell fractions derived from iGATA6 hnESCs effectively promoted the postimplantation developmental capacity of EiG6 synthetic blastocysts.

[0188] Example 5: Construction of human synthetic blastocysts using different ratios of WT hnESCs and iGATA6 hnESCs

[0189] The WT hnESCs obtained in Example 1 and the iGATA6 hnESCs stably established in Example 2 were digested and seeded in culture plates coated with Gelatin (Stemcell, 07903) and cultured at 37°C for 1 hour to remove feeder cells. The two cells were mixed in the following two proportions to construct human synthetic blastocysts:

[0190] (1) Take 4×10 4 WT hnESCs and 8×10 3 iGATA6 hnESCs were mixed thoroughly in 1 mL of 5iLAF medium and then seeded in 24-well AggreWell (Stemcell, 34411) for 3D culture (i.e., WT hnESCs: iGATA6 hnESCs = 5:1);

[0191] (2) Take 4×10 4 WT hnESCs and 2×10 3 iGATA6 hnESCs were mixed thoroughly in 1 mL of 5iLAF medium and then seeded in 24-well AggreWell (Stemcell, 34411) for 3D culture (i.e., WT hnESCs: iGATA6 hnESCs = 20:1)

[0192] The remaining steps of the construction method are the same as those shown in Example 3.

[0193] Laser scanning confocal microscopy imaging staining results showed that WT hnESCs: iGATA6hnESCs = 5:1 were used to assemble blastocysts, and HYP-like cells appeared in the trophectoderm (TE) position ( Figure 6 A); WT hnESCs:iGATA6 hnESCs = 20:1 were used to assemble blastocysts, and the number of HYP-like cells was significantly reduced ( Figure 6 B). At the same time, the number of HYP-like cells in the synthetic thylakoids assembled using different ratios of WT hnESCs:iGATA6 hnESCs also varied ( Figure 6 C).

[0194] The present invention provides a method for increasing the HYP component in synthetic blastocysts by adding an iGATA6 transgenic cell line to a system in which hnESCs spontaneously form blastocysts. The iGATA6 synthetic blastocysts obtained by the construction method of the present invention with an optimized WT hnESCs:iGATA6 hnESCs=10:1 ratio can most similarly simulate the morphology, cell lineage composition and transcriptome characteristics of real human blastocysts.

[0195] Compared with the reported induced blastocysts, the synthetic iGATA6 blastocysts have higher efficiency, a structure more similar to real embryos, and better post-implantation development capabilities.

[0196] The induction and assembly of iGATA6 hnESCs and the 5iLAF assembly medium are the key technical points of the method of the present invention. The present invention has been described in detail above with general descriptions and specific embodiments. However, on the basis of the present invention, some modifications or improvements can be made thereto, such as the synthesis of other ratios of WT hnESCs and iGATA6 hnESCs, which is obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. A method for inducing the formation of hypoblast (HYP)-like cells, the method comprising the following steps: (1) obtaining pluripotent stem cells overexpressing the GATA6 gene; and (2) Inducing the pluripotent stem cells that overexpress the GATA6 gene to form HYP-like cells. 2 . The method according to claim 1 , wherein the HYP-like cells express the markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

3. The method according to claim 1, wherein the induction is performed using doxycycline, Preferably, the induction time is 10-40h, preferably 20-28h.

4. The method according to claim 1, wherein the pluripotent stem cells are human pluripotent stem cells or non-human mammalian pluripotent stem cells, Preferably, the pluripotent stem cells are naive pluripotent stem cells.

5. The method according to claim 1, wherein the method further comprises: GATA6-overexpressing pluripotent stem cells were prepared by introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells. Preferably, the wild-type pluripotent stem cells are wild-type naive pluripotent stem cells, Preferably, the wild-type naive pluripotent stem cells are obtained by inducing stem cells, More preferably, the stem cells are selected from primed stem cells, More preferably, the primed stem cells are selected from primed stem cells of human or non-human mammalian origin. More preferably, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor in sequence, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different. More preferably, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3βinhibitor 1. One or more of KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin, More preferably, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

6. HYP-like cells obtained by the method of any one of claims 1 to 5. The HYP-like cells according to claim 6 , wherein the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

8. A method for inducing the formation of blastocyst-like cells, the method comprising the following steps: (1) obtaining GATA6-overexpressing pluripotent stem cells; and (2) Inducing cells containing the GATA6-overexpressing pluripotent stem cells to form blastocysts.

9. The method according to claim 8, wherein in step (2), the GATA6-overexpressing pluripotent stem cells are mixed with wild-type pluripotent stem cells to induce the formation of blastocyst-like cells, Preferably, the ratio of the number of GATA6-overexpressing pluripotent stem cells to the number of wild-type pluripotent stem cells is 1:(5-20), preferably 1:(8-12), Preferably, the medium used in the mixed culture is a pluripotent stem cell maintenance medium, preferably a 5iLA medium or a PXGL medium, more preferably a 5iLAF medium. Preferably, the mixed culture time is 48-72h, preferably 45-50h. Preferably, the mixed culture is 3D cell culture.

10. The method according to claim 8, wherein the induction is performed using doxycycline, Preferably, the concentration of doxycycline is 0.5-2 μg / mL. Preferably, the induction time is 10-40h, preferably 20-28h.

11. The method according to claim 8, wherein the pluripotent stem cells are human pluripotent stem cells or non-human mammalian pluripotent stem cells, Preferably, the pluripotent stem cells are naive pluripotent stem cells.

12. The method according to claim 8, wherein the method further comprises: GATA6-overexpressing pluripotent stem cells were prepared by introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells. Preferably, the wild-type pluripotent stem cells are wild-type naive pluripotent stem cells, Preferably, the wild-type naive pluripotent stem cells are obtained by inducing stem cells, More preferably, the stem cells are selected from primed stem cells, More preferably, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor in sequence, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different. More preferably, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3βinhibitor 1. One or more of KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin, More preferably, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

13. The method according to claim 8, wherein the method further comprises: After induction, the assembly culture was performed. Preferably, the culture medium used in the assembly culture is a pluripotent stem cell maintenance medium, preferably a 5iLA medium or a PXGL medium, more preferably a 5iLAF medium. Preferably, the assembly culture time is 100-140 hours.

14. Blastocysts obtained by the method according to any one of claims 8 to 13.

15. The blastocyst-like embryo according to claim 14, wherein the blastocyst-like embryo is a preimplantation blastocyst-like embryo, Preferably, the blastocyst is a human blastocyst. Preferably, the blastocyst-like cells contain three cell subpopulations: EPI-like cells, HYP-like cells and TE-like cells. More preferably, in the blastocyst-like embryo, HYP-like cells account for about 6-8% of the total cells. More preferably, the EPI-like cells express epiblast marker molecules NANOG, OCT4 and SOX2. More preferably, the HYP-like cells express hypodermal marker molecules GATA6, SOX17 and PDGFRA, More preferably, the TE-like cells express trophectoderm marker molecules GATA3, GATA2 and NR2F2.

16. Use of the HYP-like cells obtained by the method of any one of claims 1 to 5, the HYP-like cells described in claim 6 or 6, the blastocyst-like cells obtained by the method of any one of claims 8 to 13, or the blastocyst-like cells described in claim 14 or 15 in preparing cells or organoids for treating diseases related to early embryonic development, or in preparing cell models or organoid models for studying diseases related to early embryonic development, or in studying pre-implantation and early post-implantation embryogenesis, or in screening key genes for early embryonic development defects.

17. A pharmaceutical preparation comprising HYP-like cells obtained by the method of any one of claims 1 to 5, HYP-like cells according to claim 6 or 6, blastocysts obtained by the method of any one of claims 8 to 13, or blastocysts according to claim 14 or 15.

18. A method for screening a therapeutic or preventive drug, wherein the method comprises: A step of contacting the blastocyst obtained by the method of any one of claims 8 to 13 or the blastocyst according to claim 14 or 15 with a candidate molecule.

Images