A vector for modifying protease genes and its applications

Abstract

The present invention relates to the field of biotechnology, and particularly relates to a vector for knocking out protease genes and its application. By designing a transient silencing fragment of protease SBT6.1, a TRV2::SBT 6.1 vector was constructed using homologous recombination technology. The TRV2::SBT6.1 vector was injected into the leaves of Nicotiana benthamiana at the two-week-old stage by Agrobacterium to obtain plants with high expression levels of foreign proteins. It was found that after transient silencing of protease SBT 6.1, the expression level of the foreign target protein increased significantly, achieving the purpose of improving the Nicotiana benthamiana bioreactor, and having great application value in production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a vector for transforming a protease gene and application thereof. Background Art

[0002] Transgenic plant bioreactors are production systems that utilize genetic engineering techniques to produce medical proteins such as vaccines and antibodies, as well as other biological agents, using plant cells, tissues, or whole plants. The use of plants as bioreactors to produce medical protein products, diagnostic reagents, or functional foods has garnered widespread attention in the biopharmaceutical field and has become a hot topic in current medical and life science research. Transgenic plants as bioreactors for producing pathogen antigens have many advantages. First, this system offers low production costs, simplified vaccine production, ease of large-scale production, and convenient refrigerated transportation. Second, plant expression systems closely resemble those used in animals in the folding and assembly of exogenous proteins, resulting in similar biological activity and immunogenicity to products expressed in animal cells. Third, this protein processing method utilizes only soil, air, and water, making it environmentally friendly, safe, and environmentally friendly, offering significant advantages in the context of energy conservation and emission reduction. Fourth, plants are resistant to digestion by gastrointestinal enzymes, making oral administration simple. Therefore, transgenic plants offer a new strategy for developing safe and affordable proteins for animal or human use, with broad application prospects and opportunities.

[0003] Proteases are ubiquitous in all organisms. The plant genome encodes hundreds of proteases, which are widely involved in the growth and development of plants, as well as in the response of plants to environmental or growth stimuli. Exogenous proteins, as foreign substances, are often targeted by plant proteases, resulting in partial or complete hydrolysis of the exogenous proteins, thereby reducing the expression level of the exogenous proteins. Chinese patent CN202210079560.5 A method for improving the expression level of recombinant proteins in endosperm bioreactors, using storage gluten mutant (LGC-1) hybridization and gene editing (TALEN technology and CripsrCas9) technology to knock out endogenous storage protein genes, reduce the content of endogenous storage proteins, alleviate endoplasmic reticulum stress, and improve the transport efficiency of recombinant proteins in endosperm cells, thereby increasing the expression of recombinant proteins in endosperm cells. Chinese patent CN202310033597.9 The application of Trichinella spiralis serine protease inhibitors in transgenic plant bioreactors, by providing a soybean plant that effectively expresses Trichinella spiralis antigens to achieve the application of Trichinella spiralis antigens in transgenic plant bioreactors.

[0004] Nicotiana benthamiana is a commonly used plant bioreactor, primarily used for transient expression of exogenous proteins. It boasts advantages such as high conversion efficiency and the ability to carry large target gene fragments. Nicotiana benthamiana is also widely used in vaccine production and drug development. Currently, there are no methods for genetically engineering the gene encoding a protease in Nicotiana benthamiana to increase the expression of exogenous proteins.

[0005] Summary of the Invention

[0006] The technical problem to be solved by the present invention is that Nicotiana benthamiana is a commonly used plant bioreactor, primarily used for transient expression of exogenous proteins. It has advantages such as high conversion efficiency and the ability to carry target genes with larger target fragments. Currently, there are no methods for knocking out (knockdown) genes encoding proteases in Nicotiana benthamiana using genetic engineering techniques to increase the expression of exogenous proteins in Nicotiana benthamiana.

[0007] To address these issues, the present invention provides a vector for modifying protease genes. By designing a transient silencing fragment for the protease SBT6.1 gene, the TRV2::SBT 6.1 vector was constructed using homologous recombination technology. The TRV2::SBT6.1 vector was then injected into two-week-old Nicotiana benthamiana leaves using Agrobacterium tumefaciens to produce plants with high expression of exogenous proteins. Transient silencing of the protease SBT6.1 gene significantly increased the expression of the exogenous target protein, achieving the goal of improving Nicotiana benthamiana bioreactors and possessing significant application value in production.

[0008] To achieve the above objectives, the present invention is implemented by the following technical means: a protease gene-modified vector is designed by designing a protease SBT6.1 transient silencing fragment, the sequence of which is shown in SEQ ID NO.1, and a TRV2::SBT 6.1 vector is constructed using homologous recombination technology.

[0009] SEQ ID NO.1:

[0010] ACTGAGAGATGATGTCATTAATTCAGGTCTAAGTGTAGTTGTATTTGCTGACTGGTACAATGTGGACACAATGGTAAAAATGAGGTTCTTTGATGACAATACACGTAGCTGGTGGACTCCGGTCACTGGAGGTGCCAATATTCCTGCCTT AAATGATCTTTTGGCATCCTTTGGGATTGCATTTGGGAATAAAATTCTGAATGGTGATTTTGTCCTCAACGGTGAACAGAGTCGGTATGCATCTGGAGCTGATATTCTGAAGTTCCCAAGAGGTGGATACTTGCACAGCTTCCCCTTCAT.

[0011] Furthermore, the primers used to construct the vector are as follows: SBT6.1

[0012] F:AAGGTTACCGAATTCACTGAGAGATGATGT; SBT6.1

[0013] R:GAGACGGCTGAGCTCCATGAAGGGGAAGCT.

[0014] Furthermore, the above-mentioned vector was used to increase the expression of exogenous proteins in Nicotiana benthamiana. Agrobacterium was used to inject the TRV2::SBT 6.1 vector into 2-week-old Nicotiana benthamiana leaves to construct plants, thereby achieving high expression of exogenous proteins.

[0015] The application of the above-mentioned vector in preparing Nicotiana benthamiana with high expression of exogenous protein.

[0016] Furthermore, the amino acid sequence of the knocked-out protease SBT6.1 of the present invention is shown in SEQ ID NO.2.

[0017] SEQ ID NO.2:

[0018]

[0019] Furthermore, the nucleic acid sequence encoding the protease SBT6.1 in Nicotiana benthamiana is shown in SEQ ID NO.3.

[0020] SEQ ID NO.3:

[0021]

[0022] The present invention has the following beneficial effects:

[0023] The present invention discovered for the first time that the SBT6.1 protease in Nicotiana benthamiana affects the expression of exogenous target proteins to a certain extent. By designing a transient silencing fragment of the protease SBT6.1, it was confirmed that after transient silencing, the expression level of the exogenous target protein was significantly increased, achieving the purpose of improving the Nicotiana benthamiana bioreactor and having significant application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Green fluorescent protein images of TRV2::S08.063 and TRV2::GUS;

[0025] Figure 2 is the relative expression level of the target genes of TRV2::S08.063 and TRV2::GUS;

[0026] Figure 3 Figure 2 is a graph of protein expression levels of TRV2::S08.063 and TRV2::GUS;

[0027] Here, TRV2::S08.063 represents the same gene as TRV2::SBT 6.1 in the examples. DETAILED DESCRIPTION

[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0029] Example 1:

[0030] A protease gene-modified vector is used to design a protease SBT6.1 transient silencing fragment using VIGS TOOL, and a TRV2::SBT 6.1 vector is constructed using homologous recombination technology.

[0031] The method for increasing the expression of exogenous proteins in Nicotiana benthamiana using the above-mentioned vectors involved designing a transient silencing fragment of SBT6.1 and constructing the TRV2::SBT6.1 vector using homologous recombination. A TRV2::GUS vector was also constructed as a control. Two-week-old Nicotiana benthamiana leaves were co-injected with TRV2::SBT6.1 and TRV1 using Agrobacterium tumefaciens as the experimental treatment (T), while TRV2::GUS and TRV1 were co-injected as the control (CK). Fifteen days later, both T and CK plants were injected with TRBO::GFP Agrobacterium. Three days later, the leaves were photographed and sampled.

[0032] Designing silence segments:

[0033] Design and transient silencing fragments: Based on the sequence of the target gene, a fragment that can silence SBT6.1 was designed using VIGS TOOL.

[0034] Through the VIGS TOOL (https: / / vigs.solgenomics.net / ) in the Solanaceae Genome Database website, the database was selected as Nicotiana abenthamana v1.0.1, the N-MER size was set to 21, the fragment length was set to 300, and the misalignment was set to 0.

[0035] After entering the SBT6.1 gene sequence into the sequence box and running the analysis, the target gene parameter was set to 1. This yielded a 300bp sequence and the target gene sequence. The target gene sequence was then aligned with the SBT6.1 sequence to confirm that the 300bp sequence designed by the website targeted SBT6.1.

[0036] The obtained 300bp sequence is: ACTGAGAGATGATGTCATTAATTCAGGTCTAAGTGTAGTTGTA TTTGCTGACTGGTACAATGTGGACACAATGGTAAAAATGAGGTTCTTTGATGACAATACACGTAGCTGGTGGACTCCGGTCACTGGAGGTGCCAATATTCCTGCCTTAAATGATCTTTTGGCATCCTT TGGGATTGCATTTGGGAATAAAATTCTGAATGGTGATTTTGTCCTCAACGGTGAACAGAGTCGGTATGCATCTGGAGCTGATATTCTGAAGTTCCCAAGAGGTGGATACTTGCACAGCTTCCCCTTCAT

[0037] Construction of vector:

[0038] Preparation of DNA fragments required for vector construction

[0039] The transient silencing fragments required for vector construction were obtained by PCR, and the restriction enzyme sites required for cloning at both ends were introduced by PCR primers. The primers used were as follows: F: AAGGTTACCGAATTCACTGAGAGATGATGT; R: GAGACGCGTGAGCTCCATGAAGGGGAAGCT.

[0040] To amplify the transient silencing fragment of SBT6.1, PCR was performed using Nicotiana benthamiana cDNA as a template with primer pairs SBT1.9 F and SBT1.9 R. PCR was performed using SupRealQ Ultra Hunter SYBR qPCR Master Mix (Q713-02, Nanjing Novozymes) according to the manufacturer's instructions.

[0041] The TRV2 vector was double-digested using the restriction sites EcoR1 and Sac1, and the transient silencing fragment was ligated into the TRV2 vector to construct the vector TRV2::SBT6.1.

[0042] After the vector TRV2::SBT6.1 was transformed into competent E. coli (E. coli DH5α), single clones were selected for colony PCR, and positive single clones were selected for testing. After comparison, colonies with correct sequences were selected to extract plasmids.

[0043] After the correct plasmid is transformed into Agrobacterium competent cells (GV3101), single clones are selected for colony PCR, and positive single clones are selected for testing. After comparison, colonies with correct sequences are selected for shaking.

[0044] Agrobacterium TRV2::SBT6.1 and Agrobacterium TRV1 were co-injected into 2-week-old Nicotiana benthamiana leaves at a ratio of 1:1. TRV2::GUS was used as a control, and TRBO::GFP Agrobacterium was injected 15 days later. The leaves were photographed 3 days later and samples were taken for further testing.

[0045] Detection of GFP green fluorescent protein expression:

[0046] RNA extraction: RNA extraction kit (Congwei Century, CW0581M) was used to extract sample RNA according to the kit instructions.

[0047] cDNA preparation, using a reverse transcription kit (Novozyme, R333-01) to complete the genome cleanup and reverse transcription of RNA, according to the instructions in the kit

[0048] Samples were analyzed by qRT-qPCR, and gene expression was measured using a fluorescence quantitative assay kit (Novozymes, Q711-02). The expression levels were compared with those of the control TRV2::GUS. Quantitative primers: Actin (F: CGGAATCCACGAGACTACAT AC; R: GGGAAGCCAAGATAGAGC); SBT6.1 (F: GCCGAGGTGGAGTTGGATTT; R: CGGTTTG AGGAGGTTAGGGG). The procedure was performed according to the kit instructions.

[0049] Prepare 10 ml of protein extraction solution: 500 μl of 1 M Tris HCl (pH: 8.0), 500 μl of 2.5 M NaCl (pH: 8.0), 200 μl of EDTA (pH: 8.0), 1 ml of glycerol, 200 μl of 100 mM PMSF, and 7.6 ml of ddH2O.

[0050] Extract total protein from the sample by grinding the sample and adding an equal volume of protein extraction buffer (10 mL). Place on ice for 30 minutes, shaking the centrifuge tube up and down every 5 minutes. Set the centrifuge speed to 12,000 rpm, temperature to 4°C, and time for 10 minutes. After centrifugation, aspirate the supernatant. Add 5× SDS PAGE protein loading buffer (solarbio P1040) to the supernatant in appropriate proportions and incubate at 95°C in a metal bath for 10 minutes. Store the sample at -20°C until ready for use.

[0051] A 12.5% ​​PAGE gel was prepared using a PAGE gel rapid preparation kit (Yazyme PG113) according to the instructions in the kit.

[0052] Using the prepared PAGE gel, spot the samples from step 12 into the PAGE gel wells in order. Pour Running Buffer (Yazyme PS120) into the electrophoresis pool, set the voltage to 180V, and run for 60 minutes. Stain with Coomassie Brilliant Blue, destain with water, and visualize the bands. Adjust the protein loading to a consistent amount.

[0053] According to the electrophoresis steps, the expression level of GFP green fluorescent protein was detected by Wesernt Blot technology.

[0054] result:

[0055] like Figure 1 As shown in the figure, the brightness of GFP green fluorescent protein on TRV2::SBT6.1 is higher than that of GFP green fluorescent protein on TRV2::GUS. This proves that transient silencing of SBT6.1 increases the expression of GFP green fluorescent protein.

[0056] like Figure 2 As shown in Figure 3, the two genes targeted by TRV2::SBT6.1 were significantly downregulated compared to TRV2::GUS, demonstrating that the transient silencing vector TRV2::SBT6.1 reduced the expression of the targeted genes.

[0057] like Figure 3 As shown, the expression level of GFP protein in RV2::SBT6.1 was significantly higher than that in TRV2::GUS, demonstrating that transient silencing of the gene encoding the SBT6.1 protease can increase the expression of the exogenous protein GFP.

[0058] In summary, the SBT6.1 protease in N. benthamiana affects the expression of exogenous target proteins to a certain extent. After transient silencing of the SBT6.1 protease, the expression level of the exogenous target protein increased significantly, achieving the goal of further improving the N. benthamiana bioreactor.

[0059] Finally, it should be noted that while the above examples describe specific embodiments of the present invention, they are not intended to limit the present invention. Those skilled in the art will understand that these are merely illustrative and that the scope of the present invention is defined by the appended claims. All modifications or equivalent substitutions are intended to be included within the scope of the present invention. The raw materials in the above examples, unless otherwise specified, were commercially available.

Claims

1. A vector for knocking out a protease gene, characterized in that: A transient silencing fragment of protease SBT6.1 was designed, the sequence of which is shown in SEQ ID NO.1, and a TRV2::SBT 6.1 vector was constructed using homologous recombination technology.

2. A method for increasing the expression of exogenous proteins in Nicotiana benthamiana using the vector according to claim 1, characterized in that: The TRV2::SBT 6.1 vector was injected into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to construct plants, achieving high expression of exogenous proteins.

3. The method according to claim 2, characterized in that: The primers used to construct the vector are as follows: SBT6.1 F:AAGGTTACCGAATTCACTGAGAGATGATGT; SBT6.1 R:GAGACGGCTGAGCTCCATGAAGGGGAAGCT.

4. The method according to claim 2, characterized in that: The amino acid sequence of the knocked-out protease SBT6.1 is shown in SEQ ID NO.

2.

5. The method according to claim 2, characterized in that: The nucleic acid sequence encoding protease SBT6.1 is shown in SEQ ID NO.

3.

6. Use of the vector according to claim 1 in preparing Nicotiana benthamiana with high expression of exogenous protein.

Images