Application of CaFtsH1 metalloproteinase gene of pepper in leaf development in seedling stage of pepper

Abstract

The invention discloses application of a pepper CaFtsH1 metalloproteinase gene in pepper seedling stage leaf development, and belongs to the field of plant genetic engineering, a full-length nucleotide sequence of a rape CaFtsH1 gene is shown as SEQ ID NO: 1, and a specific fragment selected by VIGS is shown as SEQ ID NO: 2. The gene is subjected to virus-induced gene silencing in a pepper material Z14, and a silencing single plant has a whitened leaf phenotype and only contains very few chloroplasts with abnormal development, so that the gene is very important for the development of chloroplasts and leaves of pepper seedlings; therefore, the method has a certain application prospect in pepper molecular design breeding and high-photosynthetic-efficiency breeding.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to an application of a pepper CaFtsH1 metalloproteinase gene in the development of pepper leaves at the seedling stage. Background Art

[0002] Chloroplasts, as the main source of nutrition for the autotrophic growth of peppers, directly affect the accumulation of organic matter and yield composition of peppers. Enriching the photosynthesis regulatory network of peppers can lay a molecular biological foundation for the breeding of peppers with high photosynthesis efficiency. At the same time, in molecular design breeding, effective genotype selection of genes that affect the normal growth and development of peppers can ensure the production and supply of high-quality hybrid seedlings.

[0003] In order to avoid photoinhibition, photosynthetic plants have established various mechanisms to reduce photodamage caused by excessive light energy, and the PS II repair cycle is one of them. This process has been studied in multiple species, and the whole process is relatively conservative. It is generally divided into the following processes: light-induced photodamage of the D1 protein in the reaction center; partial disassembly of the PS II-LHC II supercomplex to expose the damaged D1; selective hydrolysis of the photodamaged D1 protein by proteases; resynthesis of D1 and reassembly of the functional PS II core complex. The whole process is extremely important for restoring and maintaining photosynthetic efficiency. In higher plants, the degradation of photodamaged D1 protein is accomplished by FtsH and Deg proteases. FtsH is an ATP-dependent protease with a transmembrane domain found in bacteria. It has been studied in many plants, including rice, Arabidopsis, wheat, soybean, peanut, tomato, tobacco, pear, rapeseed and alfalfa. Most prokaryotes have only one FtsH protein, while there are multiple FtsH proteins in plants, which degrade substrates in the form of heterohexameric complexes.

[0004] Among higher plants, Arabidopsis FtsH proteins have been extensively studied. The Arabidopsis FtsH protein family includes 17 members, including 12 FtsH proteins (FtsH1-12) and 5 FtsHi proteins that have lost their proteolytic function (FtsHi1-5). Among the 12 FtsH proteins, FtsH10, FtsH4, and FtsH3 are localized in mitochondria, while the other nine FtsH proteins are localized in chloroplasts. The heterohexameric complex is composed of four FtsH proteins in chloroplasts (type A, FtsH1 / 5 proteins; type B, FtsH2 / 8 proteins). The complex is localized in the thylakoid membrane through the N-terminal transmembrane domain, participates in the turnover of D1 protein in the PS II repair cycle, and affects the assembly and degradation of other transmembrane subunits in the photosynthetic system. The presence of at least one type A protein is required to ensure normal chloroplast development and photosynthesis. The FtsH1 / 5 double mutant of type A protein will produce a lethal phenotype.

[0005] The applicant conducted genome-wide identification, comparison and expression pattern analysis of the FtsH gene in pepper and found that the loss of CaFtsH5 in the pepper A-type protein and the remaining CaFtsH1 protein may be necessary for pepper photosynthesis and normal growth and development. After silencing the CaFtsH1 gene using VIGS technology, pepper seedlings produced an albino phenotype. The function of this gene has not been reported in pepper so far, and it is a new functional gene that can be applied to pepper molecular design breeding. Summary of the invention

[0006] The invention provides an application of a pepper CaFtsH1 metalloproteinase gene in the development of pepper leaves at the seedling stage, which effectively solves the problem.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The main purpose of the present invention is to provide an application of a pepper CaFtsH1 metalloproteinase gene in the development of pepper leaves at the seedling stage. The pepper CaFtsH1 gene is shown in SEQ ID NO.1, and the gene of the present invention can be used for pepper. Experiments of transient transformation of pepper strains such as Z14 have confirmed that CaFtsH1 mainly maintains the function of chloroplasts, ultimately ensuring the normal development of pepper leaves at the seedling stage.

[0009] The present invention belongs to the field of plant genetic engineering, and discloses the application of pepper CaFtsH1 metalloprotease gene in pepper seedling leaf development. The full-length nucleotide sequence of the pepper CaFtsH1 gene is shown in SEQ ID NO:1, and the specific fragment selected by VIGS is shown in SEQ ID NO:2. By performing virus-induced gene silencing on the gene in pepper material Z14, it was found that the silenced individual plants had albino leaf phenotype and contained only a very small number of abnormally developed chloroplasts, indicating that the gene is extremely important for the chloroplast and leaf development of pepper seedlings. Therefore, the present invention has certain application prospects in pepper molecular design breeding and high photosynthesis breeding.

[0010] The application of pepper CaFtsH1 gene in maintaining pepper chloroplast development, leaf morphology and normal survival includes inserting pepper CaFtsH1 fragment into recombinant virus to inhibit the expression of endogenous CaFtsH1 gene in Z14 by conventional methods in the art, thereby obtaining silent plants with white leaves and only a few abnormally developed chloroplasts. Therefore, the gene can be used for pepper molecular design breeding to ensure the normal growth and development of pepper through genotype selection. The gene is shown in SEQ ID NO.1.

[0011] Due to the above structure, the beneficial effects of the present invention are:

[0012] The present invention discloses for the first time the application of the pepper CaFtsH1 gene in maintaining pepper chloroplast development, leaf morphology and normal survival. The VIGS silencing results in peppers confirmed that the gene silencing of CaFtsH1 led to the generation of leaf albino and chloroplast reduction phenotypes. The experimental results of the present invention show that the expression level of the CaFtsH1 gene is closely related to pepper leaf morphology and chloroplast development, and can be applied to pepper molecular design breeding to ensure normal growth and development in the seedling stage. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for describing the embodiments are briefly introduced below.

[0014] Figure 1 These are the phenotypic measurement results of the CaFtsH1 gene VIGS silenced strains and controls.

[0015] Figure 2 The transmission electron microscopy results of CaFtsH1 gene VIGS silenced individual strain and control. DETAILED DESCRIPTION

[0016] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0017] Example 1: Cloning of Capsicum annuum gene fragments

[0018] Using the genomic cDNA of pepper (Capsicum annuum L.) Z14 as a template, the 293bp fragment of the CaFtsH1 gene was amplified by PCR, with the forward primer CaFstH1-VIGS-1F: 5'-ctagatgaggagaagagcccATGGCTAAATCTCTACTCTCTTCCAAT-3' and the reverse primer CaFstH1-VIGS-1R: 5'-tgtgctcgacgacaagacccGTTGGGGTTTGGTGCTTCAAC-3', and finally the nucleotide sequence shown in SEQ ID NO: 2 was obtained.

[0019] In the above scheme, in order to achieve connection with the vector, SmaⅠ single enzyme cleavage site and corresponding protection bases were added to the 5' end of the forward and reverse primers respectively.

[0020] Example 2: Construction of recombinant vector

[0021] After single restriction digestion of the plasmid expression vector pTRV2-C2b, the cloned pepper CaFtsH1 gene PCR product was integrated into the pTRV2-C2b vector by recombination.

[0022] The vector plasmid was linearized with fast restriction enzyme, the system was as follows: Fastdigestion buffer, 5 μl; SmaⅠRestriction Enzyme, 4 μl; plasmid, 15 μl; ddH2O, 26 μl; total 50 μL. Program: 30°C, 120 min.

[0023] Then, the single enzyme digested plasmid and PCR amplification product were purified and recovered using the kit according to the instructions, and the concentration of the recovered results was detected using 1% agarose gel. The specific steps for the recombination and transformation of the target gene and the expression plasmid vector are as follows:

[0024] a. Prepare the recombination reaction system (20 μL)

[0025] 5×CEⅠⅠBuffer, 4μL; ExnaseⅠⅠ, 2μL; linearized vector, X ul; insert fragment, Y ul; ddH2O to 20μL.

[0026] Linearized vector dosage: 0.02×number of vector base pairs (bp) ng

[0027] Insert amount: 0.04×insert base pairs (bp) ng

[0028] b. Incubate at 37℃ for more than 30 minutes;

[0029] c. Add all the above recombinant products to 100 μL DH5α competent cells and place on ice for 25 minutes;

[0030] d. After heat shock at 42℃ for 45s, place in an ice water bath for 3min;

[0031] e. Add 400 μL LB liquid medium and culture at 37°C with shaking at 150 rpm / min for 60 min;

[0032] f. In the presence of kanamycin + , 50 mg / L) on LB solid medium overnight;

[0033] g. Pick a single colony and place it on LB solid medium (Kan + , 50 mg / L) for about 12 h, and the positive clones were detected by PC R colony detection.

[0034] Example 3: Transformation of Agrobacterium tumefaciens GV3101

[0035] The plasmid was extracted using a plasmid extraction kit, and the specific instructions were followed. The sequence of the target fragment recombined into the vector was further confirmed to be accurate by first-generation sequencing. The above recombinant plasmid was then transformed into Agrobacterium GV3101, and the method steps were as follows:

[0036] (1) Add 1 μl of purified plasmid to 100 μl of competent Agrobacterium GV3101 and gently shake to mix;

[0037] (2) Place on ice for 5 min and immediately place in liquid nitrogen for 5 min;

[0038] (3) 37°C water bath for 5 min, ice bath for 5 min;

[0039] (4) Add 700 μL of LB medium and culture on a shaker at 200 rpm / min at 28°C for 1 h;

[0040] (5) Centrifuge to remove most of the supernatant, precipitate, mix gently by pipetting, take 100 μL of the bacterial solution, and apply it on an LB plate containing 50 mg / L kanamycin and 25 mg / L rifampicin;

[0041] (6) Culture at 28°C for 48 hours. Resistant colonies can be seen growing. Pick a single colony and inoculate it into 400uL LB medium (containing kanamycin and rifampicin) and culture it at 28°C with shaking overnight.

[0042] (7) PCR identification of positive colonies.

[0043] Example 4: Virus-induced gene silencing in pepper

[0044] 1) Pick positive Agrobacterium monoclones (pTRV1, pTRV2, pTRV2:PDS, pTRV2:Target) and place them in liquid LB medium containing 50 mg / mL kanamycin (Kanamycin, Kan) and 10 mg / mL rifampin (Rif). Culture on a 28°C constant temperature shaker with a speed set to 220 rpm / min until the bacterial liquid is saturated.

[0045] 2) The saturated bacterial liquid was added to a liquid LB medium (50 ml LB medium) containing 50 mg / mL Kan, 10 mg / mL Rif, 10 μM pH 5.6 morpholineethanesulfonic acid (MES) and 40 μM acetosyringone (AS) at a ratio of 1:40, and cultured on a 28°C constant temperature shaker with a speed set to 220 rpm / min for 16 h.

[0046] 50ml LB+10ul 100μm AS+1ml 0.5mol / L MES

[0047] 0.2MAS preparation: 0.3924g—>10ml dimethyl sulfoxide (DMSO) for storage

[0048] 0.5M MES preparation: 4.88g—>50ml H2O, pH: 5.2-5.6 (NaOH to adjust pH) Filter sterilize and divide into portions for later use

[0049] 3) Collect Agrobacterium at 5000 rpm / min, discard the supernatant, and resuspend Agrobacterium in ddH2O containing 200 mM magnesium chloride (MgCl2) and 150 μM AS (i.e., 1 ml of the prepared resuspension solution + 50 ml of water). Adjust the bacterial solution to an appropriate concentration (OD600 = 0.1), then wrap it with tin foil and let it stand at room temperature for 2-3 hours before injection infection.

[0050] Prepared resuspension solution—>1ml 0.5M MgCl2+37.5μlAS, make up to 50ml

[0051] 4) Mix pTRV1 and pTRV2 in equal amounts, and adjust the OD value before injection. Dilute with the resuspension solution, and mix the two bacterial solutions. The injection concentration after mixing is OD = 0.004. During injection, inject the bacterial solution into the leaf through a 1 mL syringe on the back of the cotyledon or true leaf.

[0052] 5) The injected pepper seedlings were in the cotyledon stage, with two cotyledons fully expanded. The injected pepper plants were placed in a dark culture at 16°C for 56 hours, and then transferred to normal growth conditions (temperature 25°C, 16h / 8h light / dark cycle).

[0053] Example 5: Real-time fluorescence quantitative PCR detection of gene expression

[0054] Leaves of the silenced individual plants and the negative control in Example 4 were selected for RNA extraction, reverse transcription and real-time fluorescence quantitative PCR to detect the expression of the gene.

[0055] The pepper UBI3 gene was used as an internal reference gene, and the primer sequences were as follows: Ca-UBI-3F: TGTCCATCTGCTCTCTGTTG, Ca-UBI-3R: CACCCCAAGCACAATAAGAC. The forward primer of the CaFtsH1 gene was 5'-GCTCTTGATGATGCAGCTCC-3', and the reverse primer was 5'-CAAGAACTCACTATACCTCC-3'.

[0056] RNA extraction from pepper leaves, reverse transcription of the first strand of cDNA, and fluorescence quantitative PCR were all performed using the kit according to the instructions. Figure 1 As shown in B ( Figure 1 In the figure, A is the phenotype of the pTRV2-C2b-CaFtsH1 vector VIGS silenced individual strain, as well as the positive control (pTRV2-C2b-PDS) and negative control (pTRV2-C2b); B is the relative expression detection result of the CaFtsH1 gene in the silenced individual strain and the negative control. The scale of Figure A is 3cm, and the data of Figure B are the mean ± SD of at least 3 biological replicates, ** indicates significant difference at the level of <0.01. ), the expression level of the CaFtsH1 gene in the silenced individual strain was significantly lower than that in the control.

[0057] Example 6: Transmission electron microscopic observation of leaves of silent plants and negative controls

[0058] Select the true leaves of silent plants and negative controls, cut into small pieces, and fix with 2.5% glutaraldehyde (25% glutaraldehyde is diluted to 2.5% with pH7.2, 0.2 mol / L phosphate buffer), evacuate until all leaves sink to the bottom of the tube, and keep at 4°C overnight. The tissue fixed with glutaraldehyde is rinsed 3 times with 0.1M phosphate buffer (PH7.4), 15 minutes each time, and fixed with 1% osmic acid*0.1M phosphate buffer (PH7.4) at room temperature (20°C) for 2 hours (the fixation time is adjusted appropriately according to different samples); then rinsed 3 times with 0.1M phosphate buffer (PH7.2), 15 minutes each time. The tissue (or cell) is dehydrated with 30%, 50%, 70%, 80%, 85%, 90%, 100% (twice) alcohol gradient upward, 15-20 minutes each time (the dehydration time can be appropriately extended for samples with high water content and thick cell membrane). The penetrants were acetone: epoxy resin (2:1), acetone: epoxy resin (1:1), and epoxy resin, in a 37-degree incubator, and each penetration lasted 8-12 hours. The infiltrated samples were placed in an embedding plate, and the embedding agent epoxy resin was added and polymerized in a 60-degree incubator for 48 hours. Ultrathin sections were prepared using a Leica UC7 microtome with a thickness of 80-100nm, and uranium-lead double staining (2% uranyl acetate saturated aqueous solution, lead citrate, stained at room temperature for 15 minutes, and the sections were dried at room temperature overnight. After staining, the samples were examined and photographed using a Tecnai G220 TWIN transmission electron microscope, as shown in Figure 1. Figure 2 As shown ( Figure 2 S represents starch grain, CP represents chloroplast, and TM represents thylakoid membrane. Scale bars: (A) 3 μm; (B) 500 nm).

[0059] Sequence Listing

[0060] Institute of Economic Crops, Hubei Academy of Agricultural Sciences, Yangtze University

[0061] Application of pepper CaFtsH1 metalloproteinase in pepper leaf development at seedling stage

[0062] DNA

[0063] Chili pepper (Capsicum)

[0064] >SEQ ID NO:1

[0065] ATGGCTAAATCTCTACTCTCTTCCAATTTTATGGGTTCTTCTCAAATCTTTCTTTCTC

[0066] CACCAACACCCAAAACCTCAAAGTACTTCAATTTCCACTCAAAAAGAAAGTGTAT

[0067] AATCACACAATCAACACTCAACAAAAAACCCAACTCAGATAATTTCAAGAATGCT

[0068] CAATCTAAAGCTGCTTTAGCTGCTTTACTGTTTTCTTCAATAACCCCACATGCCATT

[0069] GCTCTTGATGATGCAGCTCCAATAGCCTCACCCCCACAAGTGATGGAAGTTGAAGC

[0070] ACCAAACCCCAACACTTCAAATCCATTACCCTTTTCTCAAAATCTAGTCTTGAATGC

[0071] TCCAAAGACTCAAGCTTCACCTGTTTCTGACCTTCCTGAAAGTACTCAATGGAGGT

[0072] ATAGTGAGTTCTTGAATGCTGTGAAGAAGGGTAAAGTTGAGAGGGTAAGATTTAGT

[0073] AAAGATGGAAGTGCCCTTCAGCTTACTGCTGTTGATGGTCGTAGAGCTAATGTTAT

[0074] TGTCCCTAATGACCCTGATTTGATTGATATTTTGGCTATGAATGGTGTTGATATATCA

[0075] GTTTCTGAAGGTGAAGGGGGGAATGGGTTGTTTAGTGTTATTGGGAATTTGTTGTT

[0076] TCCTTTTATTGCTTTTGCTGGATTGTTTTTCCTTTTTAGGAGGTCTCAGGGCGGGCC

[0077] GGGCGGGCCTGGAGGGCTAGGCGGCCCGATGGATTTCGGTCGGTCTAAGTCTAAG

[0078] TTTCAGGAGGTTCCTGAAACTGGAGTGACTTTTGCTGATGTTGCTGGTGCTGATCA

[0079] GGCTAAATTGGAGCTGCAAGAAGTGGTGGATTTTTTAAAGAATCCTGATAAGTATA

[0080] CTGCTTTAGGTGCTAAGATACCAAAAGGGTGTCTTTTGGTCGGTCCACCAGGTACT

[0081] GGGAAGACACTTTTAGCTAGAGCTGTAGCTGGTGAAGCTGGTGTGCCATTTTTCTC

[0082] TTGTGCAGCATCAGAGTTTGTTGAGTTGTTTGTGGGTGTGGGAGCTTCTAGAGTTA

[0083] GGGATTTGTTTGAGAAGGCGAAGTCGAAAGCGCCTTGCATTGTGTTTATCGATGAG

[0084] ATTGATGCTGTAGGAAGGCAGAGAGGTGCAGGACTTGGAGGTGGAAATGATGAGA

[0085] GGGAGCAGACTATTAATCAGCTCTTGACTGAAATGGATGGGTTTTCTGGAAATTCT

[0086] GGTGTTATTGTTTTGGCTGCAACTAATAGGCCTGATGTTCTTGATTCTGCCTTGTTG

[0087] AGACCTGGAAGGTTCGATCGACAAGTGACCGTGGACAGGCCTGATGTTGCTGGTA

[0088] GAGTCAGGATTCTTCAGGTACATTCTAGAGGAAAGGCCCTTGCAAAGGATGTGGA

[0089] CTTTGATAAGATTGCCAGGAGAACTCCAGGTTTCACTGGTGCAGATTTACAAAACT

[0090] TGATGAACGAAGCAGCCATCCTTGCAGCTAGGCGTGACCTAAAGGAAATAAGTAA

[0091] AGATGAGATATCCGATGCTCTGGAGAGGATAATTGCTGGTCCGGAGAAGAAAAAC

[0092] GCTGTTGTCTCAGATGAGAAGAAGAAGCTGGTAGCTTATCATGAGGCTGGCCATGC

[0093] CTTGGTTGGTGCACTTATGCCCGAGTATGATCCTGTTGCCAAGATATCTATAATTCCT

[0094] CGTGGCCAAGCCGGTGGTCTCACCTTCTTTGCCCCCAGCGAAGAAAGACTTGAGT

[0095] CAGGCCTGTACAGCAGGAGCTACCTAGAGAATCAAATGGCAGTTGCACTTGGTGG

[0096] AAGGGTTGCTGAGGAGGTTATTTTTGGAGAAGACAACGTAACCACTGGCGCATCT

[0097] AATGATTTCATGCAAGTTTCACGAGTGGCGAGGCAGATGGTTGAGAGATTAGGTTT

[0098] CAGCAAAAAGATAGGCCAAGTTGCCATCGGAGGAGGTGGAGGAAACCCTTTCCTA

[0099] GGCCAACAGATGTCAACCCAGAAGGACTACTCCATGGCGACAGCCGATGTAGTCG

[0100] ATTCTGAAGTAAGGGAATTGGTTGAAAAGCATACGAAAGAGCTAAACAAATCAT

[0101] CACAACTCACATCGACATCCTACACAAGCTTGCGCAGCTGCTGATAGAGAAAGAA

[0102] ACTGTTGATGGTGAAGAGTTCATGAGCCTTTTCATTGATGGCAAGGCTGAGCTATA

[0103] CATTTCATGA

[0104] >SEQ ID NO:2

[0105] ATGGCTAAATCTCTACTCTCTTCCAATTTTATGGGTTCTTCTCAAATCTTTCTTTCTC

[0106] CACCAACACCCAAAACCTCAAAGTACTTCAATTTCCACTCAAAAAGAAAGTGTAT

[0107] AATCACACAATCAACACTCAACAAAAAACCCAACTCAGATAATTTCAAGAATGCT

[0108] CAATCTAAAGCTGCTTTAGCTGCTTTACTGTTTTCTTCAATAACCCCACATGCCATT

[0109] GCTCTTGATGATGCAGCTCCAATAGCCTCACCCCCACAAGTGATGGAAGTTGAAGC

[0110] ACCAAACCCCAAC

[0111] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of pepper CaFtsH1 metalloproteinase gene in pepper leaf development at seedling stage, characterized by: The pepper CaFtsH1 gene is shown in SEQ ID NO.

1.

2. Application of pepper CaFtsH1 metalloproteinase gene in pepper leaf development at seedling stage, characterized by: The specific fragment selected by VIGS is shown in SEQ ID NO:2.

Images