PCR (Polymerase Chain Reaction) primer, probe and detection method for detecting Acamovirus infectivity

Abstract

The invention relates to the field of detection of AKV, in particular to a PCR (polymerase chain reaction) primer, a probe and a detection method for rapidly detecting AKV infectivity. The invention relates to a group of qPCR (quantitative polymerase chain reaction) compositions for detecting Akal spot virus. The qPCR compositions comprise the following primers and probes matched with the primers for use, wherein the upstream primer is a nucleotide sequence as shown in SEQ ID No.3; the downstream primer is a nucleotide sequence as shown in SEQ ID No.4; the nucleotide sequence of the probe is as shown in SEQ ID No.2. According to the PCR primer, the probe and the detection method for detecting the infectivity of the Acamovirus, whether a sample contains the Acamovirus or not can be efficiently and rapidly detected by utilizing the qPCR composition, and the detection sensitivity and the specificity are high.

Description

Technical Field

[0001] The present invention relates to the field of Akaba virus detection, and more specifically to a PCR primer and probe for rapidly detecting Akaba virus infectivity and a detection method. Background Art

[0002] Akabane Virus (AKAV) is a member of the Bunyaviridae family, the Orthobunyavirus genus. The virus particles are spherical, with an envelope and a diameter of 90 to 100 nm. There are glycoprotein spikes on the surface. The virus contains single-stranded RNA, which is composed of three molecules: large, medium and small. They form a spiral nucleocapsid with nucleocapsid protein, and the diameter of the nucleocapsid is 2 to 3 nm. The virus contains 4 structural proteins, G1, G2, N, and L. G1 and G2 are glycoproteins with hemagglutinin activity and neutralizing antigen sites, and determine the virulence of the virus. N is a nucleoprotein with complement binding antigen sites. L is a polymerase protein with replication and transcription activity.

[0003] Akabanedisease, also known as Akabane disease, is a viral infectious disease of cattle and sheep characterized by miscarriage, premature birth, stillbirth, fetal malformation, mummification, and Arthrogryposis-Hydranencephaly Syndrome (AH syndrome) in newborns. AH syndrome first broke out in Australian sheep in the 1930s, and in Japan in the late 1940s, but its pathogen was unknown for a long time until the virus was isolated from Aedes and Culex mosquitoes in Akabane Village, Gunma Prefecture, Japan in 1961. It was named Akabane disease virus, also known as Akabanedisease virus. It was subsequently confirmed that the pathogen of AH syndrome prevalent in Australia, Africa and the Middle East was also this virus. The prevalence of this disease poses a huge threat to the development of cattle and sheep farming, and has attracted widespread attention.

[0004] At present, the established methods for Akaban virus detection include virus isolation and identification, virus antigen detection and virus nucleic acid detection. Among them, the isolation and identification test cycle of Akaban virus is long and not suitable for rapid detection. The fluorescent antibody test is fast and accurate, but the sensitivity is low and false negative results are prone to occur; the conventional PCR method has high specificity and low cost, but low sensitivity; the fluorescent quantitative PCR technology has the advantages of high efficiency, high sensitivity and strong specificity, and has been applied in the detection of Akaban virus nucleic acid.

[0005] Therefore, in view of this, the existing structure is studied and improved, and PCR primers and probes and detection methods for detecting the infectivity of Akabane virus are proposed to solve the above-mentioned problems. Summary of the invention

[0006] The PCR primers and probes and the detection method for detecting the infectivity of Akaban virus of the present invention can efficiently and quickly detect whether the sample contains Akaban virus by using the qPCR composition, and the detection has high sensitivity and strong specificity.

[0007] In order to solve the above problems, the present invention proposes a technical solution: PCR primers and probes for detecting the infectivity of Akaba virus and a detection method, a set of qPCR compositions for detecting Akaba virus, including the following primers and probes used in conjunction with the primers:

[0008] The upstream primer is the nucleotide sequence shown in SEQ ID No.3;

[0009] The downstream primer is the nucleotide sequence shown in SEQ ID No.4;

[0010] The probe is the nucleotide sequence shown in SEQ ID No.2.

[0011] Preferably, the probe is labeled with FAM at the 5' end and with MGB-BHQ at the 3' end.

[0012] Preferably, the primer experiment includes a positive control, and the positive control is a recombinant plasmid including the N gene sequence.

[0013] Preferably, the detection method comprises:

[0014] Extracting genomic RNA from samples;

[0015] Reverse transcription into cDNA;

[0016] Preparing a qPCR reaction system, the reaction system comprising the qPCR composition as described above;

[0017] Transfer the prepared qPCR reaction system to a qPCR tube and perform qPCR amplification reaction;

[0018] Result determination.

[0019] Preferably, the concentrations of the N gene upstream primer and the N gene downstream primer in the qPCR reaction system are both 1 μM, and the concentration of the probe is 0.25 μM.

[0020] Due to the adoption of the above technical solution, the PCR primers and probes and the detection method for detecting the infectivity of Akabane virus of the present invention have the following beneficial effects:

[0021] The qPCR composition provided by the present invention and the method for detecting Akaban virus using the qPCR composition are products and methods for detecting Akaban virus gene N. Since the transcript of the N gene can be detected in the blood of infected animals in the early stage of virus infection, and the encoded product of the N gene is also an immunologically significant antigen of Akaban virus, and the gene also has a high sequence conservation, the N gene is used as an early detection target gene for Akaban virus, and Akaban virus can be detected earlier and more timely.

[0022] In addition, the qPCR composition provided by the present invention can efficiently and quickly detect whether a sample contains Akabane virus, and the detection sensitivity is high and the specificity is strong. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0024] Figure 1 The invention discloses PCR primers and probes for detecting the infectivity of Akaba virus and the specificity test results of the Akaba virus detection target gene N primer pair and probe in the detection method.

[0025] Figure 2 The invention discloses a PCR primer and a probe for detecting the infectivity of Akabane virus and an amplification curve of qPCR using different annealing temperatures in the detection method.

[0026] Figure 3 The invention discloses a PCR primer and a probe for detecting the infectivity of Akabane virus and an amplification curve of qPCR performed by selecting primers and probes of different concentrations in the detection method.

[0027] Figure 4 It is the sensitivity test result of detecting the target gene AKAV-N in the PCR primers and probes for detecting the infectivity of Akabane virus and the detection method of the present invention.

[0028] Figure 5 It is the clinical sample detection result in the PCR primers and probes for detecting the infectivity of Akabane virus and the detection method of the present invention. DETAILED DESCRIPTION

[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Examples are shown to illustrate certain embodiments of the present invention and should not be construed as limiting the scope of the present invention. The disclosure of the present invention can be improved in terms of materials, methods and reaction conditions at the same time, and all these improvements should fall within the spirit and scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The reagents and biological materials, if not otherwise specified, can be obtained from commercial sources.

[0031] Example 1: Establishment of a rapid fluorescence quantitative PCR detection method for Akabane virus

[0032] 1. Establishment of a rapid fluorescence quantitative PCR detection method for Akaban virus

[0033] 1. Design and screening of PCR primers and probes for detecting the copy number of AKAV characteristic sequence N nucleic acid

[0034] The present application designs two specific primers and probes based on the conservative and stable N gene sequence in the Akaban virus genome. The specific method is: download all nucleic acid sequences of the AKAVN gene from NCBI GenBank (as shown in SEQ ID NO.4), perform homology comparison analysis, and search for the conservative sequence of the N gene. Design specific primers and target probes in the N conservative nucleic acid sequence region. The primers used in this embodiment to detect the conservative nucleic acid sequence of the specific target gene N are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence is shown in SEQ ID NO.3.

[0035] SEQ ID NO.1 Forward primer sequence: 5'-GATGTTCCACAACGGAAT-3'

[0036] SEQ ID NO.2 Reverse primer sequence: 5'-TGGGGAAAATGGTTATTAAC-3'

[0037] SEQ ID NO.3 Probe sequence: FAM-5'-GAGTCTTCTTCCTCAA-3-MGB-BHQ

[0038] SEQ ID NO.4:

[0039] atggcaaatcaatttattttcaacgatgttccacaacggaatgcagctacatttaatccggatgcagggtatgtggcattt

[0040] atcagtaagtatgggcagcagctcaacttcactgttgctagagtcttcttcctcaaccagaagaaggccaagatggtctta

[0041] cataagacgccacaaccaagtgtcgatcttacttttgcaggggtcaaatttacagtggttaataaccattttccccagtac

[0042] actgcaaacccagtgtcagacactgcctttacgctccatcgcatctcgggctacctagctcgctggattgctgagcagtgc

[0043] aaagctaatcagatcaaacttgcagaggcagctgctacaattgtgatgccgctggctgaagtgaagggttgcacctggagt

[0044] gatgggtatgcaatgtacctagggttcgcccctggtgctgagatgtttctggaaacttttgagttttacccactggttatc

[0045] gacatgcaccgtgtgataaaggacgggatggatgtcaacttcatgaggaaggtcttacgccagaggtatgggcagctgact

[0046] gcagaggaatggatgacatctaagttggacgcagtcaaggctgcatttaactcagttgcccagatatcctgggccaaatct

[0047] ggcttctcacctgcagctagagctttcttggctcaatttggtattcagatctaa

[0048] 2. qPCR Reaction System

[0049] Table 1 qPCR Reaction System

[0050] Components volume Taq DNA polymerase 0.5μl 10×buffer 2μl dNTP(2.5mM) 1.6μl AKAV-N-Forward (10μM) 1μl AKAV-N-Reverse (10μM) 1μl AKAV-N-Probe (10μM) 0.25μl Template DNA 5μl Sterilized water 8.65μl

[0051] The 10× buffer contains: 200mM Tris-HCl (pH 8.3), 200mM KCl, 100mM (NH4)2SO4, 20mM MgSO4 and 5% NP 40 .

[0052] 3. qPCR reaction conditions

[0053] The qPCR reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles. Each cycle included denaturation at 95°C for 5 seconds, annealing at 60°C for 30 seconds, and collecting the signal of the FAM fluorescence channel. After the cycle was completed, the reaction was terminated.

[0054] 2. Primer and probe specificity test for qPCR detection of AKAV-N

[0055] In this implementation, bovine rotavirus, bovine viral diarrhea virus, bovine coronavirus and bovine infectious rhinotracheitis virus were selected as experimental subjects.

[0056] The above samples were extracted with nucleic acid using Tiangen Nucleic Acid Extraction Kit and reverse transcribed into cDNA using Tiangen Reverse Transcription Kit, and then used as templates for qPCR verification of the specificity of the designed primers and probes according to the reaction system in Table 1 and the above reaction conditions. The qPCR amplification curve is shown in Figure 1 As shown, the amplification Ct value using nucleic acid of other viruses as template is greater than 40 and there is no typical amplification curve, indicating that the primer and probe design has strong specificity and can be used for the detection of AKAV-N.

[0057] 3. Optimization experiment of annealing temperature of AKAV-N primers and probes

[0058] In this example, pUC57-AKAV-N linearized plasmid was selected as a template, and the primers shown in SEQ ID NO.1-2 and the probe shown in SEQ ID NO.3 were used to optimize the annealing temperature of AKAV-N primers and probe according to the experimental conditions shown in Table 2.

[0059] Table 2 Grouping of optimization experiments for AKAV-N annealing temperature

[0060] Experimental groups 1 2 3 4 5 6 7 8 Annealing temperature 53.0℃ 53.5℃ 54.0℃ 55.0℃ 56.3℃ 57.5℃ 58.5℃ 59.8℃

[0061] Figure 2 It is the amplification curve of qPCR using different annealing temperatures. Figure 2 It shows that the CT value is the lowest when the annealing temperature is 55℃, so the best annealing temperature is 55℃.

[0062] IV. Optimization experiment of AKAV-N primer and probe concentration

[0063] In this example, pUC57-AKAV-N linearized plasmid was selected as a template, and qPCR was performed with the primers shown in SEQ ID NO.1-2 and the probe shown in SEQ ID NO.3 at concentrations of 1 μM, 1 μM, and 0.25 μM, respectively. The concentrations of AKAV-N primers and probes were optimized according to the experimental conditions shown in Table 2.

[0064] Table 3 Grouping of optimization experiments for AKAV-N primer and probe concentrations

[0065] Experimental groups Forward primer (μM) Reverse primer (μM) Probe (μM) 1 0.5 0.5 0.5 2 1.0 1.0 1.0 3 1.0 1.0 0.5 4 1.0 1.0 0.25 5 0.5 0.5 0.25 6 0.5 0.5 1

[0066] Figure 3 It is the amplification curve of qPCR using different concentrations of primers and probes. Figure 3 This indicates that the CT value is lowest when the primer concentration is 1 μM and the probe concentration is 0.25 μM, so the optimal primer concentration is 1 μM and the optimal probe concentration is 0.25 μM.

[0067] 5. qPCR detection of AKAV-N sensitivity test

[0068] The linearized pUC57-AKAV-N plasmid was diluted 10 times with sterile water and used as a template. The sensitivity test was carried out using the optimal qPCR reaction system and reaction conditions, and a standard curve equation of AKAV-N copy number and Ct was constructed. Figure 4 The results showed a typical amplification curve with a good linear relationship (R 2 =1.0), indicating that the primers and probe are feasible for detecting AKAV-N. The curve equation is y=-5.225x+8.279, and the minimum detection limit is 10 copies / μl.

[0069] 6. qPCR detection of AKAV-N clinical samples

[0070] Twenty AKAV serum antibody-negative experimental cattle were included, of which four were artificially infected with laboratory-preserved AKAV. Serum was collected 4 days after infection, nucleic acid was extracted and reverse transcribed, and the experiment was carried out using the optimal qPCR reaction system and reaction conditions. Figure 5 The results showed that the curve was detected in all four artificially infected cows, while the other negative cows had no curve.

[0071] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. PCR primers and probes for detecting the infectivity of Akaban virus and a detection method, a set of qPCR compositions for detecting Akaban virus, comprising the following primers and probes used in conjunction with the primers: The upstream primer is the nucleotide sequence shown in SEQ ID No.3; The downstream primer is the nucleotide sequence shown in SEQ ID No.4; The probe is the nucleotide sequence shown in SEQ ID No.

2.

2. The PCR primers and probes and the detection method for detecting the infectivity of Akabane virus according to claim 1, characterized in that: The probe was labeled with FAM at the 5' end and with MGB-BHQ at the 3' end.

3. The PCR primers and probes and the detection method for detecting the infectivity of Akabane virus according to claim 1, characterized in that: The experiment of the primers includes a positive control, which is a recombinant plasmid including the N gene sequence.

4. The PCR primers and probes and the detection method for detecting the infectivity of Akabane virus according to claim 1, wherein the detection method comprises: Extracting genomic RNA from samples; Reverse transcription into cDNA; Preparing a qPCR reaction system, the reaction system comprising the qPCR composition as described above; Transfer the prepared qPCR reaction system to a qPCR tube and perform qPCR amplification reaction; Result determination.

5. The PCR primers and probes and the detection method for detecting the infectivity of Akabane virus according to claim 4, characterized in that: The concentrations of the N gene upstream primer and the N gene downstream primer in the qPCR reaction system were both 1 μM, and the concentration of the probe was 0.25 μM.

Images