Application of Lnc RNA as molecular target in neutron and gamma ray mixed field damage assessment

Abstract

The invention relates to an application of Lnc RNA as a molecular target in neutron and gamma ray mixed field damage assessment, the Lnc RNA is used as the molecular target, and the biological dose of neutron and gamma ray mixed field irradiation can be determined by evaluating the expression level of the Lnc RNA and assessing neutron and gamma ray mixed field damage.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to the application of Lnc RNA as a molecular target in the damage assessment of neutron and gamma ray mixed field. Background Art

[0002] In response to large-scale radiation emergencies, changes in gene expression after ionizing radiation exposure is a convenient, rapid and high-throughput means of estimating radiation biodose. It has been reported that after ionizing radiation, the expression levels of different candidate genes are regulated in a dose- and time-dependent manner. Through identification by microarray or quantitative real-time polymerase chain reaction (qRTPCR) in whole blood, isolated lymphocytes and T cells, it was found that after irradiation, some genes may change their expression levels due to radiation exposure. Such radiation-induced changes in gene expression can be used as biomarkers of human radiation exposure and can be used as biodosimeters to monitor radiation exposure in the population.

[0003] At present, most biological dosimeters are mainly used for estimating the dose of photon (gamma ray and X-ray) radiation, while there are few studies on biological dosimeters for neutron radiation or even neutron and gamma mixed irradiation. However, large-scale radiation emergency accidents inevitably involve neutron components or neutron and gamma mixed irradiation. Therefore, it is necessary to assess the irradiation damage and estimate the relevant doses of irradiation. Summary of the invention

[0004] The purpose of the present invention is to overcome the defects in the prior art and provide an application of Lnc RNA as a molecular target in the assessment of neutron and gamma-ray mixed field damage, which can assess neutron and gamma-ray mixed field damage and the biological dose of neutron and gamma-ray mixed field irradiation.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] The application of lnc RNA as a molecular target in the preparation of neutron and gamma ray mixed field damage detection products or the preparation of neutron and gamma mixed irradiation biological dosimeters.

[0007] As a further technical solution, Lnc RNA includes one or more of gene ENST00000579481, gene ENST00000517790, gene ENST00000635405, and gene ENST00000518528.

[0008] A primer set for detecting the expression level of the Lnc RNA, comprising one or more of a primer set of gene ENST00000579481, a primer set of gene ENST00000517790, a primer set of gene ENST00000635405, and a primer set of gene ENST00000518528; wherein,

[0009] In the primer set for gene ENST00000579481, the nucleotide sequence of the forward primer is shown in SEN ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.2;

[0010] In the primer set for gene ENST00000517790, the nucleotide sequence of the forward primer is shown in SEN ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.4;

[0011] In the primer set of gene ENST00000635405, the nucleotide sequence of the forward primer is shown in SEN ID NO.5, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.6;

[0012] In the primer set of gene ENST00000635405, the nucleotide sequence of the forward primer is shown in SEN ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.8.

[0013] A kit for detecting the expression level of the Lnc RNA, characterized in that it comprises one or more of the primer set of the gene ENST00000579481, the primer set of the gene ENST00000517790, the primer set of the gene ENST00000635405, and the primer set of the gene ENST00000518528.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention screened and verified the common differential lncRNAs of neutron, gamma ray and neutron-gamma mixed field irradiation through whole transcriptome sequencing technology, and finally determined ENST00000635405, ENST00000579481, ENST00000517790 and ENST00000518528 as molecular targets of radiation damage of neutron and gamma ray mixed field for application in the preparation of neutron and gamma ray mixed field damage detection products or the preparation of neutron and gamma mixed irradiation biological dosimeters. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the Venn diagram of differentially expressed LncRNAs irradiated with different rays in Example 1;

[0017] Figure 2 GO enrichment map of differentially LncRNA-regulated target genes predicted in the subgroups in Example 1;

[0018] Figure 3 This is the GO enrichment map of the differentially LncRNA-regulated target genes predicted in the γ-irradiation group in Example 1;

[0019] Figure 4 This is the GO enrichment map of the differentially LncRNA predicted regulatory target genes in the neutron-γ mixed irradiation group in Example 1;

[0020] Figure 5 This is the KEGG analysis diagram of the differentially LncRNA-regulated target genes in the subgroups in Example 1;

[0021] Figure 6 This is a KEGG analysis diagram of differentially LncRNA predicted regulated target genes in the γ-irradiation group in Example 1;

[0022] Figure 7 This is a KEGG analysis diagram of differentially LncRNA predicted regulatory target genes in the neutron-γ mixed irradiation group in Example 1;

[0023] Figure 8 This is a diagram showing the expression levels of LncRNA in peripheral blood at different radiation exposures in Example 1;

[0024] exist Figure 8 n=3; *P<0.05, **P<0.01 compared with the control group;

[0025] Fig. 9 Example 2 252 LncRNA expression after Cf irradiation;

[0026] exist Fig. 9 n=3; compared with the 0 Gy group, *P<0.05; **P<0.05. DETAILED DESCRIPTION

[0027] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Example 1: Analysis of differentially expressed genes after exposure to different radiation

[0029] 1 Experimental methods

[0030] 1.1 Peripheral blood collection and cell culture

[0031] 20 ml of peripheral blood was collected from 3 healthy adult males (labeled as 1, 2, and 3) and placed in 4 5 ml EDTAK2 anticoagulation vacuum blood collection tubes. The subjects were aged 20-30 years old, had no chronic disease, no smoking history, and no history of radiation and viral infection in the 6 months before the study.

[0032] 1.2 Irradiation and grouping

[0033] The neutron source was produced by the HINEG-I high-intensity deuterium-deuterium neutron source scientific facility of the Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, with an irradiation energy of 2.5 MeV, a dose rate of 1 Gy / h, and absorbed doses of 0.71 and 1.42 Gy, respectively; the gamma rays were produced by the Biobeam 137 Cs irradiator (Beijing Tongfang Company), the gamma ray dose rate was 3.352Gy / min, and the absorbed doses were 0.71 and 1.42Gy, respectively. Control group: human peripheral blood was not irradiated; neutron irradiation group: human peripheral blood was irradiated with 1.42Gy neutrons; neutron-gamma mixed irradiation group: human peripheral blood was first irradiated with 0.71Gy neutrons and then irradiated with 0.71Gy gamma rays; gamma irradiation group: human peripheral blood was irradiated with 1.42Gy gamma rays.

[0034] 1.3 Whole transcriptome sequencing

[0035] Total RNA of lymphocytes isolated from human peripheral blood was extracted, and ribosomal RNA in total RNA was digested using the TruSeq Stranded Total RNA with Ribo-Zero Gold kit. RNA was sheared into short fragments and reverse transcribed to generate cDNA. After purification of cDNA, end repair, A-tailing, and sequencing adapters were performed, and then fragment size selection was performed, and finally PCR amplification was performed; the constructed library was sequenced after quality inspection using Agilent 2100 Bioanalyzer.

[0036] 1.4 Bioinformatics analysis

[0037] The transcriptome data obtained by sequencing were quality controlled by fastqc software, and the sequencing data were filtered and clean reads were obtained by trimmomatic software. The clean reads were aligned to the reference genome by HISAT2 software, and the reads were assembled by Stringtie software. After the clean reads were aligned to the transcription template by Bowtie2 software, the transcripts were quantified by eXpress software to obtain the FPKM value and counts of mRNA. The estimate SizeFactors function and nbinom Test function were used for standardization and significance test to obtain the p-value and foldchange value. The difference screening conditions in this study were p-value < 0.05 and foldchange > 2 or foldchange < 0.5. GO functional annotation analysis was performed on the http: / / www.geneontology.org website and KEGG signaling pathway analysis was performed on the https: / / www.genome.jp / kegg website.

[0038] 1.5 Real-time fluorescence quantitative PCR detection: Real-time fluorescence quantitative PCR (RT-PCR) was used to analyze the expression changes of different LncRNAs. The reaction conditions were 95℃10s; 95℃5s, 60℃20s (40 cycles). The ΔΔCt method was used for relative quantitative analysis of the LncRNA expression levels of each gene. The primer sequences of each gene are shown in Table 1;

[0039] Table 1 LncRNA primer design sequence list

[0040] Gene Forward primer (5'-3') Reverse primer (5'-3') ENST00000519481 TCTCCCCTTTGAGCTGCTTG AGGTGTAACAGGATTCTCTCCAA ENST00000517790 TTTCAGCACTCTGGACGGAC CAGGGTGCCCACACTCTTAAT ENST00000635405 CAAAGAAGGAGGCGGGAACT TTCCCCTTACGGAGGCTACA ENST00000518528 CTCTGCCAACTTCCTTTGGGT TTCCCAGGAATCTCAAGCCCA β-actin GGATTCCTATGTGGGCGACGA GCGTACAGGGATAGCACAGC

[0041] 1.6 Statistical analysis: The experimental data were expressed as . IBM SPSS Statistics V21.0 software was used for analysis. The independent sample t test was used for comparison between the two groups. P < 0.05 was considered statistically significant.

[0042] 2 Results

[0043] 2.1 Analysis of differentially expressed genes after different radiation exposures

[0044] The significantly differentially expressed LncRNAs and their changes in the neutron, γ, and neutron-γ mixed irradiation groups are shown in Table 2 and Figure 1 ;

[0045] Table 2 Significantly differentially expressed LncRNAs and their changes in neutron, γ and neutron-γ mixed irradiation groups

[0046]

[0047]

[0048] Note: Fold change>1 means upward adjustment; Fold change<1 means downward adjustment.

[0049] From Table 2 and Figure 1 It can be seen that: compared with the control group, 15 differential LncRNAs were detected in the neutron irradiation group, of which 12 LncRNAs were upregulated and 3 LncRNAs were downregulated. Compared with the control group, 19 differential LncRNAs were detected in the γ irradiation group, of which 16 were upregulated and 3 were downregulated. Compared with the control group, 14 differential LncRNAs were detected in the neutron-γ mixed irradiation group, of which 12 were upregulated and 2 were downregulated. The differential LncRNAs screened in each group are shown in Table 1. The Venn diagram of differentially expressed LncRNAs in the three groups is shown in Table 1. Figure 1 There were 10 differentially expressed LncRNAs under neutron, γ-ray and neutron-γ mixed fields, of which 9 were upregulated and 1 was downregulated.

[0050] 2.2 GO analysis of differentially expressed genes under different radiation exposures

[0051] The results of GO analysis of differentially expressed genes under different radiation exposures are shown in Figure 2-4 ;

[0052] from Figure 2-4 It can be seen that the entries with higher enrichment in the GO analysis of the target genes predicted by the differentially expressed LncRNAs in the neutron group include the intrinsic apoptosis signaling pathway of DNA damage mediated by p53-like mediators, reactive oxygen metabolism, negative regulation of cytokinesis and intrinsic apoptosis signaling pathway of p53-like mediators, activation of cysteine ​​endopeptidase activity involved in the apoptosis process, and immune response, which are mainly related to the apoptosis process, such as Figure 2 . In the GO analysis of the differentially regulated target genes predicted by LncRNA in the γ-irradiation group, the items with higher enrichment levels include inflammatory response, activation of NF-κB-induced kinase activity, and intrinsic apoptosis signaling pathways of p53-like mediators to DNA damage. In the GO analysis of the differentially regulated target genes predicted by LncRNA in the neutron-γ mixed irradiation group, the items with higher enrichment levels include intrinsic apoptosis signaling pathways of p53-like mediators to DNA damage, inflammatory response, reactive oxygen metabolism process, activation of NF-κB-induced kinase activity, and intrinsic apoptosis signaling pathways of p53-like mediators.

[0053] 2.3 KEGG analysis of differentially expressed genes under different radiation exposures

[0054] The results of KEGG analysis of differentially expressed genes under different radiation exposures are shown in Figure 5-7 ;

[0055] from Figure 5-7It can be seen that the KEGG enrichment analysis of the neutron group showed that it was mainly enriched in p53 signaling pathway, apoptosis, endophagy, cell cycle, sphingolipid signaling pathway, DNA replication, nucleotide excision repair, mismatch repair, base excision repair, Jak-STAT, TNF, TGF-β, MAPK and other signaling pathways; the KEGG enrichment analysis of the γ-irradiation group showed that it was mainly enriched in p53 signaling pathway, apoptosis, cell cycle, necrosis, DNA damage repair (nucleotide excision repair, mismatch repair, base excision repair), DNA replication and cytokine-cytokine interaction, Jak-STAT, PI3K-Akt, TNF, Wnt and other signaling pathways. The KEGG enrichment analysis of the neutron-γ mixed irradiation group showed that it was mainly enriched in P53 signaling pathway, apoptosis, cell cycle, DNA damage repair (nucleotide excision repair, mismatch repair, base excision repair), DNA replication and cytokine-cytokine interaction, TNF, PI3K-Akt, NF-κB and other signaling pathways.

[0056] 2.4 Verification of differentially expressed genes in peripheral blood exposed to different radiation

[0057] In order to ensure the accuracy and reliability of the screened differentially expressed LncRNAs as much as possible, it is necessary to use qRT-PCR technology to verify the results. Four differential LncRNAs (gene ENST00000579481, gene ENST00000517790, gene ENST00000635405, gene ENST00000518528) that showed significant changes (change factor>1.5, q<0.05) in the neutron irradiation group, γ irradiation group and neutron-γ mixed irradiation were selected for verification. The results are shown in Figure 8 ; Among them, the acquisition websites of gene ENST00000579481, gene ENST00000517790, gene ENST00000635405, and gene ENST00000518528 are as follows: https: / / www.ncbi.nlm.nih.gov / .

[0058] Figure 8 The results showed that after neutron, γ and neutron-γ mixed irradiation of the peripheral blood of three healthy men, the relative expression levels of ENST00000519481, ENST00000517790, ENST00000635405 and ENST00000518528 genes were significantly different from those of the control group (p < 0.05), and all showed a significant up-regulation trend. The verification results were consistent with the sequencing results of the LncRNA expression profile in the whole transcriptome sequencing.

[0059] Example 2: Human lymphocyte cell line 252 Verification Study of Cf Neutron Source Irradiation

[0060] 1. Test method:

[0061] 1.1 Cell culture

[0062] The human lymphocyte cell line AHH-1 was obtained from the American Type Culture Collection (Manassas, VA, USA) and was inoculated in RPMI 1640 medium containing 10% fetal bovine serum and 0.1 U / L penicillin-streptomycin mixture and cultured in a 37°C 5% CO2 incubator. When the cell growth density was about 1×10 7 / ml, and cells in the logarithmic growth phase were taken for the next experiment.

[0063] 1.2 Cell irradiation

[0064] 252 Cf neutron source, average neutron energy 2.13MeV, dose rate 0.1Gy / h, absorbed dose 0, 1.42Gy.

[0065] 1.3 Total RNA extraction and cDNA synthesis

[0066] The total RNA of lymphocyte line AHH-1 was extracted using RNAprep pure cultured cell total RNA extraction kit. RNA was reverse transcribed using PrimeScriptlM RT kit to synthesize cDNA. 100-200ng RNA was added to 20μl reaction system, and the reaction was terminated after 10min at 25℃, 120min at 37℃, and 5min at 85℃, and then stored at -20℃.

[0067] 1.4 Real-time fluorescence quantitative PCR detection: Real-time fluorescence quantitative PCR (RT-PCR) was used to analyze the expression changes of different LncRNAs. The reaction conditions were 95°C for 10 s; 95°C for 5 s, and 60°C for 20 s (40 cycles). The ΔΔCt method was used for relative quantitative analysis of the expression levels of each LncRNA. The results are shown in Fig. 9 ; The primer sequences of each gene are shown in Table 1.

[0068] 2 Results and analysis

[0069] The present invention adopts californium-252 (252Cf) for cell irradiation. As a radioactive isotope, californium-252 (252Cf) can release neutrons and gamma rays at the same time, which is a mixed irradiation of neutrons and gamma rays.

[0070] from Fig. 9 The results show that: human lymphocyte cell line 252After Cf source irradiation, the expression of ENST00000635405, ENST00000579481, ENST00000517790 and ENST00000518528 were also significantly upregulated (p<0.05).

[0071] In summary, ENST00000519481, ENST00000517790, ENST00000635405 and ENST00000518528 genes can be used as molecular targets in the preparation of neutron and gamma-ray mixed field damage detection products or in the preparation of neutron and gamma mixed irradiation biological dosimeters.

[0072] The above-described embodiments are only preferred embodiments of the present invention, and are not exhaustive of the feasible implementations of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. Application of Lnc RNA as a molecular target in the preparation of neutron and gamma-ray mixed field damage detection products or in the preparation of neutron and gamma mixed irradiation biological dosimeters.

2. The use according to claim 1, characterized in that: Lnc RNA includes one or more of gene ENST00000579481, gene ENST00000517790, gene ENST00000635405, and gene ENST00000518528.

3. A primer set for detecting the expression level of Lnc RNA according to claim 1, characterized in that: Including one or more of the primer set of gene ENST00000579481, the primer set of gene ENST00000517790, the primer set of gene ENST00000635405, and the primer set of gene ENST00000518528; wherein, In the primer set for gene ENST00000579481, the nucleotide sequence of the forward primer is shown in SEN ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.2; In the primer set for gene ENST00000517790, the nucleotide sequence of the forward primer is shown in SEN ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.4; In the primer set of gene ENST00000635405, the nucleotide sequence of the forward primer is shown in SEN ID NO.5, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.6; In the primer set of gene ENST00000635405, the nucleotide sequence of the forward primer is shown in SEN ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEN ID NO.

8.

4. A kit for detecting the expression level of Lnc RNA as claimed in claim 1, characterized in that: It includes one or more of the primer set of gene ENST00000579481, the primer set of gene ENST00000517790, the primer set of gene ENST00000635405, and the primer set of gene ENST00000518528 as claimed in claim 3.

Images