FLNB gene knockout MDCK cell strain as well as construction method and application thereof

Abstract

The invention provides an FLNB gene knockout MDCK cell strain as well as a construction method and application thereof. The FLNB gene knockout cell strain is named as MDCK-FLNB-KO, and is preserved in the China Center for Type Culture Collection on November 20, 2024, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: C2024391. Wherein the FLNB gene knockout utilizes a CRISPR / Cas9 technology, sgRNA is designed for a first exon of an FLNB gene of an MDCK cell, and a FLNB gene knockout vector plasmid 1 and a plasmid 2 are constructed; and transfecting the plasmid 1 and the plasmid 2 into the MDCK cell to obtain the FLNB gene knockout MDCK cell strain. Compared with an original MDCK cell strain, the cell strain has the advantages that the adhesion capacity is reduced, and the yield is higher when the cell strain is applied to influenza virus culture.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an FLNB gene knockout MDCK cell strain and a construction method and application thereof. Background Art

[0002] MDCK cells (Madin-Darby Canine Kidney cells) are a cell line isolated from canine kidney tissue. MDCK cells grow fast, have strong adaptability, are easy to culture, and can survive under different culture medium conditions. MDCK cells have become an ideal cell line for culturing influenza viruses because of the presence of a large number of receptors sensitive to influenza viruses on the cell surface. However, natural MDCK cells have strong adhesion, high agglomeration rate, and long digestion time, which are not conducive to cell culture and large-scale production. The acclimated suspension cells have a higher generation, increased cell tumorigenicity, unclear mechanism, and the risk of reversible acclimation, which is not conducive to their application in the influenza vaccine manufacturing industry. FLNB (Filamin B) expresses filament protein B, which is an actin-binding protein mainly located in the cytoplasm. Its structure is formed by non-covalent binding of two homologous subunits. FLNB participates in the construction, maintenance and dynamic changes of the cytoskeleton through interaction with other cytoskeletal proteins, and can also mediate signal transduction with adhesion molecules, which is of great significance for cell morphology, adhesion and migration. Therefore, this study used CRISPR-Cas9 gene editing technology to construct a FLNB gene-knockout MDCK cell line with low adhesion ability, which is of great significance for promoting the better application of MDCK cells in the manufacture of influenza vaccines. Summary of the invention

[0003] In view of this, the present invention provides an MDCK cell strain with FLNB gene knockout and a construction method and application thereof, and the FLNB gene in MDCK cells is knocked out by CRISPR-Cas9 gene editing technology to obtain an MDCK cell strain with reduced adhesion ability.

[0004] In order to achieve the above object, the present invention adopts the following technical solutions: In the first aspect, the present invention provides a method for knocking out the FLNB gene, using CRISPR / Cas9 technology, designing sgRNA for exon 1 of the FLNB gene of MDCK cells, constructing FLNB gene knockout vector plasmid 1 and plasmid 2; plasmid 1 and plasmid 2 are transfected into MDCK cells to obtain an MDCK cell line with FLNB gene knockout. The FLNB gene knockout cell line is named MDCK-FLNB-KO, and has been deposited in the China Center for Type Culture Collection on November 20, 2024, with a deposit number of CCTCC NO: C2024391.

[0005] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID No. 1.

[0006] Preferably, the plasmid 1 is a pX330-sgRNA plasmid.

[0007] Preferably, the plasmid 2 is pY75-5-3 plasmid.

[0008] Preferably, the pY75-5-3 plasmid contains a 5' homology arm and a 3' homology arm for the sequence recognition site of the sgRNA, the sequence of the 5' homology arm is shown in SEQ ID No. 2, and the sequence of the 3' homology arm is shown in SEQ ID No. 3.

[0009] In a second aspect, the present invention provides a FLNB gene knockout MDCK cell strain, and the FLNB gene knockout MDCK cell strain is obtained according to the method.

[0010] Finally, the present invention provides a method for obtaining an MDCK cell line with FLNB gene knockout, or use of the MDCK cell line with FLNB gene knockout in preparing influenza virus vaccines.

[0011] Preferably, the influenza virus comprises influenza A virus and / or influenza B virus.

[0012] Preferably, the influenza virus comprises at least one of H1N1, H3N2, BV, BY subtype influenza viruses.

[0013] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention uses CRISPR-Cas9 gene editing technology to knock out the FLNB gene in MDCK cells to obtain MDCK cells with reduced adhesion ability.

[0014] (2) The FLNB gene knockout MDCK cell line provided by the present invention has similar cell proliferation ability as the original MDCK cell line, and the total number of cells in the plateau phase is slightly larger.

[0015] (3) Compared with the original MDCK cell line, the FLNB gene knockout MDCK cell line provided by the present invention has loose growth and a lower clumping rate, which is conducive to cell digestion.

[0016] (4) Compared with the original MDCK cell line, the cell-matrix adhesion ability and intracellular Ca2+ expression in MDCK cells after FLNB gene knockout were significantly decreased. 2+The concentrations of FLNB and FLNB decreased. When trypsin digestion was performed at 95% cell confluence, the digestion time of MDCK cells after FLNB gene knockout was significantly reduced, which greatly improved the efficiency of cell passage and reduced the duration of cell digestion process, which is conducive to the large-scale production of influenza vaccines.

[0017] (5) The expression of the FLNB gene may negatively regulate the entry of the virus into the host cells. MDCK cells with FLNB gene knockout can increase the hemagglutination titer of multiple subtypes of influenza virus and can therefore be used in the preparation of influenza virus vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The pX330 plasmid provided in Example 1 of the present invention is shown in Figure 1; Figure 2 This is a gel electrophoresis diagram of the pX330-sgRNA plasmid provided in Example 1 of the present invention; Figure 3 The pY75 plasmid map provided in Example 1 of the present invention; Figure 4 The gel electrophoresis diagram of the pY75-5-3 plasmid provided in Example 1 of the present invention; Figure 5 The gel electrophoresis diagram of the original MDCK cell strain and the FLNB gene knockout MDCK cell strain provided in Example 1 of the present invention; Figure 6 This is a graph showing the qPCR detection results of the mRNA expression levels of the original MDCK cell line and the FLNB gene knocked-out MDCK cell line provided in Example 2 of the present invention; Figure 7 This is a graph analyzing the protein expression levels of the original MDCK cell strain and the FLNB gene knocked-out MDCK cell strain provided in Example 2 of the present invention; Figure 8 The growth curves of the original MDCK cell strain and the FLNB gene knockout MDCK cell strain provided in Example 3 of the present invention are shown; Fig. 9 This is a plate cell clone formation observation diagram of the MDCK original cell strain and the FLNB gene knockout MDCK cell strain provided in Example 3 of the present invention; Fig.10 This is an observation diagram of the cell passage growth characteristics of the MDCK original cell strain and the FLNB gene knocked-out MDCK cell strain provided in Example 3 of the present invention; Fig.11 The cell fluorescence staining images of the original MDCK cell strain and the FLNB gene knockout MDCK cell strain provided in Example 4 of the present invention; Fig.12A comparison chart of cell adhesion strength between the original MDCK cell line and the FLNB gene knockout MDCK cell line provided in Example 4 of the present invention; Fig.13 This is a graph showing the calcium ion concentration of the original MDCK cell line and the FLNB gene knocked-out MDCK cell line provided in Example 4 of the present invention; Fig.14 A comparison diagram of trypsin digestion of the original MDCK cell strain and the FLNB gene knockout MDCK cell strain provided in Example 4 of the present invention; Fig.15 A comparison chart of cell scratch tests of the original MDCK cell strain and the FLNB gene knockout MDCK cell strain provided in Example 5 of the present invention; Fig.16 It is a soft agar colony formation diagram of the MDCK original cell strain and the FLNB gene knocked-out MDCK cell strain provided in Example 5 of the present invention; Fig.17 This is a comparison chart of the sensitivity of the original MDCK cell strain and the FLNB gene knockout MDCK cell strain provided in Example 6 of the present invention to various subtypes of influenza virus. DETAILED DESCRIPTION

[0019] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0020] The sources or components of the reagents, kits or other materials used in the following examples are as follows: MDCK cell lines: CCL-34 cells purchased from ATCC, W-63 (working library).

[0021] VP-SFM medium (Cat. No.: 12559019), fetal bovine serum (Cat. No.: 16136071), and glutamine supplement (Cat. No.: 31980030) were purchased from GIBCO.

[0022] The pX330 plasmid carries the sgRNA backbone, Cas9 expression sequence, and ampicillin resistance gene. The pY75 plasmid carries a loxP fragment containing the puromycin resistance gene (Puro).

[0023] 2×Phanta Max Master Mix (Dye Plus) (Cat. No.: P525), 2×Phanta Flash Master Mix (Dye Plus) (Cat. No.: P520), and T4 PNK (Cat. No.: N102) were purchased from Nanjing Novozymes Biotech Co., Ltd.

[0024] T7 DNA Ligase (Cat. No. M0318S) was purchased from NEB.

[0025] Top10 competent cells were purchased from Sangon Biotech (Shanghai) Co., Ltd. (Cat. No. B528412).

[0026] The influenza virus H1N1 (IVR215) strain batch number is 202210W05H1, the H3N2 (IVR237) strain batch number is 202401W01H3, the BV (BVR-26) strain batch number is 202303W01BV, and the BY (BVR-1B) strain batch number is 202205W02BY, all of which are stored in the Wuhan Institute of Biological Products Co., Ltd. in China.

[0027] The methods not described in detail in the following examples are all conventional methods well known to those skilled in the art.

[0028] Example 1 This embodiment provides a method for constructing a FLNB gene knockout MDCK cell line, comprising the following steps: 1. Design sgRNA for the FLNB gene of MDCK cells The sgRNA sequence was designed for exon 1 of the FLNB gene (NCBI website Gene ID: 484713) in MDCK cells using the sgRNA design website http: / / www.e-crisp.org / E-CRISP / SEQ ID No.1:5'-GGTAACCGAGAAGGACCTGG-3' And synthesize single-stranded F: 5'-CACCGGTAACCGAGAAGGACCTGG -3' R: 5'-AAACCCAGGTCCTTCTCGGTTACC-3' Take 1 μL of each of the two single chains, 1 μL T4 Ligation Buffer, 6.5 μL ddH2O, 0.5 μL T4 PNK, a total of 10 μL system, and incubate at 37°C for 30 min; 95°C for 5 min; and reduce the temperature by 5°C per minute until the temperature reaches 25°C for phosphorylation and annealing reaction.

[0029] 2. Construction of pX330-sgRNA plasmid The pX330 plasmid (see the plasmid map for details) was inserted into Figure 1) and the synthesized double-stranded sgRNA were digested and ligated by one-step enzyme ligation to obtain pX330-sgRNA plasmid. The reaction system was: 100ng pX330 plasmid, 2μL double-stranded sgRNA reaction diluent, 2μL Tangobuffer, 1μL DTT, 1μL ATP, 1μL BbsI enzyme, 0.5μL T7 DNA ligase, and ddH2O was used to make up to 20μL total reaction volume. The reaction program was: 37℃, 30min; 23℃, 30min.

[0030] Transform the reaction product into competent cells, take the reaction solution and gently mix it in E.coli TOP10 competent cells, place it in an ice bath for 30 minutes, heat shock it in a 42℃ water bath for 45 seconds, quickly put it back in ice for 2 minutes, add 700μL of sterile culture medium without antibiotics, shake and culture it at 37℃ for 1 hour (160-225rpm), take an appropriate amount of volume and evenly spread it on the LB agar medium plate containing the corresponding antibiotics for overnight culture. After picking a single colony, perform PCR identification of the bacterial solution, the primers are: Upstream primer: 5'-CACCGGTAACCGAGAAGGACCTGG-3' Downstream primer: 5'-CTTGATGTACTGCCAAGTGG-3' The reaction system was: 2 μL bacterial solution, 1 μL upstream primer, 1 μL downstream primer, 12.5 μL 2×Phanta MaxMaster Mix, 8.5 μL ddH2O. The reaction procedure was: pre-denaturation at 98°C for 30 seconds; denaturation at 95°C for 10 seconds, annealing at Tm temperature for 5 seconds, extension at 72°C for 5 seconds, amplification for 30 cycles; complete extension at 72°C for 1 minute. The reaction product was verified by 1% agarose gel electrophoresis. The results are as follows: Figure 2 As shown in the figure, the colony corresponding to the band size of about 500 bp is a positive colony, and the corresponding positive single colony is submitted to Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0031] 3. Design of homology arms on both sides of sgRNA Select sequences of about 1000 bp in length from the upstream and downstream of the sgRNA sequence to design homology arm sequences: 5' homologous arm SEQ ID No. 2: ccatgaagggagcccgaggtgggactcaatcctaggaccccaggaccacaccctgggctgaaggcagggactacaccgctgagccacccagggattcccgttatgatttttttaaaggcaaaattttggtaatgtgttacagtagcattggagaaactgatatgccctgcaaattattgtttgttttattttatttttaagtaatctctacacccaatatggaactcacacaaccctgaaatccagtggcatggcctactgactgagccagccaggtgcccccactcttcattcctattattgctactgagctgtttgcgagagttgatttgtatttttctctcccattactctagcaagtcctcaaggtcaaggaataagtttgtcttatttaccattagttctcaggtgcttaagagggcctcgcacacagtaggcactcaatacatgctccgagcttaatgaatacaaatagtaaaatacccattcgttcatggggtcctccagtgcctaacaccgcctctggcacacagcaggagctcaataaaaactcatactgaacctataggtggatcaagtactcctccctgccctcgtggcccaagcggccgtcccccctacacggggtcttctctcttgcacgtccctgactcagggatcagaccgtgacctccttaaccccaagtctctcccggggctccctttcgcaccgagcgcggggtcccgggacaccgcggaggccgcagggtgcagtgcgccttagagaccgcagggggcgagcgtggctcgggaactcccgccgcggggctgggacagggcggggcccgagggcgggtcggctcagtgcgcaggcgccggtccagacgcctcgcgcggccaggggcaggcggccgcagagcagtgccggccgcggctccagtagcagcgagttcg By PCR amplification method, wild-type MDCK cell genomic DNA was used as a template to obtain the homology arm sequence: The 5' homology arm PCR amplification primers are as follows: Upstream primer: 5'-CCATCGATCCATGAAGGGAGCCCGAG-3' Downstream primer: 5'-GGGATATCCGAACTCGCTGCTACTGG-3' The 3' homology arm PCR amplification primers are as follows: Upstream primer: 5'-ACGCGTCGACCAAGCGCATCGGGAACCT-3' Downstream primer: 5'-CCCAAGCTTCCTTCCCACTTCCATGACC-3' The reaction system was: MDCK-WT DNA (100 ng), 2 μL upstream primer, 2 μL downstream primer, 25 μL 2×PhantaMax Master Mix, and ddH2O was used to make the total reaction volume 50 μL. The reaction program was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at Tm temperature for 15 s, extension at 72°C for 60 s, amplification for 35 cycles; complete extension at 72°C for 5 min.

[0032] 4. Construction of homologous recombination vector pY75-5-3 plasmid Insert the 5' homology arm and pY75 plasmid (see the plasmid map for details) Figure 3 ) was digested with ClaI and EcoRⅤ enzymes (NEB) and incubated at 37°C overnight. The digestion product was purified using the Universal DNA Purification Kit (Cat. No.: DP214, TIANGEN). The purified product was ligated using NEB's T4 DNA Ligase system and incubated at 16°C overnight. The ligation product was transformed into competent cells, and single colonies were picked for PCR and gel electrophoresis identification. The corresponding positive single colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. When the sequencing results show that the 5' homologous arm is correctly connected, the 3' homologous arm is connected according to the above method. The 3' homologous arm uses the restriction site SalI and HindⅢ enzyme (NEB), and finally the homologous recombination pY75-5-3 plasmid is obtained. The results are as follows Figure 4 As shown in the figure, the corresponding colonies with a band size of about 1200 bp are positive colonies.

[0033] The primers for 5' homology arm PCR identification are as follows: Upstream primer: 5'-GCTGCAAGGCGATTAAGTTG-3' Downstream primer: 5'-CATGCTCCAGACTGCCTTG-3' The primers for 3' homology arm PCR identification are as follows: Upstream primer: 5'-GTGGTTTGTCCAAACTCATC-3' Downstream primer: 5′-TGTGTGGAATTGTGAGCG-3′.

[0034] 5. Cell electroporation and screening of monoclonal cells The successfully constructed pX330-sgRNA plasmid and pY75-5-3 plasmid were electroporated into MDCK cells simultaneously using an electroporator (model: GenePulserXcell, Bio-Rad). The number of cells in each electroporation cup was 10 6 8 μg of pX330-sgRNA plasmid and pY75-5-3 plasmid were added, and the total volume was supplemented with electroporation solution to 200 μL. The electroporation conditions were pulse voltage, 110V; number of pulses, 1 pulse; pulse width, 25ms. After electroporation, the cells in each electroporation cup were evenly divided into 6-well cell culture plates, complete cell culture medium was added, and cultured in a 37°C cell culture incubator.

[0035] According to the cell growth status, when the cell confluence reaches 60%, replace the complete medium containing 8μg / mL puromycin for screening, and replace the puromycin screening medium every 2 days. After about 1 week, small cell clusters with puromycin resistance can be observed. Monoclonal cells are obtained by limiting dilution method: first, digest the cell clusters with puromycin resistance grown in the six-well plate; second, count the cells and dilute them to a cell concentration of 30-50 / 10mL; finally, after the cell suspension is fully mixed, add 100μL per well to a 96-well plate and culture in a cell culture incubator at 37℃. Closely observe the cell growth status and mark the wells containing only monoclonal cell clusters under an optical microscope; after the cells in the marked wells are full, expand the cell culture for cell identification and freeze the cells at the same time.

[0036] 6. Monoclonal cell PCR identification Primers were designed upstream and downstream of the homologous arms at both ends of the cell genome insertion sequence for PCR identification. This pair of primers can simultaneously identify wild-type, single knockout and double knockout clones, and eliminate the interference of plasmid residues in the cells. First, the monoclonal cell genomic DNA was extracted using the Minibest universal Genomic DNA Extraction Kit (TAKARA) and used as a template for PCR identification. The reaction system is: DNA template (100ng), 1μL upstream primer, 1μL downstream primer, 12.5μL 2×Phanta Max Master Mix, and ddH2O was used to make the total reaction volume 25μL. The reaction procedure is: pre-denaturation at 98℃, 30s; denaturation at 95℃, 10s, annealing Tm temperature, 5s, extension at 72℃, 5s, amplification for 30 cycles; thorough extension at 72℃, 1min. The reaction product was verified by 1% agarose gel electrophoresis, and the results are as follows. Figure 5 As shown, WT represents the original MDCK cell line, and KO represents the MDCK cell line with FLNB gene knockout. Theoretically, the two homologous chromosomes of MDCK-FLNB-KO cells are both inserted with a puromycin resistance gene fragment of about 1371 bp in length, that is, the band size of MDCK-FLNB-KO cells is 1179 bp more than that of MDCK-WT cells. In the figure, the amplified band size of MDCK-WT cells is about 2500 bp, and the amplified band size of MDCK-FLNB-KO cells is about 3700 bp, indicating that homozygous cells with FLNB gene knockout (MDCK-FLNB- / -) were obtained. The PCR products were sequenced by Sangon Biotech (Shanghai) Co., Ltd.

[0037] The primers used for cell PCR identification are as follows: Upstream primer: 5'-CTCGGATCTCGCCTGGAGTCAA-3' Downstream primer: 5'-GAGAGGAACCCGACACCAAC-3' Example 2 This example studies the transcription level and protein level of the FLNB gene knockout MDCK cell line prepared in Example 1.

[0038] 1. qPCR verification of FLNB knockout cells qPCR primers were designed according to the FLNB gene and GAPDH reference gene, and the total RNA of MDCK-WT cells and MDCK-FLNB-KO cells was extracted using MiniBEST UniversalRNA Extraction Kit (TaKaRa), and reverse transcription was performed using PrimeScript™ IV 1st strand cDNA Synthesis Mix (TaKaRa) to synthesize cDNA. The reverse transcription reaction system was: total RNA template (100ng), 4μL 5× PrimeScript IV cDNA Synthesis Mix, 1μL Random 6mers, and RNase Free dH2O was used to make up the total reaction volume to 20μL. The reaction program was: 30℃, 10min; 42℃, 20min; 95℃, 5min. The reverse transcription product was subjected to qPCR experiment using Applied Biosystems 7500 system, and the reaction system was: cDNA template (20ng), 10μL 2×ChamQ SYBR qPCR Master Mix (Low ROX Premixed), 1μL upstream primer, 1μL downstream primer, and ddH2O was used to make the total reaction volume 20μL. The reaction program was: pre-denaturation at 95℃, 30s; cycle reaction at 95℃, 10s, 60℃, 30s, amplification for 40 cycles; and melting curve collection.

[0039] The primers for qPCR identification are as follows: FLNB upstream primer: 5'-TGGAGCGAAGTGGACTGAAGG-3' FLNB downstream primer: 5'-GTGTCGTTGGCGTTGTGAATAATG-3' GAPDH upstream primer: 5'-CAAGGCTGTGGGCAAGGTCATC-3' GAPDH downstream primer: 5'-TTCTCCAGGCGGCAGGTCAG-3' The results of qPCR detection of cell mRNA expression levels are as follows Figure 6 As shown, compared with MDCK-WT cells, the transcription level of FLNB gene in MDCK-FLNB-KO cell line was reduced by about 95.37% (P < 0.0001).

[0040] 2. Western Blot verification of FLNB knockout cells The cells were lysed with RIPA lysis buffer (Shanghai Biotech), and the supernatant was taken for BCA protein quantification (biosharp). After protein denaturation, SDS-PAGE precast gel (GenScript) was used for protein separation and then transferred to nitrocellulose membrane (NC membrane). 5% skim milk powder was added for blocking at room temperature for 2 hours, and after rinsing with PBST, the primary antibody (FLNB antibody; Abcam; 1:2000) was incubated at room temperature for 2 hours. After rinsing with PBST, the secondary antibody (HRP-labeled goat anti-rabbit IgG, Shanghai Biotech; 1:50000) was incubated at room temperature for 1 hour. The membrane protein was developed using ECL reagent (Millipore); scanned and photographed using the Amersham ImageQuant800 system (Cytiva, Japan). The results of Western Blot experiments are shown in Figure 2. Figure 7 As shown, using GAPDH as the internal reference gene, the protein expression level of MDCK-FLNB-KO cells was decreased by 97.75% compared with that of MDCK-WT cells (P<0.001).

[0041] Example 3 This example studies the growth characteristics and proliferation ability of the FLNB gene knockout MDCK cell line prepared in Example 1.

[0042] 1. Cell growth curve MDCK-WT cells and MDCK-FLNB-KO cells in the logarithmic growth phase were digested with trypsin to prepare cell suspensions. 5×10 cells were added to each well. 4 The cells were inoculated into a six-well plate at the starting number and cultured at 37°C. The cells were taken out and digested every 24 hours for cell counting. The counting was continued for 10 days. The cell growth curve was drawn with time (h) as the horizontal axis and the number of cells as the vertical axis. The results are shown in Figure 8 As shown, compared with MDCK-WT cells, MDCK-FLNB-KO cells had similar cell proliferation capacity and a slightly larger total number of cells in the plateau phase.

[0043] 2. Plate colony formation experiment MDCK-WT cells and MDCK-FLNB-KO cells in the logarithmic growth phase were digested with trypsin to prepare cell suspensions. 2×10 cells per well were added. 3 The cells were inoculated into a six-well plate at the starting number of 100 cells / mL and cultured at 37°C. The cells were observed every 24 hours. After 96 hours of culture, when small cell clusters appeared and were not connected, the supernatant medium was removed, the cells were washed twice with PBS buffer, fixed with 4% paraformaldehyde for 20 minutes, and then stained with 1% crystal violet for 20 minutes to observe the cell clustering. The results are shown in the figure. Fig. 9As shown in the figure, MDCK-WT cells grow tightly and form cell clusters, while MDCK-FLNB-KO cells grow loosely and are scattered in the culture matrix with a low aggregation rate. The number and area of ​​the two cell clones are basically the same.

[0044] 3. Cell passage observation When the confluence of MDCK-WT cells and MDCK-FLNB-KO cells reached 80%, they were passaged at a ratio of 1:4 and cultured at 37°C. Cell characteristics were observed using a cell counter. Fig.10 As shown, compared with MDCK-WT cells, MDCK-FLNB-KO cells had higher viability, slightly smaller diameter, more rounded shape, and lower clumping rate, indicating that the growth morphology of MDCK-FLNB-KO cells was altered.

[0045] Example 4 This example studies the adhesion ability of the FLNB gene knockout MDCK cell line prepared in Example 1.

[0046] 1. Cell fluorescence staining The cells were cultured in a twelve-well plate, washed 3 times with PBS buffer, fixed with fixative for 20 minutes, washed 3 times, added 200uL Actin-Tracker Rad working solution (Biyuntian, 1:100) to each well, incubated at room temperature for 1 hour in the dark, washed 3 times, and covered on a slide with anti-fading DAPI. After sealing, the slides were stored at 4°C and confocal fluorescence photography was performed. The results are shown in Fig.11 As shown. Phaloidin was used for cell staining. Phaloidin can specifically bind to actin filaments and clearly show the morphology and distribution of actin filaments in cells. Actin filaments interact with integrin receptors in the extracellular matrix and participate in the formation and regulation of focal adhesions. As can be seen from the figure, the actin filament skeleton of MDCK-WT cells is more obvious, while it is almost not observed in MDCK-FLNB-KO cells.

[0047] 2. Cell Adhesion Assay According to the instructions of the cell adhesion kit (Shanghai Beibo), the coating solution was added to the 96-well plate and left to stand at 4°C overnight. Before use, the coating solution was removed and air-dried in a safety cabinet for several minutes, and then washed three times with washing solution. 10 cells were added to each well. 4 The cells were incubated at 37°C for 1 hour, the culture medium was removed, the cells were washed 3 times with PBS, 100 μL of culture medium and 10 μL of cell staining solution were added, and the cells were incubated at 37°C for 2 hours. The OD value was read at 450 nm using an ELISA reader. Fig.12As shown, compared with MDCK-WT cells, the adhesion ability between MDCK-FLNB-KO cells and the extracellular matrix decreased by about 24.3% (P < 0.01).

[0048] 3. Intracellular calcium concentration detection According to the instructions of Fluo-4 Calcium Ion Assay Kit (Biyuntian), 5×10 3 Cells were seeded in 96-well plates and cultured overnight at 37°C in a cell culture incubator. The culture medium was removed by aspiration, the cells were washed once with PBS, 100 μL of Fluo-4 staining solution was added to each well, and the cells were incubated at 37°C in the dark for 30 min. Fluorescence analysis was performed using a full-view cell scanning analyzer. Fig.13 Compared with MDCK-WT cells, the intracellular Ca 2+ The concentration decreased by about 41.44% (P<0.0001). The decrease in intracellular calcium ion concentration will affect the adhesion strength between cells.

[0049] 4. Cell trypsin digestion test MDCK cells are adherent cells. During the process of cell subculturing and expansion, trypsin digestion is required. Digest MDCK-WT cells and MDCK-FLNB-KO cells with a confluence of 95% respectively. Observe the cell digestion under a microscope. The results are as follows: Fig.14 As shown in the figure, the time required for trypsin digestion of MDCK-WT cells is 25 minutes, while the time required for trypsin digestion of MDCK-FLNB-KO cells is 15 minutes. The reduction in trypsin digestion time can intuitively reflect the decrease in cell adhesion ability.

[0050] Example 5 This example studies the migration speed and tumorigenicity of the FLNB gene knockout MDCK cell line prepared in Example 1.

[0051] 1. Cell scratch test The cells were plated in a six-well plate with streaking marks and cultured overnight until the confluence reached 100%. The culture medium was removed and washed with PB. Then, the cells were streaked with a 10 μL white pipette tip and serum-free culture medium was added to culture at 37°C. Pictures were taken and recorded under a microscope at 0 h, 4 h, 8 h, 12 h, and 24 h, and analyzed using Image J software to calculate the cell migration rate = (initial scratch area - scratch area at time t) / initial scratch area. The analysis results are shown in Figure 2. Fig.15 As shown, MDCK-WT cells migrated rapidly at 24 h and almost completely healed the gap, with a migration rate of 94.53%, while MDCK-FLNB-KO cells migrated slowly, with a migration rate of 47.69% at 24 h.

[0052] 2. Soft agar colony formation experiment: MDCK-WT cells and MDCK-FLNB-KO cells in the logarithmic growth phase were treated into cell suspensions and 2×10 3 A soft agar clone formation experiment was performed in a six-well plate. The concentration of the lower layer of gel was 0.5%, and the concentration of the upper layer of gel was 0.8%. After culturing in a 37°C incubator for 21 days, the cell clustering was observed by 1% crystal violet staining, and photos were taken under a microscope to calculate the average number of cell clones. The results are as follows: Fig.16 As shown, in cell suspension culture, the average clone number of MDCK-FLNB-KO cells was lower than that of MDCK-WT cells, and the tumorigenicity of MDCK cells with FLNB gene knockout was reduced.

[0053] Example 6 In this example, the sensitivity of the FLNB gene knockout MDCK cells prepared in Example 1 to influenza virus was studied.

[0054] MDCK-WT cells and MDCK-FLNB-KO cells were cultured to a confluence of 90%, the culture medium was removed and the cells were washed with PBS buffer, virus maintenance solution containing 1 μg / mL recombinant trypsin was added, and four virus strains H1N1 (IVR215), H3N2 (IVR237), BV (BVR-26), and BY (BVR-1B) were inoculated at an MOI of 0.01, respectively, and cultured in a 34°C incubator for 72 hours. The virus supernatant was collected for hemagglutination virus titer detection.

[0055] Add 25 μL PBS to the wells in the 2nd to 12th columns of the 96-well microplate, and add 50 μL of the virus solution to be tested to the 1st column; take 25 μL of the virus solution in the 1st column and mix it evenly in the corresponding wells in the 2nd column, and make two-fold dilutions from the 2nd to the 12th columns in sequence, and discard 25 μL of the liquid in the last column. Add 25 μL of 1% chicken / guinea pig red blood cell suspension to each well, mix thoroughly, and let it stand for 30 minutes before judging the results. The results are as follows: Fig.17 As shown, the sensitivity of MDCK-FLNB-KO cells to various subtypes of influenza virus was increased to varying degrees.

[0056] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0057] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for knocking out the FLNB gene, characterized in that: Using CRISPR / Cas9 technology, sgRNA was designed for exon 1 of the FLNB gene in MDCK cells, and FLNB gene knockout vector plasmids 1 and 2 were constructed; plasmids 1 and 2 were transfected into MDCK cells to obtain MDCK cell lines with FLNB gene knockout. The FLNB gene knockout cell line was named MDCK-FLNB-KO and was deposited in the China Center for Type Culture Collection on November 20, 2024, with a deposit number of CCTCCNO: C2024391.

2. The method according to claim 1, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID No.

1.

3. The method according to claim 1, characterized in that The plasmid 1 is the pX330-sgRNA plasmid.

4. The method according to claim 1, characterized in that: The plasmid 2 is the pY75-5-3 plasmid.

5. The method according to claim 4, characterized in that The pY75-5-3 plasmid contains a 5' homology arm and a 3' homology arm for the sequence recognition site of the sgRNA, the sequence of the 5' homology arm is shown in SEQ ID No. 2, and the sequence of the 3' homology arm is shown in SEQ ID No.

3.

6. A FLNB gene knockout MDCK cell line, characterized in that: The FLNB gene knockout MDCK cell line is obtained according to the method according to any one of claims 1 to 5.

7. Use of the MDCK cell line with FLNB gene knockout obtained according to the method according to any one of claims 1 to 5, or the MDCK cell line with FLNB gene knockout according to claim 6 in preparing influenza virus vaccine.

8. The use according to claim 7, characterized in that: The influenza virus includes influenza A virus and / or influenza B virus.

9. The use according to claim 8, characterized in that: The influenza virus includes at least one of H1N1, H3N2, BV, and BY subtype influenza viruses.

Images