Kit for detecting hepatitis delta virus RNA (Ribonucleic Acid) based on RAA-CRISPR-Cas13a
Through the detection method based on RAA-CRISPR-Cas13a, specific RAA primer pairs and crRNA were designed, and combined with LwCas13a protein, the problem of low detection sensitivity and specificity of hepatitis D virus in the prior art was solved, and a high sensitivity D was achieved Hepatitis virus RNA detection.
Patent Information
- Application Number
- CN202311065728.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-23
- Publication Date
- 2025-02-25
AI Technical Summary
The detection sensitivity and specificity of the prior art for hepatitis D virus are not high, and the detection consistency is poor, so more accurate detection methods are needed.
Using the detection method based on RAA-CRISPR-Cas13a, a high sensitivity and high specific detection of RNA of hepatitis D virus was achieved by designing specific RAA primer pairs and crRNAs, and combining LwCas13a protein.
It has achieved high sensitivity detection of RNA of hepatitis D virus, with a sensitivity of 10copy/μL, which has important clinical application value.
Smart Images
Figure BDA0004409284570000051 
Figure BDA0004409284570000061 
Figure BDA0004409284570000062
Abstract
Description
Technical Field
[0001] The present invention relates to a determination or inspection method of an enzyme or a microorganism, and in particular to a kit for detecting hepatitis D virus RNA based on RAA-CRISPR-Cas13a. Background Art
[0002] A composition, characterized in that: the composition comprises a RAA primer pair, and the RAA primer pair consists of primers that specifically amplify a hepatitis D virus genomic RNA fragment containing a nucleotide sequence of SEQ ID No.1.
[0003] Hepatitis D virus (HDV) is a single-stranded negative-strand RNA virus that must attach to hepatitis B virus (HBV) to replicate and spread. Clinical research results show that simultaneous or overlapping infection with HDV and HBV can cause the original condition to worsen, and it is easy to develop into severe hepatitis, cirrhosis, liver fibrosis and liver cancer, which seriously threatens human health. Although my country belongs to a low-prevalence area of HDV, due to the large population base and the large number of chronic HBV infections in my country, it is currently estimated that the total number of HDV infections in my country accounts for 8.8% of the global HDV infection population. It is also the country with the heaviest economic burden due to HDV infection in the world. Therefore, timely and accurate detection of HDV is of great clinical significance. At present, the detection methods for HDV are mainly aimed at its antigens and antibodies, such as enzyme-linked immunosorbent assay, radioimmunoassay and immunoblotting. These methods have low sensitivity and specificity for the detection of HDV clinical samples, and poor consistency, and more accurate detection methods are needed.
[0004] In recent years, detection methods based on CRISPR-Cas technology have developed rapidly and have been widely used in biology, medicine, agriculture and animal husbandry. Cas13a is an RNA-guided CRISPR effector protein that can specifically target and cut single-stranded RNA, and remains active after cutting, continuing to cut other non-target RNAs. This property is called "incidental cutting." Summary of the invention
[0005] The technical problem to be solved by the present invention is: how to quickly detect or identify hepatitis D virus.
[0006] To solve the above technical problems, in a first aspect, the present invention provides a composition, comprising a RAA primer pair, wherein the RAA primer pair consists of primers for specifically amplifying a hepatitis D virus genomic RNA fragment containing a nucleotide sequence of SEQ ID No.1.
[0007] Furthermore, in the composition, the RAA primer pair consists of two single-stranded DNAs with nucleotide sequences of SEQ ID No. 3 and SEQ ID No. 7.
[0008] Furthermore, the composition also includes crRNA, which includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting the hepatitis delta virus RNA target sequence.
[0009] Furthermore, in the composition, the anchor sequence in the crRNA is positions 1-38 of SEQ ID No.8, and the guide sequence is positions 39-66 of SEQ ID No.8.
[0010] Furthermore, in the composition, the nucleotide sequence of the crRNA is SEQ ID No.8.
[0011] In order to solve the above technical problems, in a second aspect, the present invention provides a kit for detecting hepatitis D virus RNA, wherein the kit comprises the above composition.
[0012] Furthermore, the kit also includes Cas13a protein.
[0013] Furthermore, in the kit, the Cas13a protein is LwCas13a protein.
[0014] Furthermore, in the kit, the LwCas13a protein was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.
[0015] Furthermore, the kit also includes all or part of the following reagents for detecting amplification products: NTP (such as NTP Mix), T7 RNA polymerase, RNase inhibitor, fluorescent reporter RNA (RNAse Alert v2, reporter RNA is an RNA molecule with signal reporting function), and RNase free water.
[0016] Furthermore, the kit also includes a buffer and / or ddH2O for specifically amplifying the hepatitis D virus RNA target sequence.
[0017] In order to solve the above technical problems, in a third aspect, the present invention provides any of the following substances:
[0018] A1, the RAA primer pair described in the above composition;
[0019] A2, the crRNA described in the above composition;
[0020] The crRNA and Cas protein described in A3 and A2, or a complex formed by the two.
[0021] Furthermore, in the above-mentioned substance, the Cas protein is Cas13a protein.
[0022] Furthermore, in the above-mentioned substance, the Cas13a protein is LwCas13a protein.
[0023] To solve the above technical problems, in a fourth aspect, the present invention provides the use of the above composition and / or the above substance in any of the following:
[0024] B1. Preparation of products for detecting hepatitis D virus RNA or hepatitis D virus RNA;
[0025] B2. Preparation of products for detecting or assisting in detecting whether a sample to be tested contains hepatitis D virus RNA or preparation of products for detecting or assisting in detecting whether a sample to be tested contains hepatitis D virus RNA;
[0026] B3. Preparing a product for screening a target individual for hepatitis D virus or screening a target individual for hepatitis D virus;
[0027] B4. Preparation of products for diagnosis of hepatitis D or diagnosis of hepatitis D;
[0028] B5. Prepare products for screening or assisting in screening drugs for the prevention and treatment of hepatitis D virus or for screening or assisting in screening drugs for the prevention and treatment of hepatitis D virus.
[0029] To solve the above technical problems, in a fifth aspect, the present invention provides a method for detecting or assisting in detecting hepatitis D virus RNA, the method comprising using the above composition or the above kit to detect whether the sample to be tested is or is a candidate for hepatitis D virus, or / and using the above composition or the above kit to detect whether the sample to be tested contains or is a candidate for containing hepatitis D virus.
[0030] Furthermore, the method comprises the following steps:
[0031] C1) using the nucleic acid of the sample to be tested as a template, first reverse-transcribe it into cDNA, and then perform RAA amplification using a primer pair consisting of single-stranded DNA with nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 7 to obtain an amplified product;
[0032] C2) taking the amplified product obtained in C1) as a template, preparing a CRISPR-Cas13a detection system for reaction, wherein the CRISPR-Cas13a detection system comprises the composition of any one of claims 1 to 5, Cas13a protein, NTP, T7 RNA polymerase, and RNase inhibitor; and replacing the RAA product with water as a negative control; performing fluorescence detection on the system, reading the detection signal, and setting the reaction conditions: 37° C., reading the fluorescence intensity value every 2 min, and reading 30 times;
[0033] C3) detecting the fluorescence intensity of the CRISPR-Cas13a detection system, and determining whether the sample to be tested contains hepatitis D virus RNA according to the fluorescence intensity: if the fluorescence intensity value of the test sample detection system is more than 3 times higher than the fluorescence intensity value of the negative control within the same detection time, the sample to be tested contains or is a candidate for containing hepatitis D virus RNA, otherwise the sample to be tested does not contain or is a candidate for not containing hepatitis D virus RNA.
[0034] Furthermore, in step C1), the reaction conditions for RAA amplification are: 39° C. for 20-40 minutes (eg, 30 minutes).
[0035] Further, in step C2), the CRISPR-Cas13a detection system includes the RAA product, any of the above-mentioned Cas13a proteins, any of the above-mentioned crRNA, NTP, RNase inhibitor, T7 RNA polymerase, and reporter RNA.
[0036] Furthermore, in step C3), the reaction conditions are: 37° C., reading the fluorescence intensity value every 2 minutes, and reading 30 times.
[0037] Furthermore, the sample to be tested may be a blood sample, an organ (such as liver, spleen, kidney, etc.) tissue sample or a cell, etc.
[0038] The method for detecting or assisting in detecting hepatitis D virus RNA provided by the present invention can be a non-disease diagnosis and treatment method or a disease diagnosis and treatment method. The non-disease diagnosis and treatment method can be, for example, to detect whether hepatitis D virus RNA is contained in cells before and after the use of drugs when screening drugs for preventing and treating hepatitis D virus RNA at the cell level.
[0039] The beneficial technical effects achieved by the present invention are as follows:
[0040] The present invention is based on CRISPR-Cas13a nucleic acid detection technology. Through design, construction and screening, the present invention finally provides a RAA amplification primer pair for hepatitis D virus RNA detection, a target sequence to be detected and a specific crRNA that can target the target sequence. The crRNA can achieve high-sensitivity and high-specificity detection of hepatitis D virus RNA by activating Cas13a, with a sensitivity of 10 copy / μL, and has important application value in the field of detection and identification of hepatitis D virus. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] Figure 1 This is a conservation analysis of the nucleic acid sequences of the upstream and downstream primers of RAA.
[0042] Figure 2 Agarose gel electrophoresis for RAA primer screening.
[0043] Figure 3 This is a conservation analysis of crRNA sequences.
[0044] Figure 4 This is a graph of crRNA screening results.
[0045] Figure 5 This is a graph showing the sensitivity results of hepatitis D virus target sequence detection.
[0046] Figure 6 This is a graph showing the specificity results of hepatitis D virus target sequence detection. DETAILED DESCRIPTION
[0047] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0048] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0049] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.
[0050] Reagents required in the following examples:
[0051] RAA detection kit (Hangzhou Zhongce Biotechnology Co., Ltd., S003ZC), HiScribe T7 fast and efficient RNA synthesis kit (New England Biolabs, USA, E2050S), RNA purification magnetic beads (AgencourtRNACleanXP, Beckman Coulter, A63987), rNTP (New England Biolabs, USA, N0466S), Murine RNase inhibitor (New England Biolabs, USA, M0314L), LwCas13a protein (Hangzhou Zhongce Biotechnology Co., Ltd., R101ZC), T7 RNA polymerase (New England Biolabs, USA, M0251S), RNAse Alert v2 (Thermofisher Technology Co., Ltd., USA, 4479769), RNase-free H2O (Beijing Bomade Gene Technology Co., Ltd., RA114-01).
[0052] Example 1. Design and screening of RAA primers used in the present invention
[0053] 1. Analysis of Conserved Region Sequences and Preparation of Plasmid Standards
[0054] In the Hepatitis D Virus Database ( https: / / hdvdb.bio.wzw.tum.de / hdvdb / ) Download 8 All sequence information of HDV genotypes was compared using MEGA11 software, and the conserved sequence was SEQ ID No. 1. The plasmid standard synthesized by Beijing Biomed Gene Technology Co., Ltd. was named HDV RNA, and the copy number calculation formula was: copies / μL = 6.02×10 23 × concentration (ng / μL) × 10 9 / plasmid length × 660. The structure of the plasmid standard HDV RNA is: a recombinant vector obtained by inserting the DNA fragment shown in SEQ ID No. 1 into the EcoRV restriction site of the pUC57 vector and keeping the other nucleotide sequences of the pUC57 vector unchanged.
[0055] SEQ ID No.1(5'-3'):tggccggcatggtcccagcctcctcgctggcgccggctgggcaacattccgaaggggaccgtccctcggtaatggcgaatgggacccagaactctctttagattccc agagagaatcaagagaaaactggctctcccttagccatccgagtggacgtccgtcctccttcggatgcccaggtcggaccgcggggaggtggagatgccatgccgacccgaagaggaa;
[0056] 2. Design of RAA Primers
[0057] Then, according to the RPA primer design principles (reference PMID: 27246147), the conservation analysis of RAA primer sequences was as follows: Figure 1 As shown, there is a T7 transcription sequence at the 5' end of the primer, so that the double-stranded DNA (dsDNA) amplified by RAA can be recognized and transcribed by T7 RNA polymerase (see Table 1). The sequence was synthesized by Shanghai Sangon Co., Ltd.
[0058] Table 1. RAA amplification primers for detecting HDV DNA
[0059] name Sequence (5'-3') HDV RNA-F1 aattctaatacgactcactatagggtggccggcatggtcccagcctcctcgctgg(SEQ ID No.2) HDV RNA-F2 aattctaatacgactcactataggggccggcatggtcccagcctcctcgctggcg(SEQ ID No.3) HDV RNA-F3 aattctaatacgactcactatagggggcatggtcccagcctcctcgctggcgccg(SEQ ID No.4) HDV RNA-R1 gtccactcggatggctaagggagagccagt(SEQ ID No.5) HDV RNA-R2 ggacgtccactcggatggctaagggagagc(SEQ ID No.6) HDV RNA-R3 acggacgtccactcggatggctaagggaga(SEQ ID No.7)
[0060] 3. RAA Amplification
[0061] The copy number of the plasmid standard HDV RNA was calculated and then serially diluted to: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL. The diluted plasmid was used as a template and amplified with the RAA primers designed in Table 1. The RAA amplification system is shown in Table 2. The prepared system was mixed upside down in the dry powder tube, centrifuged briefly, and placed in a metal bath, set at 39°C for reaction for 30 minutes. After the amplification was completed, it was taken out and stored at 4°C for later use.
[0062] Table 2. RAA amplification system
[0063]
[0064]
[0065] Note: A Buffer is buffer solution, B Buffer is magnesium acetate.
[0066] 4. Screening of RAA Primers
[0067] Take the gradient dilution of plasmid standard 10 3 copies / μL was used as a template, and three upstream primers and three downstream primers were paired in pairs. The amplification was performed using the above RAA amplification method, and the amplification products were detected by agarose gel electrophoresis. The results were as follows: Figure 2 As shown in the results, the combination of F2 and R3 (i.e., SEQ ID No. 3 and SEQ ID No. 7) has a higher amplification efficiency. Therefore, the primer pair of F2 and R3 was selected as the optimal primer for subsequent RAA amplification for detecting HDV RNA.
[0068] Example 2. Design and screening of crRNA for use in the present invention
[0069] 1. Design of crRNA
[0070] According to the crRNA design principles (reference PMID: 27246147) and the position of the above-mentioned optimal primer pair, the conservation analysis of the crRNA sequence is as follows Figure 3 As shown, the present invention designs 4 crRNAs in the HDV RNA conserved sequence. The crRNA sequence is composed of a repetitive sequence at the 5' end and a reverse complementary sequence of the target sequence at the 3' end. The repetitive sequence is 39nt: 5'-GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAA-3', which can bind to the LwCas13a protein. In this study, crRNA was obtained by T7 in vitro amplification transcription. The upstream sequence of the amplified and transcribed crRNA sequence is the T7 promoter sequence (5'-TAATACGACTCACTATAG-3') and a partial repetitive sequence (5'-GGGATTTAGACTACCCCAA-3'), and the downstream sequence is the first 20nt of the target sequence. See Table 3 for the specific sequence. The sequence was synthesized by Shanghai Bioengineering Co., Ltd.
[0071] Table 3. Preparation of crRNA and T7 amplified transcript sequences for detecting HDV RNA
[0072]
[0073]
[0074] 2. PCR Amplification
[0075] The synthesized sequence was diluted to 10 μM with ddH2O, and the PCR reaction system was prepared according to Table 4.
[0076] Table 4. PCR amplification system
[0077] name volume HDV-crRNA 2μL T7-crRNA-F 2μL HDV-crRNA-R 2μL 2×Taq PCR MasterMix 25μL <![CDATA[ddH2O]]> 19μL Total volume 50μL
[0078] PCR reaction conditions: 95℃5min thermal denaturation; 95℃30s, 55℃30s, 72℃15s, 38 cycles; 72℃ automatic extension for 10min. After amplification, the PCR product was stored at 4℃.
[0079] 3. Purification of PCR Products
[0080] The above PCR product was purified, and the specific steps were as follows: 500 μL Tris balanced phenol (Hao-like biological) and an equal volume of chloroform were added to a centrifuge tube, oscillated and mixed, and then briefly centrifuged (12,000rpm, 10sec), and the supernatant was discarded to obtain a mixed solution; 150 μL of the mixed solution was added to the PCR product, oscillated and mixed, and then placed in a centrifuge, centrifuged at 12,000rpm for 10min; 30 μL of the supernatant was placed in a new centrifuge tube, 70 μL of anhydrous ethanol was added, oscillated and mixed, and then placed in a centrifuge, centrifuged at 12,000rpm for 10min, and the supernatant was discarded; 200 μL of 75% ethanol was added, placed in a centrifuge, centrifuged at 12,000rpm for 10min, and the supernatant was discarded (this step was repeated three times). The obtained white precipitate was dried at room temperature (no liquid residue), 50 μL of ddH2O was added, the concentration was detected using a Nanodrop instrument, and it was stored at -20°C to obtain the purified PCR product.
[0081] IV. T7 in vitro transcription
[0082] Take 1 μg of the purified PCR product obtained in step 3 and transcribe the purified PCR product into crRNA using the HiScribe T7 Fast and Efficient RNA Synthesis Kit. The transcription system is shown in Table 5.
[0083] Table 5. T7 in vitro transcription system of crRNA
[0084] name volume NTP Mix 10μL 6.7mM each NTP final PCR product (step 3) (1.5μL) T7 RNA polymerase 2μL <![CDATA[RNase-free H2O]]> 6.5μL Total volume 20μL
[0085] After mixing the above T7 in vitro transcription system, put it in a water bath and incubate it at 37°C overnight to obtain the transcription product; add 20 μL RNase-free H2O to the transcription product, then add 2 μL DNaseⅠ (for removing excess DNA), mix well, and incubate at 37°C for 15 minutes to obtain crRNA.
[0086] 5. Purification of crRNA
[0087] Purify the crRNA obtained by the above transcription according to the Agencourt RNA Clean XP instructions (Beckman Coulter). The specific steps are as follows: shake the magnetic beads in the bottle to mix, add 1.8 times the volume of magnetic beads to the centrifuge tube containing the transcription product, gently blow 10 times to mix, and let it stand at room temperature for 3 minutes. Place the centrifuge tube in the magnetic rack and let it stand for 10 minutes. The magnetic beads are adsorbed on the wall of the tube. Gently aspirate the liquid in the tube to prevent the magnetic beads from being aspirated. Add 200μL 70% ethanol (prepared with RNase-free H2O) to the centrifuge tube, incubate at room temperature for 30s, and discard (repeat this process 3 times to wash the magnetic beads). Dry the centrifuge tube at room temperature and remove the residual liquid in the tube. Add 50 μL RNase-free H2O, pipette 10 times to mix, put it into the magnetic rack, aspirate the clear liquid after the magnetic beads adhere to the wall, put it into a new centrifuge tube, measure the concentration of the purified crRNA with the Nanodrop instrument, dilute it to 100 ng with RNase-free H2O, and place it at -80℃ for aliquoting.
[0088] 6. Screening of crRNA
[0089] 1. Take the gradient diluted plasmid standard HDV RNA 10 3 copies / μL was used as a template, and RAA amplification was performed using the best primers and method screened in Example 1 to obtain RAA amplification products.
[0090] 2. Take 5 μL of RAA amplified product and detect it using different crRNAs according to the method in Example 3, and set the amplified product with water as the template as a negative control.
[0091] 3. Test results Figure 4 As shown, the results showed that the fluorescence values of the four crRNA tests were statistically different from those of the negative control, P < 0.0001. HDV-crRNA1 with the highest fluorescence value was selected as the crRNA for CRISPR-Cas13a to detect hepatitis D virus RNA, and the sensitivity and specificity of the detection method were further evaluated. Figure 4 Middle A: Fluorescence value change curve of 4 crRNA detection within 60 minutes; Figure 4 Middle B: Fluorescence intensity values of four crRNAs detected at 60 minutes; compared with the negative control group, **** means P < 0.0001, ** means P < 0.05. NC is the negative control.
[0092] Example 3, establishment of RAA-CRISPR-Cas13a method for detecting HDV RNA
[0093] 1. Preparation of CRISPR-Cas13a detection system
[0094] 5 μL of the RAA amplification product in Example 1 was taken as a template for CRISPR-Cas13a detection, and the configuration system was shown in Table 6. At the same time, water was set as a template as a negative control.
[0095] Table 6. CRISPR-Cas13a detection system
[0096] name Dosage template 5μL LwCas13a protein 45nM NTP Mix 1μL 1mM each NTP final T7 RNA polymerase 0.4μL Murine RNase inhibitor 1μL crRNA 22.5nM RNAse Alert v2 125nM <![CDATA[RNase-free H2O]]> Up to 25μL Total volume 25μL
[0097] 2. Fluorescence intensity detection
[0098] The reaction system prepared above was placed in a fluorescent quantitative PCR instrument. The reaction conditions were: 37°C, and the fluorescence intensity value was read every 2 minutes for 30 times.
[0099] Result determination: Within the same detection time, the fluorescence intensity value of the experimental group was significantly higher than that of the negative control (ddH2O). After statistical analysis, there was a statistical difference between the fluorescence intensity values of the three repeated experiments and the negative control.
[0100] Example 4: Sensitivity test of the method of the present invention
[0101] The method in Example 1 was used to perform RAA amplification on the gradient diluted plasmid standard HDV RNA, and the concentrations after dilution were: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 The product amplified according to the method in Example 3 was tested to detect the sensitivity of the method of the present invention. The specific steps are as follows:
[0102] 1. Perform RAA amplification on the gradient diluted HDV RNA plasmid according to the primers and method of Example 1 to obtain RAA amplification products of different concentrations. The concentrations of the diluted HDV RNA plasmids are: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.
[0103] 2. Take 5 μL of RAA amplification product and use the CRISPR-Cas13a system for detection according to the method in Example 3, and set the amplification product with water as the template as a negative control.
[0104] Test results such as Figure 5 As shown, the CRISPR-Cas13a system detects 10 1 The fluorescence signal of the plasmid amplification product with 0.1447 copies / μL was statistically significant compared with the negative control, p<0.05, and the fluorescence values of the positive plasmid samples with other concentrations were all less than 0.0001 compared with the negative control. Figure 5 Middle A: Line graph showing the fluorescence value changes of the CRISPR-Cas13a system detecting plasmids of different concentrations within 60 minutes; Figure 5 Middle B: At 60 minutes, the fluorescence intensity values of each concentration of plasmid detected by CRISPR-Cas13a system were compared with the negative control group, *** is P < 0.001, ** is P < 0.05. NC is the negative control. It can be concluded that the sensitivity of RAA-CRISPR-Cas13a in detecting hepatitis D virus plasmid is 10 copies / μL.
[0105] Example 5: Specificity detection of the method of the present invention
[0106] 1. Using hepatitis D virus (HDV), hepatitis B virus (HBV), hepatitis E virus (HEV), forest encephalitis virus (TBEV) and human immunodeficiency virus (HIV) pathogenic nucleic acids as detection templates, different viral nucleic acids were detected according to the method in Example 3 to verify the specificity of the method of the present invention. The specific steps are as follows:
[0107] 1. Using hepatitis D virus (HDV), hepatitis B virus (HBV), hepatitis E virus (HEV), forest encephalitis virus (TBEV) and human immunodeficiency virus (HIV) nucleic acid plasmids as detection templates, RAA amplification was performed according to the primers and method of Example 1 to obtain RAA amplification products.
[0108] Among them, the nucleic acid plasmids of hepatitis B virus (HBV), hepatitis E virus (HEV), forest encephalitis virus (TBEV) and human immunodeficiency virus (HIV) were synthesized by Beijing Bomade Gene Technology Co., Ltd., and the vector (backbone vector) was pUC57, and the structure was: the conservative sequences of the four viruses were constructed into the EcoRV restriction site of the pUC57 vector, and the other nucleotide sequences of the pUC57 vector were kept unchanged. The conservative sequence of hepatitis B virus (HBV) is SEQ ID No.13, the conservative sequence of hepatitis E virus (HEV) is SEQ ID No.14, the conservative sequence of forest encephalitis virus (TBEV) is SEQ ID No.15, and the conservative sequence of human immunodeficiency virus (HIV) is SEQ ID No.16.
[0109] Table 7. Conserved sequences of viruses
[0110]
[0111]
[0112] 2. Take 5 μL of RAA amplification product respectively, and use the CRISPR-Cas13a system to detect each viral nucleic acid according to the method in Example 3, and set the amplification product with water as the template as a negative control.
[0113] Test results such as Figure 6 As shown, the fluorescence signal of HDV detected by the CRISPR-Cas13a system was statistically significant compared with the negative control, P < 0.0001, and the fluorescence signal of other viral nucleic acids was not statistically significant compared with the negative control. Figure 6 Middle A: Line graph showing the fluorescence value changes of the CRISPR-Cas13a system detecting viral nucleic acid plasmids within 60 minutes; Figure 6 Middle B: At 60 minutes, the fluorescence intensity values of plasmids at various concentrations detected by the CRISPR-Cas13a system were compared with the negative control group, **** is P < 0.0001. NC is the negative control. It can be concluded that RAA-CRISPR-Cas13a has good specificity in detecting hepatitis D virus plasmids.
[0114] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.
Claims
1. A composition, characterized in that: The composition comprises a RAA primer pair, which consists of primers for specifically amplifying a hepatitis D virus genome RNA fragment containing a nucleotide sequence of SEQ ID No.
1.
2. The composition according to claim 1, characterized in that: The RAA primer pair consists of two single-stranded DNAs with nucleotide sequences of SEQ ID No.3 and SEQ ID No.
7.
3. The composition according to claim 1 or 2, characterized in that: The composition also includes crRNA, which includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting a hepatitis delta virus RNA target sequence.
4. The composition according to claim 3, characterized in that: In the crRNA, the anchor sequence is positions 1-38 of SEQ ID No.8, and the guide sequence is positions 39-66 of SEQ ID No.
8.
5. The composition according to claim 3 or 4, characterized in that: The nucleotide sequence of the crRNA is SEQ ID No.
8.
6. A kit for detecting hepatitis D virus RNA, characterized in that: The kit comprises the composition according to any one of claims 1 to 5.
7. The kit according to claim 6, characterized in that: The kit also includes Cas13a protein.
8. Any of the following substances: A1, the RAA primer pair described in any one of claims 1-5; A2, the crRNA described in the composition of claim 3 or 4; The crRNA and Cas protein described in A3 and A2, or a complex formed by the two.
9. Use of the composition according to any one of claims 1 to 5 or / and the substance according to claim 8 in any of the following: B1. Preparation of products for detecting hepatitis D virus RNA or hepatitis D virus RNA; B2. Preparation of products for detecting or assisting in detecting whether a sample to be tested contains hepatitis D virus RNA or preparation of products for detecting or assisting in detecting whether a sample to be tested contains hepatitis D virus RNA; B3. Preparing a product for screening a target individual for hepatitis D virus or screening a target individual for hepatitis D virus; B4. Preparation of products for diagnosis of hepatitis D or diagnosis of hepatitis D; B5. Prepare products for screening or assisting in screening drugs for the prevention and treatment of hepatitis D virus or for screening or assisting in screening drugs for the prevention and treatment of hepatitis D virus.
10. A method for detecting or assisting in detecting hepatitis D virus RNA, the method comprising using the composition described in any one of claims 1 to 5 or the kit described in claim 6 or 7 to detect whether the sample to be tested is or is a candidate for hepatitis D virus, or / and using the composition described in any one of claims 1 to 5 or the kit described in claim 6 or 7 to detect whether the sample to be tested contains or is a candidate for containing hepatitis D virus.