Syringa plant classification bar code prepared based on chloroplast genome polymorphic fragments and application of syringa plant classification bar code
By designing the classification barcode and primer set of Celadon genome based on the chloroplast genome, the problems of classification and identification of Celadon genus were solved, rapid and accurate identification was achieved, and its industrial development was promoted.
Patent Information
- Application Number
- CN202411760688.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2025-02-25
AI Technical Summary
There is controversy in the classification and identification of plants in the genus Clove. Due to the rapid growth of new varieties, irregular naming, and unknown origin of germline parents, the existing technology is difficult to effectively solve the classification and identification problems of plants in the genus Clove, which limits its promotion and application and industrial development.
The classification barcode of the genus Celadon is adopted based on the polymorphic fragments of the chloroplast genome. By designing primer groups such as psbA-trnH and trnC-petN, the rapid and accurate identification of the genus Celadon is achieved.
The sequence of highly variable zones was screened through bioinformatics, which achieved rapid and accurate identification of lilac plants, solved the problems of classification and identification of lilac plants in the existing technology, and promoted its industrial development.
Smart Images
Figure CN119506464A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of plant molecular biology, and more particularly to a classification barcode of lilac plants prepared based on polymorphic fragments of chloroplast genome and application thereof. Background Art
[0002] Syringa L. is a deciduous shrub or small tree of the Oleaceae family. It is a precious fragrant flower plant in my country. It has the advantages of luxuriant flowering, rich flower colors, and strong adaptability. It is now widely used in various forms of landscapes such as gardens, aromatic gardens, health care green spaces, specialized gardens, and temple gardens. In addition, plants of this genus are often used as woody cut flowers, tea and medicinal raw materials, etc. It is a plant species with good ornamental value, good color and fragrance, and high economic added value.
[0003] There are disputes over the classification and interspecific relationships of the genus Syringa. Due to the rapid increase in the number of new varieties, irregular naming, and unknown origins of the parent species, the limitations of classification and identification based on morphology, palynology, isozymes, etc. are becoming increasingly prominent, which brings certain difficulties to the classification, identification and breeding of plants in this genus. This situation has seriously restricted the promotion and application of Syringa plants in my country and the development of the industry.
[0004] At present, the development of molecular markers for Syringa plants mainly involves the development of EST-SSR molecular markers related to lilac flower traits and the development of ISSR molecular markers for identifying lilac and white lilac, wild populations and cultivated varieties. The chloroplast genome has the characteristics of small molecular weight, simple structure and high genetic conservation, and plays an important role in the study of plant phylogeny, species identification and genetic transformation. At present, the whole genome sequences of chloroplasts of about 40 species and variants of Syringa have been published, but the length of the whole genome sequence of chloroplasts of Syringa is about 156kb, which is difficult to amplify, sequence and assemble. The methods are relatively cumbersome, which is not conducive to the study of kinship and species identification. Scholars have conducted useful research on a few Syringa plants in Northeast China based on the conservative sequences of the chloroplast genome trnL-F, atpB-rbcL and trnL intron regions. At present, there is no research on the development of molecular tags for the chloroplast genome of Syringa and its application in the molecular identification of kinship and variant plants of Syringa. Summary of the invention
[0005] In view of this, the present invention provides a classification barcode for genus Syringa prepared based on polymorphic fragments of chloroplast genome and application thereof.
[0006] In order to achieve the above object, the present invention adopts the following technical solution:
[0007] A barcode for classifying plants of the genus Syringa, wherein the barcode uses the 84th to 581st and 29085th to 29869th positions of the diploid red lilac chloroplast genome sequence with accession number OL414766.1 as reference sequences, and the information thereof is shown in Tables 4 to 7 of the specification.
[0008] Another object of the present invention is to provide a primer set for classification of genus Syringa based on chloroplast genome barcode, the primer set consisting of psbA-trnH and trnC-petN; the nucleotide sequence of psbA-trnH is shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of trnC-petN is shown in SEQ ID NO.3 and SEQ ID NO.4.
[0009] Another object of the present invention is to provide a classification method for lilac plants based on chloroplast genome barcoding, comprising the following steps:
[0010] S1: extracting DNA of the tested lilac plant;
[0011] S2: Use the above primer set to amplify the DNA obtained in S1;
[0012] S3: Compare the amplification result obtained in S2 with the above barcode and make a judgment.
[0013] Preferably, S1 also includes testing the concentration, purity and integrity of the DNA.
[0014] Preferably, the PCR reaction system in S2 is: 2 μL of DNA template, 3 μL of each F / R primer, 25 μL of 2×Taq PCRMasterMix, and ddH2O is added to 50 μL.
[0015] Preferably, the PCR amplification reaction procedure in S2 is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing for 30 s, extension at 72°C for 45 s, 32 cycles; and finally keeping at 72°C for 8 min and storing at 4°C.
[0016] Another object of the present invention is to provide application of the above molecular tag or the above primer set or the above classification method in the classification of plants of the genus Syringa.
[0017] Beneficial effects: Based on the chloroplast genome information of the genus Syringa, the present invention uses bioinformatics to complete the screening of 16 hypervariable region sequences, from which 2 hypervariable region sequences are selected to achieve rapid and accurate identification of plants of the genus Syringa. The 2 hypervariable regions of the chloroplast genome and their specific primers can achieve rapid and accurate identification of variant plants of the genus Syringa. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.
[0019] Figure 1 The results of PCR amplification of five typical lilac species using 16 pairs of primers, including purple lilac (Z); red lilac (H); small-leaved lilac (XY); feather-leaved lilac (YY); and Syringa syringae (BM).
[0020] Figure 2 The psbA-trnH and trnC-petN primers successfully amplified 52 Syringa species in Table 2.
[0021] Figure 3 is the genetic distance of primers K2P for psbA-trnH and trnC-petN. DETAILED DESCRIPTION
[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0023] Example 1
[0024] 1. The kit method was used to extract genomic DNA from young leaves of five typical lilac plants (Syringa purpurea, Syringa rubrum, Syringa microphylla, Syringa ulmoides, and Syringa syringae) that were healthy and free of pests and diseases, and the DNA concentration, purity and integrity were tested.
[0025] 2. Comparing the above five chloroplast genomes of lilac in NCBI, 16 pairs of DNA barcode primers were designed for 16 genes. The amplification results are shown in the attached figure. Figure 1 shown.
[0026] PCR reaction system: In a 50 μL reaction system, 2 μL of DNA template, 3 μL of each F / R primer (10 μmol / L), 25 μL of 2×Taq PCR MasterMix, and ddH2O were added.
[0027] The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing for 30 s, extension at 72°C for 45 s, 32 cycles; and finally keeping at 72°C for 8 min and storing at 4°C.
[0028] By the attached Figure 1 It can be seen that the amplified bands of psbA-trnH, trnC-petN, rpl32-trnL, trnL-trnF, ndhB-trnL, trnL, matK2, and accD1 in the five lilac species are clear and different, and can be used as alternative primers for DNA barcodes. Their specific sequences are shown in Table 1.
[0029] Table 1
[0030]
[0031] Example 2
[0032] 1. Expand the sample population of Syringa syringae and further screen the primer sets that can effectively distinguish the samples in Table 2 from the candidate primer sets obtained in Example 1. The PCR reaction system and amplification reaction procedure are the same as in Example 1.
[0033] Table 2 Syringa plant materials
[0034]
[0035]
[0036] The electrophoresis results after amplification (see Appendix Figure 2 ) showed that the psbA-trnH and trnC-petN primer sets could achieve effective amplification and differentiation of the expanded lilac sample population, while the other primer sets could not.
[0037] The specific fragments of all test materials were successfully amplified using psbA-trnH and trnC-petN primers, and the K2P (Kimura-2-parameter) model was used to calculate the genetic distances within and between species. The NJ phylogenetic tree was constructed using MEGA X software, and the bootstrap replications value was set to 1000 to test the support rate of each branch. The sequencing data was further analyzed, and the AT and GC contents of each species were identified using BioEdit software.
[0038] The results showed that after amplification with psbA-trnH and trnC-petN primers, the product length ranged from 336 to 518 bp and 745 to 804 bp, respectively, with an average length of 476 bp and 785 bp, respectively. The sequencing results showed that high-quality amplified sequences were successfully obtained. In psbA-trnH and trnC-petN, the average AT content was 71.44% and 61.85%, respectively, and the GC content was 28.56% and 38.11% (Table 3). Overall, the GC content was lower than the AT content in the two primers, and the GC content of trnC-petN was higher than that of psbA-trnH.
[0039] Table 3 Nucleotide composition of lilac plants based on psbA-trnH and trnC-petN primers
[0040]
[0041]
[0042] In psbA-trnH, the K2P genetic distance ranged from 0.0000 to 0.5656, with an average of 0.1523±0.0044. Similarly, in trnC-petN, the K2P genetic distance ranged from 0.0000 to 0.04770, with an average of 0.0172±0.0004 (see Appendix Figure 3 ). The genetic distance of psbA-trnH is greater than that of trnC-petN, indicating that psbA-trnH is considered to be a barcode region with great potential in plant phylogenetic studies. Using either marker alone could not distinguish all the tested lilac species well. The phylogenetic tree was established using the combination of the two markers, and it was found that 52 materials were clustered into four major categories, with an identification success rate of 88.89%. The combination of the two barcodes can distinguish plants of the genus Syringa.
[0043] 2. The products amplified by the psbA-trnH and trnC-petN primer sets in the previous step were sent to BGI (Beijing BGI Corporation) for bidirectional sequencing.
[0044] After sequencing, SeqMan (DNAStar) was used for splicing to remove low-quality sequences and primer regions at both ends. The obtained sequences were aligned using MEGAX software, with the 84-581st and 29085-29869th positions of the diploid red lilac chloroplast genome (accession number: OL414766.1) as reference, and 52 copies were obtained.
[0045] Genetic information of lilac plants (see Table 4-7).
[0046] psbA-trnH amplified positions 84-581 of OL414766.1, and the sequence information is as follows:
[0047] TCCGCCCCTCTTAGATTTTTTTATTTTAAGACAAAAGGTTTCATTTCGATCATTTCATTTATCTTCTTTCTTATTTCTGAGATATTATTATCTCAGAGATAAAAAGATTAAGCAAAAATTCGAATTTTTCTCGTTTTCATTTGAAATTCAAATTGAAATGTCAAAAAAAACTTCCCAAAAGATGTAAAAATGCATATAGAACGAACAAATAATACTCAATAATCAATCAACCCCTAAGAAAAAGAATCCCCTTTCTTTCTTTTTCGTTAATGTAACGAATAAAAGTCTATGTAAGTACAATATGACTAAAAAAAGTAGTAGTAATTAAAAAGAAAATAAAGGAGCAACAACGCCCTCTTGATAGAACAAGAAAGAGTTTATTGTTCCTTTATTTTCTTTTTTTTTTTCAATAACTCCTATACACTAAAATCGGGTCTTATCCATTTGTAAATGGAGCTTCTATCGAAGCTAGGTCTAGAGGGAAGTTATGAGCATTAC, SEQ ID NO.17;
[0048] The 29,085-29,869 positions of OL414766.1 were amplified by trnC-petN, and the sequence information is as follows:
[0049] GGGTGTCGCCTGATCAACAAAAAGCTCGAAATCTCTTCTTCTCTTCTGTTGATACTTGTTTGATTCTAAGCATCTGGTCTGAGGGTTTTCTAAAAGATTGTGAATCCTTGCATCTAGGATTCAAGGAAATATTCTCCTCTAATGATAGAGGGGCTGTCAAGACTTCATGATTCCCTTCTATTACTAAGGTAGTGTCGAATGACTGGATCTTGAATTAGATTGGAGAGCCTGATAGGAAATCTGATTCAATTAATAGTTGTGGAAAGGGGCGGAAGTTGCTTTATATACGACGGACTCGCGAGAATCTTCGAGTGCTCAGGTATTCAATCAATATTAGATTAGATGGATAATTGACTTTTATAGAAAAAGGGGCAAAAAAATTGCTTTTCGGCAACCCCTAGTCAAGCCCCCCTCTTTCACAGCGATAATCGGGAAAGGGGATACGGATTAGATCAAACAAAGGGGGAAATAGGGGTCTGTAATAGATAGCGATTTCCCCCTTTTTACTTACGAAGGTCAACAAAAACAAAAAAAGAATAGGCCTTATTATTCCTACATGTTCCCATTCCCTTGAGATGTTACTACGTATTTTGCTTGTGTTTAATCTTTCACGATTCAAAAAAGAATCATTTATTGGATTGGTTTCTCAATAGTGTTCGGTCAGAATCCCTTTTTGACTCTGCACCATTGATTCCACTATTATTAGTAAGGAATAATGGAATAATTCCTTCATATTTATAGAGATAGGGGACATAACTCACATGGATATAGTAAGTCTCGCTTGG, SEQ ID NO.18。
[0050] Table 4 Variant site information of 52 Syringa germplasms based on the psbA-trnH marker 1
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057] Table 5 Information on variation sites of 52 lilac germplasms based on psbA-trnH markers 2
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064] Table 6 Information on mutation sites of 52 lilac germplasms based on trnC-petN markers 1
[0065]
[0066]
[0067]
[0068] Table 7 Information on mutation sites of 52 lilac germplasms based on trnC-petN markers 2
[0069]
[0070]
[0071]
[0072] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0073] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A barcode for classifying genus Syringa, characterized in that: The barcode uses the 84th to 581st and 29085th to 29869th positions of the diploid red lilac chloroplast genome sequence with accession number OL414766.1 as reference sequences, and its information is shown in Tables 4 to 7 of the specification.
2. A chloroplast genome barcode-based classification primer set for lilac plants, characterized in that: The primer set consists of psbA-trnH and trnC-petN; the nucleotide sequence of the psbA-trnH is shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of the trnC-petN is shown in SEQ ID NO.3 and SEQ ID NO.
4.
3. A classification method for lilac plants based on chloroplast genome barcoding, characterized in that: The following steps are involved: S1: extracting DNA of the tested lilac plant; S2: using the primer set described in claim 2 to amplify the DNA obtained in S1; S3: Compare the amplification result obtained in S2 with the barcode described in claim 1 and make a determination.
4. The classification method according to claim 3, characterized in that: The S1 also includes testing the concentration, purity and integrity of the DNA.
5. The classification method according to claim 3, characterized in that: The PCR reaction system in S2 is: 2 μL of DNA template, 3 μL of each F / R primer, 25 μL of 2×Taq PCRMasterMix, and ddH2O is added to 50 μL.
6. The classification method according to claim 3, characterized in that: The PCR amplification reaction procedure in S2 is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing for 30 s, extension at 72°C for 45 s, 32 cycles; and finally keeping at 72°C for 8 min and storing at 4°C.
7. Use of the molecular tag according to claim 1, the primer set according to claim 2, or the classification method according to any one of claims 3 to 6 in the classification of plants of the genus Syringa.