Novel Single-Cell CRISPR Screening Library

By using dual gRNA expression cassettes and optimizing lentiviral system in single-cell CRISPR screening technology, the problem that the existing technology cannot effectively study ncRNA function is solved, and CRISPR screening at the single-cell level is achieved, which expands the screening range and reduces the experimental cost.

CN119506359BActive Publication Date: 2025-06-13INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510081784.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-06-13
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

The existing single-cell CRISPR screening technology cannot effectively study the functions of components such as lncRNA, miRNA and non-coding sequences. Moreover, due to the large size of the virus plasmid, it is difficult to package the virus and has high experimental costs.

Method used

Using the dual gRNA expression cassette, the gRNA expression cassette was inserted into the CROP-seq vector backbone by optimizing the lentiviral system, achieving CRISPR screening at the single-cell level, and extending the screening range to ncRNA.

Benefits of technology

CRISPR screening at single-cell level without affecting virus yield can be achieved, and the functions of ncRNAs such as lncRNA and miRNA can be studied, reducing experimental costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119506359B_ABST
    Figure CN119506359B_ABST
Patent Text Reader

Abstract

The present invention discloses a novel single-cell CRISPR screening library. The present invention provides a dual gRNA expression cassette, a dual gRNA expression cassette vector for single-cell CRISPR screening, and a method for constructing a single-cell CRISPR screening library. The CRISPR screening library constructed by using this method can expand the single-cell CRISPR screening scope from protein-coding genes to ncRNAs, and can achieve the knockout of ncRNAs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene screening. Specifically, the present invention relates to a method for constructing a novel single-cell CRISPR screening library. Background Art

[0002] The CRISPR screening technology refers to introducing a large number of gRNAs and recombinant Cas9 protein of Streptococcus pyogenes into cells, and then determining specific gene manipulation results through genome sequencing, transcriptome sequencing or single-cell transcriptome sequencing, so as to establish a connection with the phenotype of the cells and thus explore the functions of genes in a high-throughput manner. The specific principle is that the gRNA binds to the recombinant Cas9 protein of Streptococcus pyogenes (~160KD) to form a nucleic acid-protein complex, and the complex is guided to the genome by the gRNA using the principle of sequence complementarity, and then the complementary sequence is excised. After excision, mutations are generated due to non-homologous end joining repair in vivo, resulting in a frameshift of the gene open reading frame, leading to a frameshift mutation in the gene and encoding a non-functional protein, ultimately achieving gene knockout.

[0003] Currently, CRISPR gene screening is the main method for high-throughput studying the roles of genes or other elements in the process of life. However, due to the strong heterogeneity of stem cells, the resolution should be increased to the single-cell level to study the roles of these elements during the fate determination of stem cells. However, the current single-cell CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) screening is based on a single gRNA (guide RNA) system, so it can only knockout protein-coding genes and cannot study the roles of elements such as lncRNA (long non-coding RNA) and non-coding sequences in the process of life.

[0004] Currently, the developed single-cell CRISPR screening methods are mainly CROP-seq (CRISPR Droplet sequencing) and perturb-seq (perturbation sequencing). Both of these methods are gene screening systems mediated by a single gRNA system, which cannot study the functions of elements such as lncRNA, miRNA (microRNA), and non-coding sequences. And the current CRISPRi (CRISPR interference) technology for studying lcnRNA and miRNA still cannot be improved to single-cell precision and cannot achieve gene screening at the single-cell level. Moreover, due to the large size of the viral plasmid, the virus is very difficult to package during the packaging process, resulting in a low virus titer and a high economic cost in the experiment. Therefore, it is of great significance to provide a novel single-cell CRISPR screening technology that can study the functions of elements such as lncRNA, miRNA (microRNA), and non-coding sequences. Summary of the Invention

[0005] To make up for the deficiencies of the prior art, the object of the present invention is to provide a novel single-cell CRISPR screening library for studying the functions of ncRNAs (non-coding RNAs).

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect of the present invention, a dual gRNA expression cassette is provided.

[0008] Further, the dual gRNA expression cassette includes a first gRNA expression cassette and a second gRNA expression cassette.

[0009] Further, the first gRNA expression cassette sequentially includes a macU6 promoter, a gRNA1 placeholder sequence, a new scaffold, and a Terminator in the 5' to 3' direction.

[0010] Further, the second gRNA expression cassette sequentially includes a U6 promoter, a gRNA2 placeholder sequence, a second scaffold, and a Terminator in the 5' to 3' direction.

[0011] Further, the sequence of the macU6 promoter is as shown in SEQ ID No: 1; the sequence of the new scaffold is as shown in SEQ ID No: 2; the sequence of the Terminator is tttttt.

[0012] Further, the sequence of the U6 promoter is as shown in SEQ ID No: 4; the sequence of the second scaffold is as shown in SEQ ID No: 5.

[0013] Further, the promoter sequences of the first gRNA expression cassette and the second gRNA expression cassette are in operable connection with the gRNA placeholder sequences.

[0014] In the present invention, the term "gRNA", also known as "guide RNA", generally refers to an RNA sequence or molecule (or a collection of a set of RNA molecules) that can bind to a Cas protein and help target the Cas protein to a specific position within a target polynucleotide (such as DNA or RNA). The guide RNA can comprise a crRNA segment and a tracrRNA segment. As used herein, the term "crRNA" or "crRNA segment" refers to an RNA molecule or a portion thereof that includes a guide sequence for targeting a polynucleotide, a stem sequence, and optionally a 5' overhang sequence. The term "tracrRNA" or "tracrRNA segment" refers to an RNA molecule or a portion thereof that includes a protein-binding segment (e.g., the protein-binding segment is capable of interacting with a CRISPR-associated protein such as Cas9). The term "guide RNA" also encompasses a single guide RNA (sgRNA), wherein the crRNA fragment and the tracrRNA fragment are located in the same RNA molecule. The term "guide RNA" also collectively includes a group of two or more RNA molecules, wherein the crRNA segment and the tracrRNA segment are located in separate RNA molecules.

[0015] In the present invention, the gRNA placeholder or gRNA placeholder sequence should be understood as a randomly selected gRNA sequence that is intended to be replaced by a pair of gRNA sequences designed according to the gene of interest under study. In addition to the random gRNA sequence, any other random sequence can also be used. There are n sets of dual gRNAs in the dual gRNA expression cassette, and the n sets of dual gRNAs are designed for n different target genes. A pair of gRNAs in a set of dual gRNAs for a target gene are located in the first gRNA expression cassette and the second gRNA expression cassette, respectively.

[0016] In some embodiments, in each gRNA expression cassette, the RNA promoter sequence and the gRNA placeholder sequence are operably linked, which should be understood as such that when a gRNA sequence is introduced into the placeholder according to the present invention, the gRNA sequence is expressed under the control of the RNA promoter sequence.

[0017] In the present invention, the term "promoter" should be understood to refer to a regulatory sequence / element or a control sequence / element that can bind / recruit RNA polymerase and initiate transcription of a sequence downstream or in the 3' direction from the promoter. The promoter can be, for example, constitutively active, or always active or inducible thereon, wherein in the presence of an external stimulus, the promoter is active or inactive. Examples of RNA promoters include h7SK, T7 promoter, or U6 promoter. In a specific embodiment of the present invention, the promoter is the U6 promoter and the macU6 promoter (human U6 promoter).

[0018] In some embodiments, the length of the guide RNA (gRNA) coding sequence is at least 10 nucleotides to 200 nucleotides, more preferably 10 to 50, more preferably 10 to 30, more preferably 15 to 30, more preferably 15 to 25, most preferably 17 to 23, and even more preferably about 20 nucleotides in length.

[0019] The second aspect of the present invention provides a dual gRNA expression cassette vector for single-cell CRISPR screening.

[0020] Furthermore, the vector contains the dual gRNA expression cassette described in the first aspect of the present invention.

[0021] Furthermore, the vector further contains a lentiviral CROP-seq vector backbone with PuroR-P2A-GFP.

[0022] Furthermore, the first gRNA expression cassette is located at the front end of the EF1A sequence of the lentiviral CROP-seq vector backbone; the second gRNA expression cassette is located 155 bp after the WPRE sequence of the lentiviral CROP-seq vector backbone.

[0023] Furthermore, the lentiviral CROP-seq vector backbone with PuroR-P2A-GFP is the LentiCROP-PuroR-P2A-GFP-U6 plasmid.

[0024] In the present invention, in order to expand the single-cell CRISPR screening scope from protein-coding genes to ncRNAs (non-coding RNAs), such as lncRNAs, miRNAs, etc., the applicant modified the lentiviral system based on the CROP-seq vector backbone, optimized the gRNA expression cassette and inserted a new gRNA expression cassette, and achieved single-cell level CRISPR screening without affecting virus production.

[0025] The third aspect of the present invention provides a cell.

[0026] Furthermore, the cell contains the dual gRNA expression cassette described in the first aspect of the present invention or the dual gRNA expression cassette vector described in the second aspect of the present invention.

[0027] In the present invention, there is no particular limitation on the cell, which can be a prokaryotic cell or a eukaryotic cell. For example, but not limited to, various eukaryotic cells or prokaryotic cells commonly used in the art, such as K562 cells, Jurkat cells, HEK293T cells, yeast cells, Escherichia coli cells, etc.

[0028] The fourth aspect of the present invention provides a method for constructing a single-cell CRISPR screening library.

[0029] Further, the method includes: performing lentiviral packaging on the dual gRNA expression cassette vector described in the second aspect of the present invention and infecting target cells.

[0030] Further, the method includes: first splicing the designed and synthesized n pairs of gRNAs into the first gRNA expression cassette and the second gRNA expression cassette described in the first aspect of the present invention, where n is an integer greater than or equal to 1; then assembling the spliced first gRNA expression cassette to the front end of the EF1A sequence of the lentiviral CROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid, and assembling the spliced second gRNA expression cassette to the 155 bp position at the back end of the WPRE sequence of the lentiviral CROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid.

[0031] Further, the MOI for infecting the target cells is 250 - 300.

[0032] Preferably, the method further includes sequencing to detect whether the n pairs of gRNAs are correctly combined into the first gRNA expression cassette and the second gRNA expression cassette.

[0033] Preferably, the method of splicing the gRNA into the gRNA expression cassette is the Gatway method.

[0034] Preferably, the method of assembling the first gRNA expression cassette and the second gRNA expression cassette into the LentiCROP-PuroR-P2A-GFP-U6 plasmid is the Gibson assembly technique.

[0035] In the present invention, the gRNA can be ordered from a commercial platform or designed and synthesized according to research purposes, and the present invention places no restrictions on the source of the gRNA.

[0036] In the present invention, when the applicant performs lentiviral packaging and infects target cells, in order to ensure that one virus enters one cell (i.e., to ensure that only one pair of gRNAs enters one cell), the lentiviral infection conditions are optimized. It is found that when the MOI is 250 - 300, it is possible to package so that only one pair of gRNAs enters one cell, thereby achieving screening at the single-cell level.

[0037] In the present invention, the ‌Gatway method is based on the principle of site-specific recombination, allowing researchers to efficiently and flexibly transfer DNA fragments between different vectors. The core of this method is to utilize the site-specific recombination system of λ phage, especially using the Int integrase and Xis accessory protein to catalyze the recombination of DNA fragments between specific sites (i.e., att sites).

[0038] The Gateway system uses two types of att sites - attB and attP. The attB site is located on the Entry Vector, while the attP site is located on the Destination Vector. Both of these sites contain a specific DNA sequence, which are recognition sites for the Int integrase. In the BP reaction (BP Clonase Reaction), the Int integrase and the Xis accessory protein catalyze the recombination between the attB site and the attP site, generating the attL and attR sites, and transferring the DNA fragment on the Entry Vector to the Destination Vector. This reaction is unidirectional, i.e., it can only go from attB to attL / attR. In the LR reaction (LR Clonase Reaction), the same enzymes catalyze the recombination between the attL site and the attR site, generating the attB and attP sites, and may transfer the DNA fragment from one vector to another. This reaction is also unidirectional, but in the opposite direction to the BP reaction.

[0039] In the present invention, the Gibson assembly technique uses T5 exonuclease to cleave from the 5' end of the DNA fragment, generating single-stranded DNA end pairing to form a gapped circular DNA. The Phusion DNA polymerase fills the gap, generating a circular DNA with only a nick.

[0040] The Taq DNA ligase repairs the nick to obtain a complete double-stranded DNA plasmid.

[0041] The fifth aspect of the present invention provides a library for single-cell sequencing.

[0042] Furthermore, the library is constructed from the cell population obtained by the method described in the fourth aspect of the present invention.

[0043] The sixth aspect of the present invention provides any of the following applications.

[0044] Furthermore, the applications include:

[0045] 1) The application of the dual gRNA expression cassette vector described in the second aspect of the present invention in gene knockout;

[0046] 2) The application of the single-cell CRISPR screening library constructed by the method described in the fourth aspect of the present invention in studying gene function.

[0047] Furthermore, the gene is ncRNA.

[0048] In the present invention, the term "ncRNA", also known as non-coding RNA, refers to RNA molecules that do not encode proteins, and they play important regulatory roles in cells. ncRNA is a class of RNAs that are not translated into proteins, and they directly participate in various biological processes in cells in the form of RNA. There are many types of ncRNA, including miRNA, lncRNA, circRNA, etc., and each type has its specific functions and action mechanisms. ncRNA mainly regulates biological processes such as gene expression, chromatin modification, and transcriptional regulation by interacting with DNA, RNA, or proteins. The expression of many ncRNAs is tissue- and cell type-specific and is closely related to specific physiological and pathological processes. miRNA is a class of short endogenous non-coding RNAs, about 21-25 nucleotides in length. miRNA mainly regulates the expression level of target genes by binding to the 3'UTR region of target mRNA, inhibiting its translation or promoting its degradation, and they play important roles in processes such as cell differentiation, development, metabolism, proliferation, apoptosis, and tumorigenesis. lncRNA is a class of non-coding RNAs with a length exceeding 200 nucleotides. lncRNA participates in various biological processes, such as chromatin modification, transcriptional regulation, and ceRNA regulation, and has a profound impact on gene expression and cell function. They play important roles in the occurrence and development of various diseases, including cancer, cardiovascular diseases, etc. circRNA is a class of non-coding RNAs with a circular structure, and they are formed by a special splicing method. circRNA exists stably in cells and has potential regulatory functions, such as acting as a sponge for miRNA and participating in protein translation.

[0049] Advantages and benefits of the present invention:

[0050] The present invention modifies the lentiviral system based on CROP-seq, optimizes the gRNA expression cassette and inserts a new gRNA expression cassette. Without affecting virus production, single-cell level CRISPR screening is achieved. This method can expand the single-cell CRISPR screening scope from protein-coding genes to lncRNA, miRNA, etc. Description of the drawings

[0051] Figure 1 Schematic diagram of the structure of the first gRNA expression cassette system in the LentiCROP-PuroR-P2A-GFP-U6 plasmid;

[0052] Figure 2 Schematic diagram of the structure of the dual gRNA expression cassette vector provided by the present invention;

[0053] Figure 3 gRNA sequencing distribution map;

[0054] Figure 4 It is the knockout result diagram at the DNA level of the HBBP1 gene;

[0055] Figure 5 It is the knockout result diagram at the RNA level of the HBBP1 gene;

[0056] Figure 6 It is the experimental verification flow chart for verifying the feasibility of single-cell screening by the dual gRNA expression cassette vector provided by the present invention;

[0057] Figure 7 It is the infection result diagram under conventional conditions;

[0058] Figure 8 It is the infection result diagram after the first optimization of conditions;

[0059] Figure 9 It is the infection result diagram after the second optimization of conditions;

[0060] Figure 10 It is the apoptosis detection result diagram after the second optimization of conditions;

[0061] Figure 11 It is the single-cell sequencing result;

[0062] Figure 12 It is the quality control diagram for the knockout effect of the dual gRNA single-cell CRISPR library;

[0063] Figure 13 It is the result diagram of candidate pseudogenes related to the proliferation and apoptosis of hematopoietic stem / progenitor cells. Detailed implementation manners

[0064] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0065] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0066] Example 1 Construction of the first gRNA expression cassette

[0067] I. Experimental materials

[0068] LentiCROP-PuroR-P2A-GFP-U6 (Zhuangmeng Biotech, China, Plasmid #200029), Gibson seamless ligation kit (Xinhai Gene, China, Cat. No.: D2601), Phanta ultra-high-fidelity enzyme (Novizan, China, P521-d1), px552-U6-gRNA1-U6-gRNA2-CMV-eGFP (Zhuangmeng Biotech, China, #211760), BSMB1 V2 (NEB, USA, R0580).

[0069] II. Experimental methods

[0070] First, primers were designed, and the U6-gRNA1-U6-gRNA2 sequence in the px552-U6-gRNA1-U6-gRNA2-CMV-eGFP plasmid was amplified using PCR technology to obtain the first gRNA expression cassette system. The first gRNA expression cassette system was inserted into the front end of the EF1A sequence in LentiCROP-PuroR-P2A-GFP-U6 using the Gibson seamless ligation kit. The primer sequences used in the experiment are shown below:

[0071] macU6-gRNA1-F: gagggcctatttcccatgagtc (SEQ ID No:5);

[0072] macU6-gRNA1-R: gataaaaaagcaccgactcggtg (SEQ ID No:6);

[0073] U6-gRNA2-F: gagggcctatttcccatgattcc (SEQ ID No:7);

[0074] U6-gRNA2-R: tctagttacgccaagcttaaaaaagca (SEQ ID No:8).

[0075] III. Experimental results

[0076] The sequencing result of inserting the first gRNA expression cassette system into the front end of the EF1A sequence in LentiCROP-PuroR-P2A-GFP-U6 is as Figure 1As shown in the figure. macU6, gRNA#1, new scaffold, and Terminator are sequences inserted after amplification. Among them, the sequence of macU6 is gagggcctatttcccatgagtccttcatatttgcatatacgatgcaagaatgttagagagataattagaattaatttggctataaacataaagatattagtacaaaatattgatgcagaaagtaataatttcttgggtagtttgtaattttaaaattatgttttaaaatggaccatgacatacttgccgtaagtgtaaagtatttctatttcttgcctttatatatcttctggcaagttaccaacaccg (SEQ ID No:1); the sequence of new scaffold is gtttcagagctatgctggaaactgcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID No:2); the sequence of Terminator is tttttt.

[0077] Example 2 Construction of the Dual gRNA Expression Cassette System

[0078] I. Experimental Materials

[0079] Oligo gRNA (commissioned from Yunzhou Biotechnology Co., Ltd.), Gibson seamless ligation kit (Xinhai Gene, China, Cat.No.: D2601), Phanta Ultra-High Fidelity Enzyme (Novizan, China, P521-d1), px552-U6-gRNA1-U6-gRNA2-CMV-eGFP (Zhuangmeng Biotechnology, China, #211760), BSMB1 V2 (NEB, USA, R0580).

[0080] II. Experimental Methods

[0081] Construction of the second gRNA expression cassette: The second gRNA expression cassette contains a U6 promoter, a gRNA2 placeholder sequence, a second scaffold, and a Terminator. The sequence of the U6 promoter is gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccg (SEQ ID No:3); the sequence of the second scaffold is gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID No:4); the sequence of the Terminator is tttttt.

[0082] Using the set of ncRNAs of interest obtained from previous studies, after determining the chromosomes on which the ncRNAs in this set are located in the genome and their 5' start and 3' end positions, the chromosomal positions and 5' positions of these ncRNAs were imported into Cas-Designer (http: / / www.rgenome.net / cas-designer / ) to obtain the full sequences of gRNA1. Subsequently, the chromosomal positions and 3' positions of all ncRNAs were imported into Cas-Designer to obtain the full sequences of gRNA2, which were then synthesized in batches in the form of oligonucleotides (oligos). The full sequences of gRNA1 and gRNA2 were respectively ligated into the gRNA placeholder sequences of the first gRNA expression cassette and the second gRNA expression cassette at specific positions using the Gateway method, and then sequencing was performed to detect whether gRNA1-gRNA2 was correctly assembled into the expression cassette.

[0083] The double gRNA expression cassette system was assembled into LentiCROP - PuroR - P2A - GFP - U6 using Gibson assembly technology. Specifically, the first gRNA expression cassette was assembled in front of the EF1A sequence in LentiCROP - PuroR - P2A - GFP - U6, and the second gRNA expression cassette was assembled into the deleted region of the 3' LTR in LentiCROP - PuroR - P2A - GFP - U6, that is, 155 bp behind the WPRE sequence. The 3' LTR region of the LentiCROP - PuroR - P2A - GFP - U6 plasmid was emptied during construction, and the gRNA expression cassette was inserted. Using the self - integration ability of lentivirus, the gRNA expression cassette would jump to the front of the EF1A position, and the U6 promoter could recruit pol III to encode the gRNA for gene editing. The second gRNA expression cassette in the 3' LTR would be detected by sequencing in the mRNA sequence encoded by pol II recruited by EF1A. Based on this, in this patent, the first gRNA expression cassette was inserted in front of the EF1A sequence, and the second gRNA expression cassette was inserted into the gRNA expression cassette position of the original plasmid. According to the above principle, a pair of gRNAs (gRNA1, gRNA2) for gene editing was expressed. Since gRNA2 could be detected by sequencing, each pair of gRNAs entering the cells could be determined.

[0084] III. Experimental Results

[0085] The fragment with gRNA was inserted into the lentiviral backbone, and finally a first - step lentiviral library consisting of 5.5×10^5 monoclonal colonies was obtained. Using the first - step library as a template, a sequencing library for second - generation sequencing was constructed. The sequencing library was sequenced on an Illumina NovaSeq sequencer using the PE150 sequencing strategy.

[0086] The sequencing results were analyzed and compared: among the 3717 pairs of gRNAs designed, 3710 pairs of gRNAs were identified in the second - generation sequencing (coverage rate was 99.81%). As Figure 3 shown, the abscissa is the Log2 value of the Readcount of a single gRNA on the genome, and the ordinate is the distribution density, that is, the distribution probability of each gRNA Readcount; it can be seen that the gRNAs of the plasmid library are relatively concentrated between 2^6 and 2^10, which indicates that the probability of each pair of gRNAs entering the cells is equal, and the situation where subsequent phenotypes are caused by uneven distribution of gRNA pairs can be excluded.

[0087] Example 3 Verification of the Knockout Efficiency of the Double gRNA Expression Cassette Vector

[0088] I. Experimental Materials

[0089] PEI reagent (China Boao Long, KX010041), 293T cells, K562 cells, electrophoresis apparatus, lentivirus titer ELISA detection kit (China Boao Long, BF06203), qpcr related reagents.

[0090] II. Experimental methods

[0091] A pair of gRNAs was designed for the HBBP1 gene (gRNA1: GGTTAAGGTGAGAAGGCTGG; gRNA2: AGGGTGGGTTGTGACTCCAG). According to the methods of Example 1 and Example 2 above, the gRNAs were inserted into the double gRNA expression cassette vector plasmid. Then the plasmid was transfected into 293T cells to package the virus. Subsequently, the lentivirus titer was detected. The cells were infected with an MOI of 300, and the fragment integrity of the HBBP1 gene in the cells was detected. Primers were designed on both sides of the target gene for PCR to obtain the DNA sequence to determine whether DNA-level knockout was completed. At the same time, RNA was extracted, and after reverse transcription, it was determined whether RNA-level knockout was successful.

[0092] III. Experimental results

[0093] The results of knocking out the HBBP1 gene at the DNA level and RNA level are as Figure 4 and Figure 5 shown. Whether at the DNA level or the RNA level, the fragments of the HBBP1 gene became smaller, indicating that the double gRNA expression cassette vector system we constructed could operate normally to complete gene knockout.

[0094] Example 4 Optimize the infection conditions to ensure that only a pair of gRNAs enters one cell

[0095] I. Experimental materials

[0096] PEI reagent (China Boao Long, KX010041), CD34 cells, centrifuge, polyberene, lentivirus library, puromycin.

[0097] II. Experimental methods and results

[0098] For 684 pseudogenes that were found to possibly participate in the hematopoietic process in previous studies, 3-5 pairs of gRNAs were designed for each pseudogene to achieve knockout of the entire fragment, and then the changes in the transcriptome level of stem cells, as well as the changes in cell expansion ability and differentiation preference, were observed to determine the role of this type of ncRNA in the hematopoietic process. After constructing the double gRNA expression cassette vector to synthesize the CRISPR library using the methods of Example 1 and Example 2, single-cell screening was carried out in human hematopoietic stem / progenitor cells to verify the feasibility of the library.

[0099] Under the condition of informed consent of the volunteers, we obtained umbilical cord blood stem cells from umbilical cord blood, added polybrene to CD34 cells, and then added the lentiviral library 6 hours later to explore and optimize the infection conditions.

[0100] First, we explored the infection results under conventional infection conditions (MOI 30, 5 μg / mL polybrene). The results are as Figure 7 shown. Under conventional infection conditions, the infection ratio is too low. Since the gRNA plasmid carries the GFP protein, the successfully infected cells will carry green fluorescence. As Figure 7 shown, the GFP+ ratio under conventional infection is only 9.6%, and the infection efficiency of the cas9 protein is also very low, only 0.035%. Therefore, the conditions need to be optimized.

[0101] The first optimization of conditions: The low efficiency of conventional infection may be due to the low probability of contact between the virus and suspended cells. Therefore, by centrifuging physically to throw the cells to the bottom and adjusting the MOI to increase the virus amount, the probability of virus infecting cells is increased. Therefore, when infecting, the MOIs of the cas9 virus and the gRNA virus are set to 300 (cas9) and gRNA (150) respectively, while ensuring that the polybrene concentration is 5 μg / mL, and centrifuged at 800 g for 90 min. Among them, the cas9 protein has puromycin resistance, and puromycin at a concentration of 1 mg / mL is used for screening for 12 h. The results are as Figure 8 shown. Although GFP + has not been significantly improved in this experiment, the proportion of cas9 + cells in GFP + cells has increased to 50%.

[0102] The second optimization of infection conditions: The first optimization found that the positive rate of gRNA is lower than that of cas9, indicating that the virus dosage of gRNA is insufficient. And through literature review, it is found that immunosuppressants need to be added during virus infection of stem cells to increase the ability of the virus to integrate into cells. Therefore, immunosuppressant CSH (cyclosporine H) is added on the basis of the first optimization, and the dosage of the gRNA lentivirus is increased. The specific method is as follows: Add polybrene (5 μg / mL) and CSH (working concentration of 15 μM) to the culture medium of CD34 + cells and pre-stimulate for 6 h. After adding the cas9 lentivirus with an MOI of 260 and the gRNA lentivirus with an MOI of 260, centrifuge at 800 g for 90 min at 37 °C. Change the medium 16 h later. After 36 h of changing the medium, screen with puromycin at a concentration of 1 mg / mL for 12 h. The results are as Figure 9 shown. It can be seen that after the second optimization of the infection conditions, the infection efficiency can be significantly improved. Measure the GFP + ratio 72 h after infection, and the infection efficiency is about 40%.

[0103] Cell apoptosis detection: Since excessive infection can lead to cell apoptosis, we performed flow cytometry to determine the cell apoptosis to exclude the possibility of cell apoptosis caused by excessive virus infection, which would affect the subsequent single-cell sequencing detection of molecular phenotypes. Annexin V is a Ca2+-binding protein with a molecular weight of 35-36 kDa. 2+ Annexin V is a phospholipid-dependent binding protein that can bind to PS with high affinity. Annexin V is labeled with fluorescein, and the occurrence of cell apoptosis can be detected using a flow cytometer or a fluorescence microscope. Propidium iodide (PI) is a dye that can bind to DNA. It cannot penetrate the intact cell membrane of normal cells or early apoptotic cells, but in cells in the middle and late stages of apoptosis and dead cells, PI can penetrate the cell membrane and dye the cell nucleus red. Therefore, when Annexin V is used in combination with PI, it can be used to identify living cells, apoptotic cells, and dead cells. The specific steps of the experimental operation are as follows: collect cells, take an appropriate amount of logarithmic growth phase cells and inoculate them in a 6-well plate, collect cells after treatment under corresponding conditions (such as drugs) for corresponding time, and pay attention to combining the supernatant and digested cells (Note: suspended cells can be directly centrifuged); wash cells, wash cells twice with pre-cooled PBS; group, each experiment is divided into unstained group, single-stained Annexin V group, single-stained PI group and PI and Annexin V double-stained group, and the treatment groups are double-stained from low to high; stain, dilute 4× binding buffer to 1× buffer with PBS, aspirate the residual PBS in the centrifuge tube, add 100μL of 1× binding buffer to each tube, blow the cells with a pipette to fully resuspend the cells, and add dye under light-proof conditions; no dye is added to the unstained group, 5μL of Annexin V or PI is added to the single-stained group, and Annexin V is added to the Annexin V and PI double-stained group Add 5 μL of 5% paraformaldehyde and 5 μL of PI, and mix gently with a pipette; incubate at room temperature in the dark for 15 minutes, add 300 μL of 1× binding buffer and mix, then transfer the cell suspension to a 5 mL flow tube in the dark, and detect on a flow cytometer within 1 hour.

[0104] Cell apoptosis detection results: After the cells were infected with the second optimized conditions, cell apoptosis was detected. The results are as follows Figure 10As shown, the upper left quadrant (UL) is (Annexin V- / PI+), which may be cell debris without cell membranes or dead cells caused by other reasons; Q2: the lower left quadrant (LL) is normal (living) cells (Annexin V- / PI-); Q3: the upper right quadrant (UR) is late apoptotic cells (Annexin V+ / PI+); Q4: the lower right quadrant (LR) is early apoptotic cells (Annexin V+ / PI-). According to the results of cell apoptosis, it can be determined that most of the CD34 cells after pro-infection + cells are in the living cell state without apoptosis, indicating that the CD34 cells after the second optimization + are in good condition and the subsequent molecular phenotypes are caused by gene editing. Infect CD34 cells with the infection conditions optimized for the second time. Subsequently, puromycin screening (concentration: 1 μg / mL) was carried out 2 days later, and the medium was changed 12 hours later. Flow sorting was carried out 5 days later to obtain GFP + cells for single-cell sequencing. The results of single-cell sequencing are as Figure 11 shown. The detection effects of gRNAs in the cells of the non-gene editing groups on the 4th and 8th days (two control groups) and the gene editing group on the 8th day were statistically analyzed. The U6-scaffold sequence of the second gRNA expression cassette was amplified by PCR and sequenced again to further detect the gRNA sequence in the cells. The results showed that gRNAs were detected in most cells, indicating that the gRNA lentiviral library could be stably integrated into human hematopoietic stem cells after multiple optimizations. At the same time, it was determined that only one pair of gRNAs entered most cells (since only gRNA2 could be detected by sequencing, so only the corresponding gRNA2 of each pair of gRNAs was detected), indicating that most cell phenotypes were caused by the deletion of a fragment of a single ncRNA (pseudogene); Figure 12 is a quality control chart for the knockout effect of the dual gRNA single-cell CRISPR library. By detecting the positive control group in the cells (78 protein-coding genes are included in the library, and the level can be directly detected by transcriptome sequencing), the RNA expression of these protein-coding genes in the experimental group on the 8th day (+DOX / group treated with doxycycline added, inducing cas9 expression for knockout) was significantly lower than the expression level of these ncRNAs in the control group (-DOX / group not treated with doxycycline added, cas9 not expressed and unable to carry out knockout); Figure 13It is a result diagram related to the proliferation and apoptosis of hematopoietic stem / progenitor cells. The X-axis represents the ratio of the cell frequency of the knockout group on the 8th day to that of the non-knockout group on the 4th day for the same pair of gRNAs, and the Y-axis represents the ratio of the cell frequency of the non-knockout group on the 8th day to that of the non-knockout group on the 4th day for the same pair of gRNAs. Therefore, in the first quadrant, the cell proliferation ability is enhanced after knocking out the ncRNA, and in the third quadrant, the apoptosis situation of the cells after knocking out the ncRNA is shown. Approximately 12 pseudogenes related to the proliferation ability of hematopoietic stem cells and 12 pseudogenes related to the apoptosis of hematopoietic stem cells were obtained in this screening.

[0105] In summary, we found that the vector system constructed using the dual gRNA expression cassette can achieve gene knockout, thus proving that the system can work properly and can also be used for the screening of ncRNAs at the single-cell level.

[0106] The above specific embodiments are only explanations of the present invention, and they do not limit the present invention. Those skilled in the art can make modifications without creative contributions to these embodiments according to needs after reading this specification, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A method for constructing a single-cell CRISPR screening library, characterized in that: The method comprises: firstly, splicing the designed and synthesized n pairs of gRNAs into the first gRNA expression cassette and the second gRNA expression cassette, respectively, wherein n is an integer greater than or equal to 1; the first gRNA expression cassette comprises a macU6 promoter, a gRNA1 placeholder sequence, a new scaffold and a Terminator in sequence from 5' to 3'; the second gRNA expression cassette comprises a U6 promoter, a gRNA2 placeholder sequence, a second scaffold and a Terminator in sequence from 5' to 3'; the method of splicing the n pairs of gRNAs into the first gRNA expression cassette and the second gRNA expression cassette, respectively, is a Gateway method; Then, the spliced ​​first gRNA expression cassette is assembled into the front end of the EF1A sequence of the LentiCROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid, and the spliced ​​second gRNA expression cassette is assembled into the 155bp of the rear end of the WPRE sequence of the LentiCROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid; the method of inserting the first gRNA expression cassette and the second gRNA expression cassette into the CROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid is the Gibson assembly technology; Infect target cells with the assembled expression vector; The sequence of the macU6 promoter is shown in SEQ ID No: 1; the sequence of the new scaffold is shown in SEQ ID No: 2; the sequence of the Terminator is tttttt; The sequence of the U6 promoter is shown in SEQ ID No: 3; the sequence of the second scaffold is shown in SEQ ID No: 4; The promoter sequences of the first gRNA expression cassette and the second gRNA expression cassette are in operable connection with the gRNA placeholder sequence.

2. The method according to claim 1, characterized in that The MOI of the infected target cells is 250-300.

Citation Information

Patent Citations

  • Method for constructing double-sg RNA library and method for applying double-sg RNA library to high-flux functionality screening research

    CN106637421A