Rye resistance genes to stripe rust and their application
By cloning and overexpressing the stripe rust resistance gene SECCE1Rv1G0003760 from rye, the problem of insufficient resistance in wheat varieties was solved, the disease resistance and genetic diversity of wheat were improved, and its adaptability to pests, diseases and climate change was enhanced.
Patent Information
- Application Number
- CN202311079619.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-25
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2043-08-25
AI Technical Summary
Existing wheat varieties are not resistant enough to stripe rust, resulting in severe yield losses. Furthermore, modern breeding has led to a reduction in genetic diversity, making it difficult to cope with pests, diseases, and climate change.
Using hybridization and gene mapping techniques, the stripe rust resistance gene SECCE1Rv1G0003760 was cloned from rye and introduced into wheat using an overexpression vector to improve wheat's disease resistance.
It significantly improved wheat's resistance to stripe rust, enhanced its growth advantage under pests, diseases, and climate change, and provided new genetic improvement resources.
Smart Images

Figure BDA0004413855940000081 
Figure BDA0004413855940000082 
Figure BDA0004413855940000101
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant genetic engineering, and relates to a rye SECCE1Rv1G0003760 anti-stripe rust gene and application thereof. BACKGROUND
[0002] Wheat (Triticum aestivum L.) is one of the most important food crops in China, and its yield maintenance and improvement is an important guarantee for national food security. Wheat stripe rust is a common disease in wheat production, which is caused by Puccinia striiformis Westend. f. sp. Tritici. The most obvious feature of stripe rust is the production of obvious yellow or orange spores on the leaves, which are generally arranged in rows along the leaf veins. 88% of the world's wheat production areas are susceptible to stripe rust, and the annual yield loss caused by stripe rust is 5 million tons, with an economic loss of 1 billion US dollars (see reference: Colin, R, Wellings. Global status of stripe rust: a review of historical and current threats. Euphytica. 2011, 179: 129-141). China is one of the largest areas of stripe rust epidemic in the world, and since the founding of the country, there have been four major epidemics in 1950, 1964, 1990 and 2002, resulting in a yield loss of about 13 billion kilograms (see reference: Wan A, Zhao Z, Chen X, et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f. sp. tritici in China in 2002. Plant Disease, 2004, 88: 896-904). Therefore, the breeding of stripe rust resistant wheat varieties and the mining and utilization of disease resistance genes are of great significance to ensure national food security.
[0003] Modern breeding with high yield as the goal has greatly weakened the genetic diversity of crops. The loss of genetic diversity not only limits the further improvement of yield and quality, but also makes crops difficult to cope with global climate change and the prevalence of pests and diseases. Wheat relatives contain many excellent genes, which are important genetic resources for genetic improvement of common wheat. Therefore, introducing beneficial genes from wheat relatives into common wheat is one of the important and effective ways to improve wheat varieties.
[0004] Rye (Secale cereale L.), a annual or perennial herbaceous crop of the family Poaceae, is one of the wild relatives of wheat. Rye is a diploid species with a genome of RR. Rye has excellent traits that common wheat lacks, and is an important wild germplasm resource for genetic improvement of common wheat. Triticale is a new species artificially synthesized by intergeneric sexual hybridization and polyploidy of species of Triticum and Secale. It combines the high yield and quality of wheat with the disease resistance, cold resistance and high lysine content of rye, has a huge hybrid growth advantage, and can be used for feed, wine making, bioenergy and food. Triticale is mainly of two types, hexaploid (AABBRR) and octoploid (AABBDDRR), which are obtained by crossing diploid rye with different ploid wheat and doubling. The two triticale parents L20191212 and 4100 used in this paper are both hexaploid triticale. There is no literature report on the sequence and molecular marker of the stripe rust resistance gene in triticale L20191212. SUMMARY
[0005] The present application is inoculated with Puccinia striiformis f. sp. CYR32-34, and it is found that two triticale parents L20191212 and 4100 show near-immunity and high susceptibility, respectively. The two triticale parents are crossed to obtain F1, and then selfed to obtain F2 population. Inoculation identification is performed on 389 single plants in the F2 population, and it is found that 301 plants are resistant to disease and 88 plants are highly susceptible. 40 plants with extreme resistance and 40 plants with extreme susceptibility are selected from the F2 population to form a resistance pool and a susceptibility pool, respectively, and total RNA is extracted from the leaves for sequencing. BSR (Bulk segregant RNA sequencing) analysis shows that the resistance gene to stripe rust is located on the 1R chromosome of Secale cereale. Using the resequencing data of the two parents, 14 co-dominant Indel markers are developed on the 1R chromosome, and gene mapping is performed using the F2 consisting of 389 single plants, which further locates the resistance gene to stripe rust in a 10 Mb interval (corresponding to the Lo7 reference genome 1R: 6.5-16.5 Mb). Subsequent analysis of all genes in the interval finds that there is an R gene cluster in the interval, which contains five typical CC-NBS-LRR type R genes (SECCE1Rv1G0003730-SECCE1Rv1G0003770). Combined with the transcriptome data of the resistance pool and the susceptibility pool, it is found that two genes (SECCE1Rv1G0003760 and SECCE1Rv1G0003770) are specifically expressed in the resistance pool and lowly expressed or not expressed in the susceptibility pool, so SECCE1Rv1G0003760 and SECCE1Rv1G0003770 are determined as candidate genes. Using the reference genome sequence of Secale cereale (https: / / ftp.ebi.ac.uk / ensemblgenomes / pub / release-56 / plants / fasta / secale_cereale / dna / ), the sequences of SECCE1Rv1G0003760 and SECCE1Rv1G0003770 in L20191212 are cloned. To verify the function of SECCE1Rv1G0003760 and SECCE1Rv1G0003770, overexpression vectors of SECCE1Rv1G0003760 and SECCE1Rv1G0003770 are used for genetic transformation of susceptible stripe rust wheat as a recipient material, and the transgenic results show that overexpression of SECCE1Rv1G0003760 can improve the resistance of wheat to stripe rust, and a specific molecular marker 1R3760-1 is developed, which shows that SECCE1Rv1G0003760 is a resistance gene to stripe rust.
[0006] Specifically, the present application provides the following technical solutions:
[0007] In one aspect, the present application provides an anti-stripe rust gene, characterized in that the nucleotide sequence of the anti-stripe rust gene is as shown in SEQ ID NO: 2 or has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as shown in SEQ ID NO: 2.
[0008] In another aspect, the present application provides an expression vector, characterized in that the expression vector comprises the anti-stripe rust gene as described above.
[0009] In another aspect, the present application provides a host cell, characterized in that the host cell comprises the anti-stripe rust gene or the expression vector as described above.
[0010] In another aspect, the present application provides a method for detecting the presence or absence of an anti-stripe rust gene in a plant to be tested, characterized in that the method comprises detecting the presence of the anti-stripe rust gene according to claim 1 or a specific molecular marker thereof, preferably the sequence of the specific molecular marker is as shown in SEQ ID NO: 3, preferably detecting the presence of the sequence of SEQ ID NO: 3 using primers as shown in SEQ ID NO: 4 and SEQ ID NO: 5.
[0011] In another aspect, the present application provides a method for improving the ability of a plant to resist stripe rust, comprising introducing the anti-stripe rust gene or the expression vector or the host cell as described above into the plant or cells of the plant.
[0012] In another aspect, the present application provides a method for breeding a plant resistant to stripe rust, comprising introducing the anti-stripe rust gene or the expression vector or the host cell as described above into the plant or cells of the plant.
[0013] In another aspect, the present application provides the use of the anti-stripe rust gene or the expression vector or the host cell as described above in improving the ability of a plant to resist stripe rust or breeding a plant resistant to stripe rust.
[0014] In another aspect, the present application provides a method for obtaining a plant cell or a plant carrying an anti-stripe rust gene, characterized in that the method comprises introducing the anti-stripe rust gene or the expression vector or the host cell as described above into the plant cell or the plant.
[0015] In another aspect, the present application provides a molecular marker for detecting the presence or absence of an anti-stripe rust gene in a plant to be tested, characterized in that the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 3.
[0016] In some embodiments, the plant is wheat or rye.
[0017] In some embodiments, the stripe rust is caused by physiological race CYR32, CYR33 and / or CYR 34.
[0018] Definitions
[0019] GISH: Genomic in situ hybridization, which is developed on the basis of fluorescence in situ hybridization. This technique uses total genomic DNA from one species as a marker probe, and total genomic DNA from another species at an appropriate concentration for blocking, and in situ hybridization is performed on the target chromosomes. Between the blocking DNA and the marker DNA probe, the blocking DNA preferentially hybridizes to or non-specific sequences, and the remaining specific sequences are mainly hybridized to the marker probe, and finally the chromosomes or chromosome fragments of different origins are detected.
[0020] Inoculation identification: healthy young triticale seedlings are cultured in the greenhouse, inoculated by artificial spore scattering of stripe rust, and the plants are made to be diseased by humidification and light culture, etc. to identify the resistance of the material to stripe rust.
[0021] Near-immune and highly susceptible: According to the resistance degree of wheat varieties to stripe rust, the disease resistance of wheat varieties can be divided into six levels: immune, highly resistant, resistant, moderately resistant, moderately susceptible and highly susceptible. Immune is that no visible spore pile is produced on the leaf. Near-immune is that small dead spots appear on the leaf, and no spore pile is produced. Highly susceptible is that large and many spore piles are produced on the leaf, and the surrounding is not de-greened.
[0022] Extremely resistant and extremely susceptible: Mendelian analysis is mainly used to study disease resistance, that is, resistant and susceptible plants are crossed, and the segregation of the offspring is analyzed. In the F2 segregation population, the most resistant material is the extremely resistant material, and the most susceptible material is the extremely susceptible material.
[0023] BSR: Bulked Segregant RNA-Seq, a fast method for target trait gene positioning using mixed pool of extreme individuals. In the segregation population, the RNA of the extreme trait offspring is mixed in equal amount, the mixed "gene pool" and the parent are sequenced respectively, the frequency (Allele Frequency, AF) of the sequencing data of different libraries at the polymorphic site (SNP) is calculated, and the correlation with the target phenotype is calculated, so as to realize the positioning of the target trait related genes or the development of linkage molecular markers.
[0024] Codominant marker: a genetic marker that can detect both dominant and recessive alleles and can distinguish between homozygous and heterozygous genotypes.
[0025] Indel marker: insertion-deletion (InDel) refers to the insertion or deletion of nucleotide fragments of different sizes in the same site of the genome between closely related species or different individuals of the same species, i.e. the insertion or deletion of one or more bases at a certain site on a sequence compared with another homologous sequence. InDel polymorphism molecular marker is a marker based on the sequence of the two sides of the insertion / deletion site designed for PCR amplification, which is still a length polymorphism marker and can be typed by a convenient electrophoresis platform.
[0026] Ubiqutin promoter: the Ubiquitin (UBQ or Ubi for short) gene promoter as a constitutive promoter shows a significantly higher gene expression level in most tissues and many types of cells in plants, especially in monocotyledonous plants (such as corn), which has high activity and is often used to drive overexpression of a certain gene.
[0027] Specific molecular marker: a specific molecular marker is developed based on functional single nucleotide polymorphism (SNP) or insertion and deletion (InDels) site in gene sequence, which has the advantages of high selection efficiency, co-dominance, co-segregation with target gene, and not affected by genetic background.
[0028] Genome resequencing: a method for sequencing genomes of different individuals of a species whose genome sequence is known. It is used to analyze the differences between different individual genomes, such as finding single nucleotide polymorphism sites, insertion and deletion sites, structural variation sites and copy number variation sites, etc.
[0029] 1BL / 1RS translocation system: refers to the wheat-rye translocation chromosome formed by translocation of the short arm of 1R chromosome of rye to the long arm of 1B chromosome of wheat. Because the short arm of 1R contains genes for resistance to wheat leaf rust, stem rust, stripe rust and powdery mildew, germplasm containing 1BL / 1RS has been widely used in wheat breeding around the world. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1Rust resistance identification and GISH identification of the chromosome composition of hexaploid triticale L20191212. a The figure is the rust identification of hexaploid triticale L20191212 and 4100, and Mingxian 169 (Mingxian 169) was used as a susceptible control. The mixed material of three physiological races CYR32, CYR33 and CYR34 was inoculated at the one-leaf-one-heart stage, and the phenotype was counted 14 days after inoculation. The results showed that L20191212 was nearly immune to stripe rust, and 4100 was highly susceptible to stripe rust. b and c are GISH analysis of triticale L20191212 and 4100, respectively, with rye genome as probe (green). The GISH results showed that L20191212 and 4100 were both hexaploid triticale.
[0031] Figure 2 Rust identification results of hexaploid triticale L20191212 and 4100 F2. F2 plants were inoculated with a mixture of three physiological races CYR32, CYR33 and CYR34 at the one-leaf-one-heart stage, and the phenotype was counted 14 days after inoculation. 1, Mingxian 169; 2, L20191212; 3, 4100; 4-6, F2 resistant plants. 7-9, F2 susceptible plants. The results showed that there was a separation of resistance in the F2 population, and the difference between F2 resistant single plants and F2 susceptible single plants was obvious.
[0032] Figure 3 The comparison results of resistant pool and susceptible pool transcriptome data are shown. It was found that 2 genes (SECCE1Rv1G0003760 and SECCE1Rv1G0003770) were specifically expressed in the resistant pool, while lowly expressed or not expressed in the susceptible pool.
[0033] Figure 4The amplification results of the specific molecular marker 1R3760-1 for SECCE1Rv1G0003760 in triticale and common wheat, the first row is the amplification results of 1R3760-1, and the second row is the amplification results of the reference gene Tubilin. From left to right are Marker, 6 common wheat (Yannong 19, Zhongdan, Fielder, Shanong 19, Shanong 20 and Shanong 122), 3 1BL / 1RS translocation lines (dwarf resistant 58, Kenong 199, and Nongda 399), 18 hexaploid triticale (4100, Rozovskaya-7, L20191212, PI 542533, PI 542560, PI 552974, PI 559373, PI 590946, PI 610226, CIXT33, PI 511870, PI 587384, PI 542563, PI 610224, PI 610227, PI 628658, PI 610225, CIXT101). The amplification results of Tubilin primer show that the quality of the DNA used in the application is reliable, and the amplification results of 1R3760-1 show that SECCE1Rv1G0003760 cannot be detected in 6 common wheat, can be detected in 3 1BL / 1RS translocation lines, and can be detected in 8 triticale, and cannot be detected in 10 triticale. The results show that SECCE1Rv1G0003760 does not exist in common wheat, exists in 1BL / 1RS translocation lines and triticale.
[0034] Figure 5 The results of the resistance to stripe rust of transgenic positive plants are shown. A mixture of three physiological races CYR32, CYR33 and CYR34 is inoculated at the one-leaf-one-heart stage, and the phenotype is counted 14 days after inoculation. The inoculation results show that the SECCE1Rv1G0003760 transgenic positive material is nearly immune to stripe rust, and the SECCE1Rv1G0003770 transgenic positive material is highly susceptible to stripe rust, proving that SECCE1Rv1G0003760 is a stripe rust resistance gene, and SECCE1Rv1G0003770 is not a stripe rust resistance gene. DETAILED DESCRIPTION
[0035] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with specific examples and with reference to the drawings.
[0036] Example 1 Identification of rye stripe rust resistance gene
[0037] The inventors used a mixed inoculation of physiological races CYR32, CYR33, and CYR34 of wheat stripe rust (the inoculation method refers to the powdering method in section 3.3, "Propagation and Preservation of Wheat Stripe Rust," of the national standard NY / T 1443.1-2007. In practice, the leaves are covered with a mixture of white talcum powder and spores; the inoculation effect is judged by the disease incidence of the susceptible control material). Identification (using the stripe rust identification platform of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) revealed that two triticale parents, L20191212 (provided by Professor Li Xingfeng of Shandong Agricultural University) and 4100 (provided by Professor Ni Zhongfu of China Agricultural University), showed near-immunity and high susceptibility to the three mixed physiological races CYR32, CYR33, and CYR34, respectively. To clone the stripe rust resistance gene in L20191212, the two triticale parents were crossed to obtain F1, and self-crossed to obtain the F2 population. Inoculation and identification were performed on 389 individual plants in the F2 population, revealing 301 resistant and 88 highly susceptible plants. From the F2 population, 40 extremely resistant plants and 40 extremely susceptible plants were selected to form a resistance pool and a susceptible pool, respectively. Total RNA was extracted from leaves for transcriptome sequencing (performed at Annoroad Gene Technology Co., Ltd.). BSR (Bulk segregant RNA sequencing) analysis revealed that the stripe rust resistance gene is located on rye chromosome 1R. Using genome resequencing data from two parents at a 10x sequencing depth, 14 co-dominant Indel markers were developed on chromosome 1R. Fine mapping was performed using an F2 population of 389 individual plants (the F2 offspring obtained after crossing the two parents; this was the population used for gene mapping, with a resistance:susceptibility ratio of 3:1). This further mapped the stripe rust resistance gene to a 10Mb interval (corresponding to Lo7 reference genome 1R: 6.5-16.5Mb). Subsequent analysis of all genes within the interval revealed an R gene cluster containing five typical CC-NBS-LRR type R genes (SECCE1Rv1G0003730-SECCE1Rv1G0003770). Combined with transcriptome data from the anti-inflammatory and susceptible pools, two genes (SECCE1Rv1G0003760 and SECCE1Rv1G0003770) were found to be specifically expressed in the anti-inflammatory pool, while showing low expression or no expression in the susceptible pool. Figure 3 Therefore, SECCE1Rv1G0003760 and SECCE1Rv1G0003770 were identified as candidate genes. Using the rye reference genome sequence (https: / / ftp.ebi.ac.uk / ensemblgenomes / pub / release-56 / plants / fasta / secale_cere ale / dna / ), the sequences SECCE1Rv1G0003760 and SECCE1Rv1G0003770 from L20191212 were cloned.
[0038] Table 1 is the statistical result of L20191212 and 4100F2 population stripe rust identification. A total of 389 strains were inoculated, 301 strains were resistant, 88 strains were highly susceptible, basically in accordance with the 3:1 separation ratio.
[0039]
[0040] Example 2 Detection of rye stripe rust resistance genes
[0041] The genomic DNA of the plant material to be tested was amplified by PCR using the molecular marker 1R3760-1 primer, and materials that could amplify a 1772bp material were all materials containing SECCE1Rv1G0003760.
[0042] 1R3760-1 primer F: 5'-GAATCCAGGGTGGGATCGTG-3' (SEQ ID NO: 4);
[0043] 1R3760-1 primer R: 5'-TGCCAGTAAAGGTGGTCTCA-3' (SEQ ID NO: 5).
[0044] The F primer is located in the promoter region of the gene, and the R primer is located at the front of the CDS region
[0045] Table 2 PCR system
[0046]
[0047] PCR reaction program: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute, running for 35 cycles; finally 72°C extension for 10 minutes. The PCR amplification product can be stored at 4°C.
[0048] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1xTAE.
[0049] Example 3 Functional identification of rye stripe rust resistance genes
[0050] The overexpression vectors of SECCE1Rv1G0003760 and SECCE1Rv1G0003770 were constructed using Ubiqutin promoter. First, the wheat transgenic vector pWMB110 (provided by Professor Ye Xingguo of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences) was linearized using restriction enzymes kpnI and SacI, SECCE1Rv1G0003760 and SECCE1Rv1G0003770 CDS were amplified using primers with recombination adapters, the above PCR products and linearized vectors were recovered using a Tengen universal DNA purification recovery kit, and the linearized vector and the amplified gene fragment were connected using a Tengen EasyGeno recombination cloning kit. Genetic transformation was performed on a wheat variety Yannong 19 with high susceptibility to stripe rust (transformation method according to Chinese patent ZL201710422896.6). The SECCE1Rv1G0003760 transgenic positive plants had increased resistance to stripe rust compared with the control, which indicated that the SECCE1Rv1G0003760 gene from rye could confer wheat stripe rust resistance.
[0051] Table 3 pWMB110 vector linearization system
[0052] Drug Volume (ul) Manufacturer Size CutSmart Buffer 5 NEW ENGLAND 1.25ml kpnI 1 NEW ENGLAND 0.4ml SacI 1 NEW ENGLAND 0.1ml pWMB110 plasmid 10 250 ng / ul ddH2O 33 Total 50
[0053] 37°C for 3 hours.
[0054] The gene CDS was amplified using recombination primers as described above, and the primers used were as follows:
[0055] 3760-110-F: GGTCGACTCTAGAGGATCCCCGGGTACCGAATGGATATTGTCACGGGTGC (SEQ ID NO: 6)
[0056] 3760-110-R: TGAACGATCGGGGAAATTCGAGCTCTCAGATCTCCTCGTCCTCGC (SEQ ID NO: 7)
[0057] 3770-110-F: GGTCGACTCTAGAGGATCCCCGGGTACCGAATGGATATTGTCACGGGTGC (SEQ ID NO: 8)
[0058] 3770-110-R: TGAACGATCGGGGAAATTCGAGCTCTCAGTTCTCCTCACACAAAT (SEQ ID NO: 9)
[0059] PCR products and linearized vectors were purified and recovered according to the steps of the general DNA purification and recovery kit (TIANGEN, product number: DP214-03).
[0060] The gene fragment was connected to the linearized pWMB110 vector by a recombination method, and the specific steps were performed according to the EasyGeno recombination cloning kit (TIANGEN, product number: VI201-02).
[0061] Table 4 Statistics of stripe rust inoculation of transgenic plants
[0062]
[0063] The disease-resistant parent L20191212 was nearly immune to stripe rust, while the disease-susceptible parent 4100 was highly susceptible to stripe rust. The transgenic receptor material Yannong 19 and the SECCE1Rv1G0003770 transgenic material were nearly highly susceptible to stripe rust, while the SECCE1Rv1G0003760 transgenic positive material was nearly immune to stripe rust, indicating that SECCE1Rv1G0003760 was a stripe rust resistance gene.
[0064] Sequence
[0065] SEQ ID NO: 1 CDS sequence of the rye Lo7 reference genome gene SECCE1Rv1G0003760 (2889 bp):
[0066] ATGGATATTGTCACGGGTGCCATTGCCAAGCTGATCCCCAAGCTGGGAGAACTGCTTGTAGGGGAGTACAAGCTGCACAAGGGCGTCAGGAAAAATATCGAGGACCTCCTGAAAGAGCTCAACACCATGAACGCTGCGCTCATCAAGATTGGTGAGGTGCCGCCGGACCAGCTCGACAGCCAAGACAAGCTTTGGGGCGATGAGGTCAGAGAGCTCTCCTACGTCATTGAGGATGTGGTGGACAAGTTCCTCGTACGGGTCCATGGCATTGAGCCCGACGACAACACCAACGGATTCAAGGGGCTCGTCAAGAGGACCACCAAGTTGTTGAAGAAGGTCGTGGATAAGCATGGGATAGCTCACGCGATCAAGGACATCAAGAAGGAACTCCATGAGGTGGCTGCTAGGCGTGACAGGAACAAGTTCGATGGTATTGCTTCTACTCCTACTGAAGCAATCGA
[0067] TCCTCGTCTTCATGCTCTGTACATAGAAGCCGCAGAGCTAGTTGGCAT
[0068] CTATGGGAAGAGGGATCAGGCACTCATGAGTTTGCTCTCCTTGGAGG
[0069] GCGATGATGCCTCTACCAAGAAACTGAAGAAGGTCTCCATTGTTGGA
[0070] TTTGGAGGGTTGGGCAAGACCACTCTTGCCAGAGCAGTATACGAGA
[0071] AGATTAAAGGTGATTTTGGTTGCCACGCATTTGTTCCTGTCGGGCAG
[0072] AACCCTGATATCAAGAAGGTTTTCAGGGATATCCTCATTGACCTCCGA
[0073] AAATCAAACTCAGATCCTAGCAACTCTAACTCAGATCTTGTGATACT
[0074] GGATGCAACACAGCTTATCGACAAGCTTCGTGAATTCCTTGAGAACA
[0075] AGAGGTACCTCGTAATAATTGATGATATATGGGATGAAAAATTGTGGA
[0076] GATACATCAACCTTGCTTTCTCTATCAATAACAATCTAGGAAGTCGGC
[0077] TAATCACCACAACCCGAGATTTCGATGTCTCCAAATCATGCTGCTCAT
[0078] CAGCTGATGATTCAATTTATCATATGAAACCTCTTTGTACCAATGACT
[0079] CCAGAAGGCTCTTCTATAAAAGAGTATTTGCCGACGCTAGTGGATGT
[0080] CCAAGTGAATTTGAACAAGTGTCTAAAGATATATTGAAGAAATGTGG
[0081] CGGGGTACCACTAGCCATCATTACTATTGCAAGTGCTTTGGCTAGTGG
[0082] CCAGCAAGTGAAACCAAAGCATGAGTGGGATATTCTACTCCAGTCCC
[0083] TTGGCTCCGGAGTAACAAAAGATAATAGTTTGGCTGAGATGCGGAGA
[0084] ATACTATCTTTCAGCTATTATAATCTACCGTCTCATCTGAAAACTTGTC
[0085] TACTTTACCTATGTATATATCCAGAAGATAGCACCATTGGTAGAGATAG
[0086] ACTGATATGGAAGTGGGTGGCCGAAGGATTTGTCCACCATGGAGATC
[0087] AAGGGACCAGCCTGTTTTTGGTCGGATTAAACTACTTCAACCAGCTC
[0088] ATTAATAGAAGTATGATCCAGCCTATATATGATAATGCAGGCCAGGTAT
[0089] ATGCTTGCCGTGTACATGATATGGTTCTGGACCTTATCTGCAACTTGT
[0090] CACATGAAGCAAAGTTTGTTAATCTATTGGATGCCACTGGGAATAGC
[0091] ACATCTTCACAAAGTAATGTTCGTCGTTTGTCCCTTCAGAATAAAAAT
[0092] GAAGATCATCAAGCCAAGCCTCTCACAAATATCATGAGTATGTCACG
[0093] AGTGAGGTCCATTACTATCTTTCCACCTGCTGTTAGTATCATGCCAAG
[0094] TCTGTCAATGTTTGAAGTTCTGAGTGTACTTGATCTGTCGAACTGTGA
[0095] TTTGGGACAAAGTAGCAGCCTGCAGCTTAACCTAAAGGGTGTTGTAC
[0096] ATTTAATCCACCTAAGGTACCTTGGTCTAGCAGGCACTCAAATTAGTG
[0097] AACTCCCGACTGAGATAGGAAACCTGCAGTTTTTGGAGGTGTTGGAT
[0098] CTTGGAGATAATTATGAGCTAGATGAATTGCCTTCCACTCTTTTCAAA
[0099] TTGAGAAGATTAATCTACCTAAATGTTTATCTCTTTAAGGTGGTTCCA
[0100] ACTCCTGGTGTGTTGCAGAATCTGACATGCATAGAAGTGTTGAGGGG
[0101] GATCTTGGTCTCTCTGAACATTATTGCACAAGAGCTTGGCAACCTGG
[0102] CAAGGCTGAGGGAGCTTTCGATTCGCTTCAAGGATGGTAGTTTGGAT
[0103] TTGTATGAAGGTTTCGTGAATTCTCTGTGCAACCTACATCACATAGAA
[0104] TGCCTAAGTATTGGTTGGAATTCTGAAAAAACGTCTTTTGAACTGAT
[0105] GGATCTCTTGGGAGAACGCTGGGTGCCTCCTGTACATCTCCGCGAAT
[0106] TTGTGTCTAGGATGCCCAGCCAACTCTCTGCACTGCGAGGGTGGACA
[0107] AAGAGAGACCCCTCGCATCTCTCCAACCTCTCCAAGTTAATCCTCTC
[0108] GTCAGTGAAGGAAGTGCAGCAGGAGGACGTGGAAATCATTGGGGG
[0109] GTTGCTGTCCCTTCGCCGTCTCTGGATAAAGAGCACCCACCAAACAC
[0110] AGCGGCTGCTAGTCATCCCTACAGATGGGTTCCGCTGTATGGTAGAAT
[0111] TTTACTTGAATTGTGGGTTAGCAGCGCAGATAATGTTTGAACCAGGA
[0112] GCTTTGCCGAGGGCGGAAGAAGTTACGTTCAGCCTGGGCGTGCGGG
[0113] TGGCAAAAGAGGATGGAAACTGTGGCTTCGAATTGGGCGTGCAGGG
[0114] GAACCTGCTCTCCCTTCGGCGGCAGGTCTGGGTTAGGATGTATTGTG
[0115] GTGGAGTGAGGGTTGGGGAGGCAAAGAAAGCGGAGGCTGCGGTGA
[0116] GGCACGCACTCGAAGCCCATCCCAATCATCCCAGGATTTATATTGATA
[0117] TGTGCCCGCGTATAGCAGAAGATGCTCATGATGACGATTTGTGCGAG
[0118] GACGAGGAGATCTGA
[0119] SEQ ID NO: 2 CDS sequence of SECCE1Rv1 G0003760 in hexaploid triticale L20191212 (2889 bp):
[0120] ATGGATATTGTCACGGGTGCCATTGCCAAGCTGATCCCCAAGCTGGGAGAACTGCTTGTAGGGGAGTACAAGCTGCACAAGGGCGTCAGGAAAAATATCGAGGACCTCCTGAAAGAGCTCAACACCATGAACGCTGCGCTCATCAAGATTGGTGAGGTGCCGCCGGACCAGCTCGACAGCCAAGACAAGCTTTGGGGCGATGAGGTCAGAGAGCTCTCCTACGTCATTGAGGATGTGGTGGACAAGTTCCTCGTACGGGTCCATGGCATTGAGCC
[0121] CGACGACAACACCAACGGATTCAAGGGGCTCGTCAAGAGGACCACC
[0122] AAGTTGTTGAAGAAGGTCGTGGATAAGCATGGGATAGCTCACGCGAT
[0123] CAAGGACATCAAGAAGGAACTCCATGAGGTGGCTGCTAGGCGTGAC
[0124] AGGAACAAGTTCGATGGTATTGCTTCTACTCCTACTGAAGCAATCGA
[0125] TCCTCGTCTTCATGCTCTGTACATAGAAGCCGCAGAGCTAGTTGGCAT
[0126] CTATGGGAAGAGGGATCAGGCACTCATGAGTTTGCTCTCCTTGGAGG
[0127] GCGATGATGCCTCTACCAAGAAACTGAAGAAGGTCTCCATTGTTGGA
[0128] TTTGGAGGGTTGGGCAAGACCACTCTTGCCAGAGCAGTATACGAGA
[0129] AGATTAAAGGTGATTTTGGTTGCCACGCATTTGTTCCTGTCGGGCAG
[0130] AACCCTGATATCAAGAAGGTTTTCAGGGATATCCTCATTGACCTCCGA
[0131] AAATCAAACTCAGATCCTAGCAACTCTAACTCAGATCTTGTGATACT
[0132] GGATGCAACACAGCTTATCGACAAGCTTCGTGAATTCCTTGAGAACA
[0133] AGAGGTACCTCGTAATAATTGATGATATATGGGATGAAAAATTGTGGA
[0134] GATACATCAACCTTGCTTTCTCTATCAATAACAATCTAGGAAGTCGGC
[0135] TAATCACCACAACCCGAGATTTCGATGTCTCCAAATCATGCTGCTCAT
[0136] CAGCTGATGATTCAATTTATCATATGAAACCTCTTTGTACCAATGACT
[0137] CCAGAAGGCTCTTCTATAAAAGAGTATTTGCCGACGCTAGTGGATGT
[0138] CCAAGTGAATTTGAACAAGTGTCTAAAGATATATTGAAGAAATGTGG
[0139] CGGGGTACCACTAGCCATCATTACTATTGCAAGTGCTTTGGCTAGTGG
[0140] CCAGCAAGTGAAACCAAAGCATGAGTGGGATATTCTACTCCAGTCCC
[0141] TTGGCTCCGGAGTAACAAAAGATAATAGTTTGGCTGAGATGCGGAGA
[0142] ATACTATCTTTCAGCTATTATAATCTACCGTCTCATCTGAAAACTTGTC
[0143] TACTTTACCTATGTATATATCCAGAAGATAGCACCATTGGTAGAGATAG
[0144] ACTGATATGGAAGTGGGTGGCCGAAGGATTTGTCCACCATGGAGATC
[0145] AAGGGACCAGCCTGTTTTTGGTCGGATTAAACTACTTCAACCAGCTC
[0146] ATTAATAGAAGTATGATCCAGCCTATATATGATAATGCAGGCCAGGTAT
[0147] ATGCTTGCCGTGTACATGATATGGTTCTGGACCTTATCTGCAACTTGT
[0148] CACATGAAGCAAAGTTTGTTAATCTATTGGATGCCACTGGGAATAGC
[0149] ACATCTTCACAAAGTAATGTTCGTCGTTTGTCCCTTCAGAATAAAAAT
[0150] GAAGATCATCAAGCCAAGCCTCTCACAAATATCATGAGTATGTCACG
[0151] AGTGAGGTCCATTACTATCTTTCCACCTGCTGTTAGTATCATGCCAAG
[0152] TCTGTCAATGTTTGAAGTTCTGAGTGTACTTGATCTGTCGAACTGTGA
[0153] TTTGGGACAAAGTAGCAGCCTGCAGCTTAACCTAAAGGGTGTTGTAC
[0154] ATTTAATCCACCTAAGGTACCTTGGTCTAGCAGGCACTCAAATTAGTG
[0155] AACTCCCGACTGAGATAGGAAACCTGCAGTTTTTGGAGGTGTTGGAT
[0156] CTTGGAGATAATTATGAGCTAGATGAATTGCCTTCCACTCTTTTCAAA
[0157] TTGAGAAGATTAATCTACCTAAATGTTTATCTCTTTAAGGTGGTTCCA
[0158] ACTCCTGGTGTGTTGCAGAATCTGACATGCATAGAAGTGTTGAGGGG
[0159] GATCTTGGTCTCTCTGAACATTATTGCACAAGAGCTTGGCAACCTGG
[0160] CAAGGCTGAGGGAGCTTTCGATTCGCTTCAAGGATGGTAGTTTGGAT
[0161] TTGTATGAAGGTTTCGTGAATTCTCTGTGCAACCTACATCACATAGAA
[0162] TGCCTAAGTATTGGTTGGAATTCTGAAAAAACGTCTTTTGAACTGAT
[0163] GGATCTCTTGGGAGAACGCTGGGTGCCTCCTGTACATCTCCGCGAAT
[0164] TTGTGTCTAG GATGCCCAGC CAACTCTCTG CACTGCGAGG GTGGACA
[0165] AAGAGAGACC CCTCGCATC TCTCCAACC TCTCCAAGT TAATCCTCTC
[0166] GTCAGTGAAG GAAGTGCAGC AGGAGGACGT GGAAATCATT GGGGG
[0167] GTTGCTGTCC CTTCGCCGTCTCTGGATAA AGAGCACCCA CCAAACAC
[0168] AGCGGCTGCT AGTCATCCCT ACAGATGGGT TCCGCTGTAT GGTAGAAT
[0169] TTTACTTGAATTGTGGGTTAGCAGCGCAGATAATGTTTGAACCAGGA
[0170] GCTTTGCCGA GGGCGGAAGA AGTTACGTTC AGCCTGGGCG TGCGGG
[0171] TGGCAAAAGA GGATGGAAAC TGTGGCTTCG AATTGGGCGT GCAGGG
[0172] GAACCTGCTC CCTTCGGCGG CAGGTCTGGG TTAGGATGTATTGTG
[0173] GTGGAGTGAG GGTTGGGGAG GCAAAGAAAG CGAGGCTGCG GTGA
[0174] GGCACGCACT CGAAGCCCAT CCCAATCATC CCAGGATTTATATTGATA
[0175] TGTGCCCGCG TATAGCAGAAGATGCTCATGATGACGATTTGTGCGAG
[0176] GACGAGGAGA TCTGA
[0177] SEQ ID NO:3 1R3760-1 amplified sequence:
[0178] GAATCCAGGGTGGGATCGTGGGGCTCTGTATCTATCTAGTTTAGAGTACTATTGTACTTCCTCTGCTCCTCGTCTCCGCTTCCTCTCAGTCTCCTCCATTGATTTGCGTTGGTTGAACAGAGAGCACGATGCATCGAAGGC
[0179] ACTGACCCGACTAGCGGCCTGGTAAAAATTTCCCTCCCATCTTTCTTG
[0180] CTATTCTCTTCTTATTAATCTGCTGATTTGCTAGATTGTAAGTTCTTATT
[0181] ACTTATTCTTCCAGATCGAGTGAAGCAACCTCCGCTGCCGTGTTGTC
[0182] CCCTACGACGCAGTTGTGTCCTGCTCTTCTGGTGAAGCATCAACGGT
[0183] GATGGCCATCCGGTGTTGATGCCGCCGCTGTGTGCTGCTCTGCCGTG
[0184] AAGTATCAAAGGTGGGTTTGGATGGATATCGCAGTTTGGATTGGCAA
[0185] CTCAGTTCTAGAGCTCGTTGAAATTAAAGCGTCACACTGTTTGGATT
[0186] GGATTACAGCTACAGCTCCCCATATTCATCTATTTTGTAGGTTTCCGGT
[0187] TATTATTCAGAGCAACACGCTCACGGATCTGGCCTCTGGTGCCCAGC
[0188] CGCCACTTCCGCTTTGTTGTCCCCACAGCGCGACCATCCGACGAAGA
[0189] CGCCGCCGTTGTGTTCTGCTCTACTGTGAAGCACCAAAGGTGGGCTT
[0190] GGTCCAGATCCCTACATTCATCGATTTGGCTTGGCAACTCTGTTCTAG
[0191] AGCTTGGATTGTGTTACAGATCCCTACATTCATCGATTTGCAGGTTTC
[0192] CAGCTGATTGATCCAGAGGGCTCTCATGGATATTGTCACGGGTGCCA
[0193] TTGCCAAGCTGATCCCCAAGCTGGGAGAACTGCTTGTAGGGGAGTA
[0194] CAAGCTGCACAAGGGCGTCAGGAAAAATATCGAGGACCTCCTGAAA
[0195] GAGCTCAACACCATGAACGCTGCGCTCATCAAGATTGGTGAGGTGC
[0196] CGCCGGACCAGCTCGACAGCCAAGACAAGCTTTGGGGCGATGAGGT
[0197] CAGAGAGCTCTCCTACGTCATTGAGGATGTGGTGGACAAGTTCCTCG
[0198] TACGGGTCCATGGCATTGAGCCCGACGACAACACCAACGGATTCAA
[0199] GGGGCTCGTCAAGAGGACCACCAAGTTGTTGAAGAAGGTCGTGGAT
[0200] AAGCATGGGATAGCTCACGCGATCAAGGACATCAAGAAGGAACTCC
[0201] ATGAGGTGGCTGCTAGGCGTGACAGGAACAAGTTCGATGGTATTGCT
[0202] TCTACTCCTACTGAAGCAATCGATCCTCGTCTTCATGCTCTGTACATA
[0203] GAAGCCGCAGAGCTAGTTGGCATCTATGGGAAGAGGGATCAGGCAC
[0204] TCATGAGTTTGCTCTCCTTGGAGGGCGATGATGCCTCTACCAAGAAA
[0205] CTGAAGAAGGTCTCCATTGTTGGATTTGGAGGGTTGGGCAAGACCA
[0206] CTCTTGCCAGAGCAGTATACGAGAAGATTAAAGGTGATTTTGGTTGC
[0207] CACGCATTTGTTCCTGTCGGGCAGAACCCTGATATCAAGAAGGTTTT
[0208] CAGGGATATCCTCATTGACCTCCGAAAATCAAACTCAGATCCTAGCA
[0209] ACTCTAACTCAGATCTTGTGATACTGGATGCAACACAGCTTATCGAC
[0210] AAGCTTCGTGAATTCCTTGAGAACAAGAGGTATGCATCACTTACAGC
[0211] AAAATTGTGCACTATTATGACATGATTATTTCATATGCTAGTTGTACAA
[0212] GTAATACCGAAAGTGTCTAAACATATTGTAGCGGGAGGGTTCAGAAT
[0213] AATTTTTCCATTGAGACCACCTTTACTGGCA
[0214] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only for specific embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.
Claims
1. A method of increasing the ability of wheat or rye to resist stripe rust or of breeding wheat or rye that resists stripe rust, characterized in that, The method comprises introducing an anti-stripe rust gene into the wheat or rye, the nucleotide sequence of the anti-stripe rust gene being shown as SEQ ID NO:
2.
2. A method of increasing the ability of wheat or rye to resist stripe rust or of breeding wheat or rye that resists stripe rust, characterized in that, The method comprises introducing an expression vector into the wheat or rye, the expression vector comprising an anti-stripe rust gene shown as SEQ ID NO:
2.
3. A method of increasing the ability of wheat or rye to resist stripe rust or of breeding wheat or rye that resists stripe rust, characterized in that, The method comprises introducing a host cell into the wheat or rye, the host cell comprising an anti-stripe rust gene shown as SEQ ID NO:
2.
4. A method for detecting the presence or absence of a resistance to stripe rust gene in a wheat or rye to be tested, characterized in that, The method comprises detecting the presence of a specific molecular marker shown as SEQ ID NO: 3, and if the specific molecular marker shown as SEQ ID NO: 3 exists in the wheat or rye to be tested, it is determined that the wheat or rye to be tested is capable of resisting stripe rust.
5. The method according to any one of claims 1 to 4, characterized in that, The stripe rust is caused by physiological races CYR32, CYR33 and / or CYR 34.
6. Use of the anti-stripe rust gene defined in claim 1 or the expression vector defined in claim 2 or the host cell defined in claim 3 in improving the ability of wheat or rye to resist stripe rust or in cultivating wheat or rye that is resistant to stripe rust.
7. Use according to claim 6, characterized in that, The stripe rust is caused by physiological races CYR32, CYR33 and / or CYR 34.
Citation Information
Patent Citations
Application of wheat TaWox5 gene to improvement of wheat conversion efficiency
CN108997484A