Application of lncRNA WNT5A-AS1 in gastric cancer

Abstract

The present invention belongs to the field of biotechnology, and discloses the application of lncRNA WNT5A‑AS1 in gastric cancer. Studies have found that WNT5A‑AS1 is significantly upregulated in cisplatin-resistant gastric cancer cells, and is closely related to tumor proliferation, apoptosis and chemotherapy resistance. Detecting the expression level of WNT5A‑AS1 can improve the accuracy of gastric cancer diagnosis and prognosis evaluation, and help formulate personalized treatment plans. Knocking down WNT5A‑AS1 can effectively inhibit the proliferation of gastric cancer cells and promote apoptosis, enhance sensitivity to chemotherapeutic drugs, and provide a new treatment strategy for overcoming chemotherapy resistance. The invention has broad application prospects, and inhibiting the expression of WNT5A‑AS1 is expected to assist in the treatment of gastric cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the application of lncRNA WNT5A-AS1 in gastric cancer diagnosis, treatment, drug resistance prediction and prognosis evaluation. Background Art

[0002] Gastric cancer (GC) is the fifth most common cancer in the world and one of the leading causes of cancer death. [1] Since patients with gastric cancer have no specific symptoms in the early stages, most patients are diagnosed in the late stages and have a poor prognosis. [2] At present, endoscopy and tissue biopsy are one of the main methods for clinical diagnosis of gastric cancer and the gold standard for gastric cancer screening. However, this method is highly invasive and may cause a certain degree of damage to patients. [3] In terms of treatment, chemotherapy is a common treatment for patients with advanced or inoperable gastric cancer. [4-5] However, due to the existence of primary or acquired drug resistance in patients, the efficacy of chemotherapy is greatly limited, leading to treatment failure. [6-7] Chemotherapy resistance is one of the main causes of death in gastric cancer [8] Although more and more studies have elucidated the drug resistance mechanism of gastric cancer, the poor prognosis of patients with advanced gastric cancer has not changed. [9] Therefore, it is of great significance to study new biomarkers and molecular targets to improve the diagnostic efficiency and the efficacy of chemotherapy resistance in advanced gastric cancer.

[0003] Long noncoding RNA (LncRNA) is a type of RNA transcription product with a length greater than 200 nucleotides and generally does not have protein coding ability.

[10] LncRNA plays an important role in tumor biological behavior and participates in the occurrence and development of tumors by regulating the expression of multiple genes.

[11] , including tumor proliferation, metastasis, metabolism and drug resistance [12-15] Studies have found that lncRNA MNX1-AS1 is upregulated in non-small cell lung cancer (NSCLC) and can promote tumor proliferation and growth

[16] lncRNA AY promotes HCC metastasis by inducing ITGAV transcriptional chromatin modification

[17] The LncRIM-NF2 axis depends on the Hippo signaling pathway to mediate cellular iron metabolism in breast cancer

[18] lincNMR is a long noncoding RNA induced in hepatocellular carcinoma, and lincNMR regulates tumor cell proliferation by regulating nucleotide metabolism through the YBX1-RRM2-TYMS-TK1 axis

[19] Linc01056 promotes the resistance of liver cancer cells to sorafenib, promotes cell apoptosis in vitro, and inhibits tumor growth in vivo. Mesenchymal stem cells induce lncRNA HCP5 to undergo fatty acid oxidation through the miR-3619-5p / AMPK / PGC1α / CEBPB axis, promote the stemness and chemotherapy resistance of gastric cancer, and target HCP5 to enhance the efficacy of chemotherapy in gastric cancer

[20] LncRNA DACT3-AS1 is downregulated in gastric cancer tissues and is associated with poor prognosis in gastric cancer patients. DACT3-AS1 enhances the sensitivity of tumor cells to oxaliplatin through SIRT-1-mediated ferroptosis

[21] LncRNA00942 is upregulated in gastric cancer resistant cells, and its high expression is positively correlated with the poor prognosis of gastric cancer patients; LncRNA00942 increases the chemotherapy resistance of gastric cancer cells by inhibiting apoptosis and inducing stemness

[22] These studies have shown that LncRNA plays a key role in the drug resistance of gastric cancer. However, there is currently no molecular target that has been successfully transformed into clinical practice. Therefore, further exploring the regulatory mechanism of LncRNA in gastric cancer drug resistance and screening out potential biomarkers and molecular targets for clinical application transformation are of great clinical significance. Summary of the invention

[0004] The purpose of the present invention is to overcome at least one deficiency of the prior art and provide the use of lncRNA WNT5A-AS1 in gastric cancer.

[0005] The technical solution adopted by the present invention is:

[0006] The first aspect of the present invention provides:

[0007] Application of reagents for quantifying lncRNA WNT5A-AS1 expression in the preparation of diagnostic reagents for gastric cancer.

[0008] In some application examples, the reagent is selected from a high-throughput lncRNA chip, a tissue chip or a PCR reagent.

[0009] In some application examples, the sample detected by the reagent is a tissue sample.

[0010] The second aspect of the present invention provides:

[0011] Application of reagents for quantifying lncRNA WNT5A-AS1 expression in the preparation of gastric cancer prognostic diagnostic reagents.

[0012] In some application examples, the reagent is selected from a high-throughput lncRNA chip, a tissue chip or a PCR reagent.

[0013] In some application examples, the sample detected by the reagent is a tissue sample.

[0014] The third aspect of the present invention provides:

[0015] Application of reagents for quantifying lncRNA WNT5A-AS1 expression in the preparation of reagents for predicting chemotherapy sensitivity in gastric cancer.

[0016] In some application examples, the reagent is selected from a high-throughput lncRNA chip, a tissue chip or a PCR reagent.

[0017] In some application examples, the sample detected by the reagent is a tissue sample.

[0018] A fourth aspect of the present invention provides:

[0019] Use of a preparation for inhibiting or reducing the expression of lncRNA WNT5A-AS1 in the preparation of a drug for treating gastric cancer.

[0020] In some application examples, the agent for inhibiting the expression of lncRNA WNT5A-AS1 is at least one selected from miRNA, siRNA or shRNA targeting lncRNA WNT5A-AS1, and lncRNA WNT5A-AS1 promoter inhibitor.

[0021] In some application examples, the shRNA is WNT5A-AS1 Sh-1: AACGCACAAGTGCCATCTGA; or WNT5A-AS1 Sh-2: AAGTCGCCCCGGAACTTATTG.

[0022] A fifth aspect of the present invention provides:

[0023] Use of a preparation for inhibiting or reducing the expression of lncRNA WNT5A-AS1 in the preparation of a preparation for reversing cisplatin chemotherapy resistance or improving cisplatin chemotherapy sensitivity.

[0024] In some application examples, the agent for inhibiting the expression of lncRNA WNT5A-AS1 is at least one selected from miRNA, siRNA or shRNA targeting lncRNA WNT5A-AS1, and lncRNA WNT5A-AS1 promoter inhibitor.

[0025] In some application examples, the shRNA is WNT5A-AS1 Sh-1: AACGCACAAGTGCCATCTGA; or WNT5A-AS1 Sh-2: AAGTCGCCCCGGAACTTATTG.

[0026] A fifth aspect of the present invention provides:

[0027] A method for screening gastric cancer drugs comprises the following steps:

[0028] The candidate compound was used to act on gastric cancer cells with high expression of lncRNA WNT5A-AS1 in vitro;

[0029] The expression level of lncRNA WNT5A-AS1 in gastric cancer cells after the treatment was detected, and the therapeutic effect of the candidate compound on gastric cancer was determined based on the change in the expression level of lncRNA WNT5A-AS1.

[0030] Specifically, if the expression level of lncRNAWNT5A-AS1 is reduced after the candidate compound acts on gastric cancer cells with high expression of lncRNA WNT5A-AS1, it means that it has a potential therapeutic effect on gastric cancer or can increase the sensitivity of cells to cisplatin chemotherapy.

[0031] A sixth aspect of the present invention provides:

[0032] A gastric cancer analysis system, the system is used for gastric cancer diagnosis, determination of gastric cancer prognosis or determination of gastric cancer chemotherapy sensitivity, comprising:

[0033] a quantification device for determining the expression level of lncRNA WNT5A-AS1 in a sample;

[0034] An analysis device for determining gastric cancer risk, determining gastric cancer prognosis, or determining gastric cancer chemotherapy sensitivity based on the expression level of lncRNA WNT5A-AS1 in a sample;

[0035] The result output device is used to output the analysis result of the analysis device.

[0036] Specifically, high expression of lncRNA WNT5A-AS1 in a sample indicates a high risk of gastric cancer, or a poor prognosis (malignant progression), or weak sensitivity to chemotherapy. High expression is a common meaning in the art, which means that the expression level of lncRNA WNT5A-AS1 in a sample is significantly higher than the normal expression level, such as 1.2 times or more higher than the normal expression level.

[0037] The beneficial effects of the present invention are:

[0038] The present invention reveals for the first time the key role of WNT5A-AS1 in the malignant progression and chemotherapy resistance of gastric cancer, and provides a novel molecular marker and therapeutic target. Detecting the expression level of WNT5A-AS1 can improve the accuracy of gastric cancer diagnosis and prognosis evaluation, and help formulate personalized treatment plans. Knocking down WNT5A-AS1 can effectively inhibit the proliferation of gastric cancer cells and promote apoptosis, enhance sensitivity to chemotherapy drugs, and provide a new treatment strategy for overcoming chemotherapy resistance. The invention has broad application prospects, and inhibiting the expression of WNT5A-AS1 is expected to assist in the treatment of gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the screening of lncRNA related to cisplatin-resistant gastric cancer cells.

[0040] Figure 2 High expression of lncRNA WNT5A-AS1 in gastric cancer patients is associated with poor prognosis.

[0041] Figure 3 The effect of lncRNA WNT5A-AS1 on the proliferation and apoptosis of gastric cancer cells.

[0042] Figure 4 The effect of lncRNA WNT5A-AS1 on cisplatin drug sensitivity and apoptosis of gastric cancer cells.

[0043] Figure 5 is the effect of lncRNA WNT5A-AS1 in an in vivo xenograft model. DETAILED DESCRIPTION

[0044] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0045] Example 1: Screening of lncRNAs associated with cisplatin-resistant gastric cancer cells

[0046] This example aims to screen lncRNAs associated with cisplatin resistance in gastric cancer cells to explore their role in gastric cancer resistance.

[0047] 1. Construction of cisplatin-resistant cell line HGC27 / DDP

[0048] The gastric cancer cell HGC-27 was repeatedly induced using a medium containing cisplatin (DDP) and the cisplatin-resistant strain HGC27 / DDP was successfully constructed. In order to verify the sensitivity of the resistant strain to DDP, the half-inhibitory concentration (IC50) of HGC-27 parental cells and the resistant strain HGC27 / DDP was determined using a CCK-8 kit. The experimental results showed that the IC50 value of HGC27 / DDP-resistant cells was significantly higher than that of HGC-27 parental cells ( Figure 1 A in Figure ), indicating that the cisplatin-resistant cell line HGC27 / DDP was successfully constructed.

[0049] 2. Screening of differentially expressed lncRNAs

[0050] Next, lncRNA microarray analysis was used to compare the expression profiles of lncRNAs in HGC-27 and HGC27 / DDP cells, and differentially expressed lncRNAs were screened ( Figure 1 The expression levels of differentially expressed lncRNAs in HGC-27 and HGC27 / DDP were further verified by RT-qPCR ( Figure 1 C in Figure 1). The results showed that lncRNA WNT5A-AS1 was significantly overexpressed in the cisplatin-resistant cell line HGC27 / DDP, and the difference was most obvious.

[0051] 3. Expression analysis of lncRNA WNT5A-AS1

[0052] To more comprehensively evaluate the expression of lncRNA WNT5A-AS1, the expression level of lncRNA WNT5A-AS1 was detected by RT-qPCR in the immortalized normal gastric epithelial cell line GES-1, three gastric cancer cell lines (SNU-1, AGS, and HGC-27), and the cisplatin-resistant cell line HGC-27 / DDP ( Figure 1 D in Figure 1). The results showed that compared with normal gastric epithelial cells GES-1, lncRNA WNT5A-AS1 was highly expressed in all gastric cancer cell lines, and its expression level was even higher in the drug-resistant cell line HGC27 / DDP.

[0053] 4. Expression Validation in Clinical Samples

[0054] In addition, the expression level of lncRNA WNT5A-AS1 was detected in 147 gastric cancer tissues and 30 paired normal tissue samples from the Affiliated Cancer Hospital of Guangzhou Medical University ( Figure 1The results showed that the expression of lncRNA WNT5A-AS1 in gastric cancer tissues was significantly higher than that in normal tissues, which suggested that WNT5A-AS1 plays an important role in the occurrence and development of gastric cancer.

[0055] Conclusion: In summary, the above experimental results show that lncRNA WNT5A-AS1 is significantly overexpressed in gastric cancer and cisplatin-resistant cells, which suggests that lncRNA WNT5A-AS1 may be involved in regulating the malignant progression of gastric cancer and is closely related to the resistance of gastric cancer cells to cisplatin.

[0056] Example 2: High expression of lncRNA WNT5A-AS1 in gastric cancer patients is associated with poor prognosis

[0057] This example aims to explore the relationship between the expression level of lncRNA WNT5A-AS1 and the clinical prognosis of gastric cancer patients.

[0058] 1. lncRNA WNT5A-AS1 is associated with the prognosis of gastric cancer patients

[0059] The clinical data of the above 147 gastric cancer patients were further analyzed, and the results showed that the high expression of lncRNA WNT5A-AS1 was significantly positively correlated with poor differentiation, distant metastasis, and clinical stage IV (Table 1). This suggests that high levels of lncRNA WNT5A-AS1 may be associated with the aggressiveness and late disease progression of gastric cancer.

[0060] Table 1 Correlation analysis between lncRNA WNT5A-AS1 expression and clinicopathological characteristics in gastric cancer patients

[0061]

[0062] 2. Analysis of lncRNA WNT5A-AS1 as an independent prognostic factor

[0063] To further clarify the role of lncRNA WNT5A-AS1 in prognosis, univariate and multivariate analyses were performed, and the results confirmed that lncRNA WNT5A-AS1 was an independent risk factor for predicting progression-free survival in gastric cancer patients (Table 2). These analysis results indicate that high expression of lncRNA WNT5A-AS1 may be an adverse factor affecting the prognosis of gastric cancer patients.

[0064] Table 2 Univariate and multivariate analysis of the effects of lncRNA WNT5A-AS1 and clinical indicators on the prognosis of gastric cancer patients

[0065]

[0066] 3. Survival Analysis

[0067] In order to evaluate the effect of lncRNA WNT5A-AS1 expression on patient survival, the Kaplan-Meier method was used to analyze the survival rate and draw a survival curve. The results showed that the overall survival (OS) of gastric cancer patients with low expression of lncRNA WNT5A-AS1 was better than that of patients with high expression. According to statistical analysis, the 5-year survival rates of the low expression group and the high expression group were 58.5% and 43.1%, respectively, with a difference of 15.4% between the two groups (P = 0.013) ( Figure 2 Similarly, patients with low expression of lncRNA WNT5A-AS1 also had better progression-free survival (PFS) than those with high expression. The 5-year PFS rates of the low expression group and the high expression group were 53.5% and 34.9%, respectively, with a difference of 18.6% (P = 0.012) ( Figure 2 B in the figure). Subsequently, 98 patients who had undergone chemotherapy were further analyzed and divided into two subgroups, namely, chemotherapy-sensitive group and chemotherapy-tolerant group. The conditions for distinguishing the two groups were that the total number of chemotherapy sessions exceeded 6 times, or the treatment regimen was changed during chemotherapy, which was the chemotherapy-tolerant group. Subgroup analysis found that the proportion of patients who were tolerant to chemotherapy in the high-expression group of lncRNA WNTSA-AS1 was higher than that in the low-expression group (24.5% vs. 13.2%, Figure 2 C). Further analysis showed that the OS of patients with high expression of lncRNA WNT5A-AS1 in gastric cancer tissues of 98 patients receiving chemotherapy was significantly lower than that of patients with low expression ( Figure 2 D in.

[0068] Conclusion: In summary, high expression of lncRNA WNT5A-AS1 in gastric cancer patients is associated with adverse clinical features (such as distant metastasis and advanced clinical stage) and is an independent adverse factor for predicting patient survival. Kaplan-Meier survival curve analysis further showed that high expression of lncRNA WNT5A-AS1 was significantly associated with poor overall survival and progression-free survival. In addition, the proportion of patients with chemotherapy resistance was higher in the lncRNA WNTSA-AS1 high expression group, and the overall survival of patients receiving chemotherapy was lower. Therefore, lncRNA WNT5A-AS1 may serve as a potential biomarker for the prognosis of gastric cancer patients and may play an important regulatory role in gastric cancer drug resistance.

[0069] Example 3: Effect of lncRNA WNT5A-AS1 on gastric cancer cell proliferation, apoptosis and cisplatin sensitivity

[0070] This example aims to study the effect of lncRNA WNT5A-AS1 on the proliferation, apoptosis and sensitivity to cisplatin of gastric cancer cells.

[0071] 1. Construction of cell lines with stable knockdown or overexpression of lncRNA WNT5A-AS1

[0072] By using a lentivirus containing a specific knockdown or overexpression sequence of lncRNA WNT5A-AS1, wherein the sequence for specific knockdown of lncRNA WNT5A-AS1 is shRNA WNT5A-AS1 Sh-1: AACGCACAAGTGCCATCTGA (SEQ ID NO: 1); or WNT5A-AS1Sh-2: AAGTCGCCCCGGAACTTATTG (SEQ ID NO: 2). At the same time, a lentivirus containing an empty fragment was used as a control. According to the expression level of lncRNA WNT5A-AS1 in HGC-27 / DDP and HGC-27 cells, lncRNA WNT5A-AS1 was knocked down in the cisplatin-resistant cell line HGC-27 / DDP, and lncRNA WNT5A-AS1 was overexpressed in the parental cell line HGC-27. Specifically, the above lentivirus was transfected into HGC-27 / DDP or HGC-27 cell lines, and cell lines with stable knockdown or overexpression of lncRNA WNT5A-AS1 were constructed. The effectiveness of knockdown and overexpression was verified by RT-qPCR, and the results showed that cell lines with stable knockdown or overexpression of lncRNA WNT5A-AS1 were successfully constructed ( Figure 3 A in the figure).

[0073] 2. Effect of lncRNA WNT5A-AS1 on gastric cancer cell proliferation

[0074] In order to explore the effect of lncRNA WNT5A-AS1 on the proliferation of gastric cancer cells, CCK-8 and EDU proliferation experiments were performed in HGC-27 and HGC-27 / DDP cell lines, respectively. The results showed that in HGC-27 / DDP resistant cells, knocking down lncRNA WNT5A-AS1 significantly inhibited cell proliferation, while in HGC-27 parental cells, overexpression of lncRNA WNT5A-AS1 significantly promoted cell proliferation ( Figure 3 These results suggest that high expression of lncRNA WNT5A-AS1 contributes to the enhanced proliferation ability of gastric cancer cells.

[0075] 3. Effect of lncRNA WNT5A-AS1 on cisplatin sensitivity and apoptosis of gastric cancer cells

[0076] In order to explore the effect of lncRNA WNT5A-AS1 on the sensitivity of cisplatin, the sensitivity of HGC-27 / DDP or HGC-27 cells to cisplatin with stable knockdown or overexpression of lncRNA WNT5A-AS1 was detected by IC50 experiment. The results showed that after knocking down lncRNA WNT5A-AS1, the IC50 value of HGC-27 / DDP cells was significantly reduced, indicating that the sensitivity of cells to cisplatin increased; on the contrary, after overexpression of lncRNA WNT5A-AS1, the sensitivity of cells to cisplatin was significantly reduced ( Figure 4 These results suggest that lncRNA WNT5A-AS1 may play an important role in the development of cisplatin resistance.

[0077] In addition, flow cytometry was used to detect cell apoptosis at different lncRNA WNT5A-AS1 expression levels after cisplatin treatment. Specifically, HGC-27 / DDP or HGC-27 cells with stable knockdown or overexpression of lncRNA WNT5A-AS1 were cultured at 25 μM cisplatin chemotherapy concentration for 48 hours, and the proportion of apoptotic cells was analyzed by flow cytometry. The results showed that in cells with knockdown of lncRNA WNT5A-AS1, the number of early and late apoptotic cells increased significantly; on the contrary, overexpression of lncRNA WNT5A-AS1 significantly reduced the apoptosis rate of cells ( Figure 4 These results further confirmed that lncRNA WNT5A-AS1 may affect cisplatin sensitivity by regulating cell apoptosis.

[0078] Conclusion: The above results show that high expression of lncRNA WNT5A-AS1 can promote the proliferation of gastric cancer cells, inhibit cell apoptosis, and reduce the sensitivity of cells to cisplatin. Knockdown of lncRNA WNT5A-AS1 can significantly inhibit cell proliferation, promote apoptosis, and enhance the sensitivity of cells to cisplatin. Therefore, lncRNA WNT5A-AS1 may be a key regulatory factor in cisplatin resistance in gastric cancer, and also provides a potential research direction for the study of resistance mechanism and targeted therapy of gastric cancer.

[0079] Example 4: Functional validation of lncRNA WNT5A-AS1 in an in vivo xenograft model

[0080] To further explore the function of lncRNA WNT5A-AS1 in vivo, HGC-27 / DDP cells (Sh-1) with stable knockdown of lncRNA WNT5A-AS1 and its control cells (Sh-NC) were injected subcutaneously into NCG mice to construct a xenograft gastric cancer mouse model. The subcutaneous tumor volume of mice was measured regularly, and the tumors were collected and weighed after the experiment. The results showed that the tumor volume of mice in the lncRNA WNT5A-AS1 knockdown group was significantly smaller than that in the control group ( Figure 5 The tumor weight was significantly lower than that in the control group ( Figure 5 C in.

[0081] Summary: In summary, knockdown of lncRNA WNT5A-AS1 can effectively inhibit the tumorigenicity of gastric cancer cells in the subcutaneous tissues of NCG mice in vivo, indicating that knockdown of lncRNA WNT5A-AS1 may provide new ideas and strategies for the treatment of gastric cancer.

[0082] References:

[0083] [1] Bray F, Laversanne M, Sung H, et al. Globalcancer statistics2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-263.

[0084] [2] Wei L, Sun J, Zhang N, et al. Noncoding RNAs in gastric cancer:implications for drug resistance. Mol Cancer. 2020;19(1):62.

[0085] [3] Ma S, Zhou M, Xu Y, et al. Clinical application and detection techniques of liquid biopsy in gastric cancer. Mol Cancer. 2023;22(1):7.

[0086] [4] Wagner AD, Syn NL, Moehler M, et al.Chemotherapy for advancedgastric cancer. Cochrane Database Syst Rev. 2017;8(8):CD004064.

[0087] [5] Ham IH, Oh HJ, Jin H, et al. Targetinginterleukin-6 as a strategyto overcome stroma-induced resistance to chemotherapy in gastric cancer. MolCancer. 2019;18(1):68.

[0088] [6] Biagioni A, Skalamera I, Peri S, et al. Updateon gastric cancertreatments and gene therapies. Cancer Metastasis Rev. 2019;38(3):537-548.

[0089] [7] Ruan T, Liu W, Tao K, Wu C. A Review ofResearch Progress inMultidrug-Resistance Mechanisms in Gastric Cancer. Onco Targets Ther. 2020;13:1797-1807.

[0090] [8] Dassen AE, Dikken JL, van de Velde CJ, WoutersMW, Bosscha K,Lemmens VE. Changes in treatment patterns and their influence on long-termsurvival in patients with stages I-III gastric cancer in TheNetherlands. IntJ Cancer. 2013;133(8):1859-1866.

[0091] [9] Elimova E, Wadhwa R, Shiozaki H, et al.Molecular biomarkers ingastric cancer. J Natl Compr Canc Netw. 2015;13(4):e19-e29.

[0092]

[10] Nagano T, Fraser P. No-nonsense functions forlong noncodingRNAs. Cell. 2011;145(2):178-181.

[0093]

[11] Jiang S, Cheng SJ, Ren LC, et al. An expandedlandscape of humanlong noncoding RNA. Nucleic Acids Res. 2019;47(15):7842-7856.

[0094]

[12] Goodall GJ, Wickramasinghe VO. RNA incancer. Nat Rev Cancer.2021;21(1):22-36.

[0095]

[13] Kopp F, Mendell JT. Functional Classificationand ExperimentalDissection of Long Noncoding RNAs. Cell. 2018;172(3):393-407.

[0096]

[14] Dragomir MP, Kopetz S, Ajani JA, Calin GA.Non-coding RNAs in GIcancers: from cancer hallmarks to clinical utility. Gut. 2020;69(4):748-763.

[0097]

[15] Jiang W, Xia J, Xie S, et al. Long non-codingRNAs as adeterminant of cancer drug resistance: Towards the overcoming ofchemoresistance via modulation of lncRNAs. Drug Resist Updat.2020;50:100683.

[0098]

[16] Zhu Q, Zhang C, Qu T, et al. MNX1-AS1 Promotes Phase SeparationofIGF2BP1 to Drive c-Myc-Mediated Cell-Cycle Progression and Proliferation inLung Cancer. Cancer Res. 2022;82(23):4340-4358.

[0099]

[17] Kang CL, Qi B, Cai QQ, et al. LncRNA AY promoteshepatocellularcarcinoma metastasis by stimulating ITGAV transcription.Theranostics.2019;9(15):4421-4436.

[0100]

[18] He XY, Fan X, Qu L, et al. LncRNA modulatesHippo-YAP signalingto reprogram iron metabolism. Nat Commun. 2023;14(1):2253.

[0101]

[19] Gandhi M, GroßM, Holler JM, et al. The lncRNA lincNMR regulatesnucleotidemetabolism via a YBX1 - RRM2 axis in cancer. Nat Commun. 2020;11(1):3214.

[0102]

[20] Wu H, Liu B, Chen Z, Li G, Zhang Z.MSC-induced lncRNA HCP5 drivesfatty acid oxidation through miR-3619-5p / AMPK / PGC1α / CEBPB axis to promote stemness and chemo-resistance of gastric cancer. Cell Death Dis. 2020;11(4):233.

[0103]

[21] Qu X, Liu B, Wang L, et al. Loss of cancer-associated fibroblast-derived exosomal DACT3-AS1 promotes malignant transformation and ferroptosis-mediated oxaliplatin resistance in gastriccancer. Drug Resist Updat. 2023;68:100936.

[0104]

[22] Zhu Y, Zhou B, Hu X, et al. LncRNA LINC00942promoteschemoresistance in gastric cancer by suppressing MSI2 degradation toenhance c-Myc mRNA stability. Clin Transl Med. 2022;12(1):e703.doi:10.1002 / ctm2.703.

[0105] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. Use of a reagent for quantitatively detecting the expression of lncRNA WNT5A-AS1 in the preparation of a gastric cancer diagnostic reagent, wherein the sample detected by the reagent is a tumor tissue sample.

2. The use according to claim 1, characterized in that: The reagent is selected from a high-throughput lncRNA chip, a tissue chip or a PCR reagent.

3. Use of a reagent for quantitatively detecting the expression of lncRNA WNT5A-AS1 in the preparation of a gastric cancer prognosis diagnostic reagent, wherein the sample detected by the reagent is a tumor tissue sample.

4. Use of a reagent for quantitatively detecting the expression of lncRNA WNT5A-AS1 in the preparation of a reagent for predicting the chemotherapy sensitivity of gastric cancer, wherein the chemotherapy is cisplatin chemotherapy, and the sample detected by the reagent is a tumor tissue sample.

5. Use of a preparation for inhibiting the expression of lncRNA WNT5A-AS1 in the preparation of a drug for treating gastric cancer, wherein the preparation for inhibiting the expression of lncRNA WNT5A-AS1 is a shRNA targeting lncRNA WNT5A-AS1, and the shRNA is WNT5A-AS1 Sh-1: AACGCACAAGTGCCATCTGA; or WNT5A-AS1 Sh-2: AAGTCGCCCCGGAACTTATTG.

6. Use of a preparation that inhibits the expression of lncRNA WNT5A-AS1 in the preparation of a preparation for reversing cisplatin chemotherapy resistance or improving cisplatin chemotherapy sensitivity, wherein the preparation that inhibits the expression of lncRNA WNT5A-AS1 is shRNA targeting lncRNA WNT5A-AS1, and the shRNA is WNT5A-AS1 Sh-1: AACGCACAAGTGCCATCTGA; or WNT5A-AS1 Sh-2: AAGTCGCCCCGGAACTTATTG.

7. A gastric cancer analysis system, the system is used for gastric cancer diagnosis, determination of gastric cancer prognosis or determination of gastric cancer chemotherapy sensitivity, the chemotherapy is cisplatin chemotherapy, characterized in that: include: A quantification device, used to determine the expression amount of lncRNA WNT5A-AS1 in a sample, wherein the sample is a tumor tissue sample; An analysis device for determining gastric cancer risk, determining gastric cancer prognosis, or determining gastric cancer chemotherapy sensitivity based on the expression level of lncRNA WNT5A-AS1 in a sample; The result output device is used to output the analysis result of the analysis device.

Images