Grouper iridovirus MCP gene WB guarantee type monoclonal antibody and preparation method thereof

Abstract

The invention discloses a grouper iridovirus MCP gene WB guarantee type monoclonal antibody and a preparation method thereof. The monoclonal antibody is generated by a hybridoma cell strain SGIV-MCP-7C8 1F4, and the preservation number of the hybridoma cell strain SGIV-MCP-7C8 1F4 is GDMCC No: 64609. The invention also discloses a preparation method of the monoclonal antibody. The successful preparation of the monoclonal antibody of the SGIV MCP lays a foundation for the establishment of an SGIV immunological detection method and the research on the pathogenesis of virus infection, and can also be used for quantitative and positioning analysis of the SGIV MCP in vivo and in vitro.

Description

Technical Field

[0001] The invention belongs to the cross-technical field of immunology and virology, and particularly relates to a WB-guaranteed monoclonal antibody of the MCP gene of a grouper iris virus and a preparation method thereof. Background Art

[0002] As an important marine economic fish, grouper aquaculture has important economic value in the southern region. However, infection with Singapore grouper iridovirus (SGIV) poses a serious threat to the aquaculture industry, resulting in high mortality and huge economic losses. SGIV is a highly pathogenic virus that can cause hemorrhage and enlargement of the spleen in grouper, with a mortality rate of more than 90% within one week of infection. At present, the detection method of SGIV mainly relies on PCR technology, but this method has problems such as easy contamination, high false positive rate, high equipment cost and inconvenient operation.

[0003] In order to overcome the shortcomings of existing detection methods, it is urgent to develop a rapid, accurate, highly specific and low-cost detection method. Monoclonal antibodies are considered to be an ideal detection tool due to their high specificity and sensitivity. However, the preparation process of monoclonal antibodies is complicated, the cycle is long, and there is a risk of preparation failure. Therefore, it is of great significance to develop a monoclonal antibody preparation method that can guarantee the quality of monoclonal antibodies, especially the positive results in Western Blot (WB) detection, to improve the detection efficiency and accuracy.

[0004] In the prior art, researchers have constructed prokaryotic expression vectors to express the major capsid protein (MCP) of SGIV, and used the recombinant protein to immunize animals to prepare polyclonal antibodies. These antibodies have shown good specificity and sensitivity in the detection of SGIV. However, polyclonal antibodies may have limitations in certain applications due to their molecular diversity. In contrast, monoclonal antibodies provide higher consistency and repeatability, which is crucial to ensuring the reliability of test results. Summary of the invention

[0005] In view of this, the present invention aims to provide a WB-guaranteed monoclonal antibody against the SGIV MCP gene and a preparation method thereof, in order to improve the accuracy and efficiency of SGIV detection, help promote the development of grouper disease prevention and control technology, and provide technical support for the sustainable development of grouper aquaculture.

[0006] The first object of the present invention is to provide a hybridoma cell line SGIV-MCP-7C8 1F4 capable of producing a WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC) on May 11, 2024, address: Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code: 510070, and the deposit number is: GDMCC No: 64609.

[0007] The second object of the present invention is to provide a WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus, which is produced by the hybridoma cell line SGIV-MCP-7C8 1F4.

[0008] The third object of the present invention is to provide the use of hybridoma cell line SGIV-MCP-7C8 1F4 in producing WB-guaranteed monoclonal antibodies against the MCP gene of grouper iridovirus.

[0009] The fourth object of the present invention is to provide the use of the WB-guaranteed monoclonal antibody of the MCP gene of grouper iridovirus in the preparation of a product for detecting grouper iridovirus.

[0010] Preferably, the invention provides the use of a WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus in the preparation of a product for detecting the MCP protein antigen of grouper iridovirus.

[0011] Preferably, the product is selected from any one of a reagent or a kit.

[0012] Preferably, the kit is selected from any one of a colloidal gold immunoassay kit, a chemiluminescence kit, a radioimmunoassay kit, an enzyme-linked immunosorbent assay kit or a fluorescent immunoassay kit.

[0013] The fifth object of the present invention is to provide a product for detecting grouper iridovirus, which comprises the WB guaranteed monoclonal antibody of the MCP gene of grouper iridovirus.

[0014] The sixth object of the present invention is to provide a method for detecting grouper iridovirus, using the grouper iridovirus MCP gene WB guaranteed monoclonal antibody, or the product for detecting grouper iridovirus, to detect the sample to be tested.

[0015] The seventh objective of the present invention is to provide the use of the WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus or a product for detecting grouper iridovirus in detecting grouper iridovirus.

[0016] The present invention uses purified recombinant SGIV MCP protein as an antigen to immunize BALB / c mice, and produces fused hybridoma cells through cell fusion. After indirect enzyme-linked immunosorbent assay (ELISA) screening, a hybridoma cell line (7C8 1F4) that stably secretes the WB-guaranteed monoclonal antibody of the grouper iridovirus MCP gene is obtained. The results of the immunoblotting method show that the monoclonal antibody 7C8 1F4 of the present invention has good specificity and can specifically recognize the SGIV prokaryotic expression product and the viral MCP in the infected cells. The successful preparation of the monoclonal antibody of SGIV MCP in the present invention lays a foundation for the establishment of SGIV immunological detection methods, antiviral immune preparations, and the study of the pathogenic mechanism of viral infection.

[0017] The hybridoma cell line SGIV-MCP-7C8 1F4 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on May 11, 2024, address: Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code: 510070, and the deposit number is: GDMCC No: 64609. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is the SDS-PAGE electrophoresis diagram of the purified recombinant SGIV MCP protein, wherein 1 is the protein molecular weight standard (Marker), and 2 is the purified recombinant SGIV MCP protein.

[0019] Figure 2 The above is the immunoblotting screening of hybridoma positive cells. 1 is the culture supernatant of hybridoma cell 7C8 1F4; 2 is the culture supernatant of hybridoma cell 4A9 1E7; 3 is the culture supernatant of hybridoma cell 7H8 2F7.

[0020] Figure 3 The purified monoclonal antibody was identified by SDS-PAGE. 1 is a protein molecular weight standard (Marker), and 2 is a monoclonal antibody purified from ascites prepared by hybridoma cell 7C8 1F4.

[0021] Figure 4 Figure 1 shows the immunoblot analysis of purified monoclonal antibodies against MCP protein in virus-infected cells. Figure 2 shows SGIV-infected cells as the detection antigen and the antibody produced by hybridoma cell 7C8 1F4 as the primary antibody.

[0022] Figure 5 It is the specific detection of the virus by purified monoclonal antibodies. Among them, SGIV is grouper iridovirus, RGNNV is neural necrosis virus, ISKNV is mandarin fish infectious spleen and kidney necrosis virus, LMBV is California sea bass iridovirus, and control is a cell sample not infected with the virus. DETAILED DESCRIPTION

[0023] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. Specific experimental conditions and methods are not specified in the following examples, and the technical means used are generally conventional means known to those skilled in the art.

[0024] Example 1: Construction of prokaryotic expression recombinant plasmid of grouper iridovirus MCP and protein expression

[0025] (1) The sequence of the open reading frame of the SGIV MCP gene (as shown in SEQ ID NO. 1) was cloned into the prokaryotic expression vector pET-B2m (purchased from Wuhan Jinkairui Bioengineering Co., Ltd.) using restriction endonucleases BamHI and XhoI to construct a recombinant expression vector pET-B2m-SGIV MCP; the recombinant plasmid pET-B2m-SGIV MCP was transformed into Escherichia coli BL21 competent cells, positive bacteria were screened by colony PCR, and sequencing was performed for verification.

[0026] >SEQ ID NO.1

[0027] ATGACTTGTACAACGGGTGCTGGCGTAACCAGTGGCTTCATAGATTTGGCCACGTACG

[0028] ACAATCTCGACAGAGCGTTATACGGCGGAAAGGACGCCACTACGTACTTTATCAAAGA

[0029] GCATTATCCCGTAGGATGGTTCACCAAGCTTCCCACCATGGCCACCAGAGTGTCTGGA

[0030] AACCCAGCGTTCGGGCAAGAGTTTTCGGTCGGGGTTCCCAGGTCGGGCGATTACGTG

[0031] CTCAACGCCTGGCTCACTCTTAAAACCCCCGAAATTAAACTGCTCGAAACAAATAGGC

[0032] TCGGCGCAAACGGTACCGTGAGGTGGACCAAAAACCTAATGCACAACGCTGTAGAGC

[0033] ACGCTTCTCACCTTCAACGAATTTGCGCGCAGCAGTTTAACACAGCGTATTTAGAC

[0034] GCTTGGACACAGTTTAACATGTGCGAAGGTAAACGCATAGGTTACGACAACATGATCG

[0035] GGAACACCAGCGACATGACCAACCCCACTCCCGCTCAGGGTCAGGACGGCGCAAGG

[0036] ACACTACCTTCCAAAAATTTAGTGCTCCCGTTGCCGTTCTTTTTCAGCAGAGACTGCG

[0037] GATTGGCTCTGCCCACCGTAGTGTTGCCCTATAATGAAATCAGAATCAACATTAAACTG

[0038] AGGTCGCTTCAGGAGCTTTTAGTGTTTCAGAACAAAGACACCGGAAATGTGATTCCTA

[0039] TCTCTGCTACCGACATAGCCGGCGGGCTCGCCGACACCGTGGAAGCTTACGTGTATAT

[0040] GACCGTGGGTCTCGTTTCCAACGTGGAAAGGTGCGCCATGGCAGGGACCGTCAGGGA

[0041] TATGGTCGTAGAACAAATGCAGGCCGCCCCCACACACATCGTTAACCCTCAAAACACA

[0042] AATAACGTCCACGTAGACATGAGGTTCTCGCACGCCGTGAAAGCCCTCTTTTTCATGG

[0043] TGCAAAACGTCACTTATAAATCTGTGGGTTCAAATTATACGTGTGTAACACCAGTTAAC

[0044] GGTCCGGGCAACACCGTGATGGAGCCCGCCATGTCCGTTGATCCCATCAAAAGCGCCA

[0045] GCCTCACGTACGAAAATACGACCAGGTTGGCAAATATGGGTGTAGAGTATTACTCTCTG

[0046] GTACAACCTTGGTATTTTTCAGCCTCCATTCCAGTGTACACCGGATACCACATGTATTCA

[0047] TACGCCCTAAACGTGGGCAGCGTTCATCCTTCGGGGTCTACCAATTACGGAAGATTGA

[0048] CCAACGCTAGCATCACTGTAACAATGTCCCCGAGTCTGTCGTCGCCGCAGCAGGAGG

[0049] AGGTAACAATAATTCTGGTTACAACGAACCTCAGAGGTTCGCGTTGGTAGTGATCGCCGTAAACCATAACGTCATCAGAATCATGAACGGTTCCATGGGGTTCCCTATCTTGTAA.

[0050] (2) The positive bacteria with correct sequencing were placed in LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C overnight with shaking. The next day, the overnight culture was diluted at a volume ratio of 1:100 and cultured until the OD600 of the culture was about 0.6. Then, isopropyl β-D-thiogalactoside (IPTG) was added at a final concentration of 0.5 mmol / L to induce protein expression.

[0051] (3) Inclusion body protein purification. The protein was purified according to the inclusion body protein purification method. The specific procedures are as follows: ① Collect the bacterial solution, resuspend the bacterial cells in pre-cooled NTA-0 buffer, place on ice for 30 minutes, and perform ultrasonic disruption for 25-30 minutes (the parameters are set to 200W power, 3s working, and 4s pause), centrifuge at 16000rpm / min and 4℃ for 50 minutes, and remove the supernatant. ② The precipitate was resuspended in STET buffer (DTT concentration 1mM), ultrasonically disrupted for 10min, the parameters were set to 200W, working for 3s, and paused for 3s; centrifuged at 10000rpm / min and 4℃ for 10min, and the supernatant was removed; ③ Repeat ② three times until the supernatant was transparent; ④ The precipitate was resuspended in PBS, ultrasonicated, the parameters were set to 200W, working for 3s, paused for 3s, and time was 5min; centrifuged at 16000rpm / min and 4℃ for 10min, and the supernatant was removed; ⑤ The inclusion bodies were resuspended in 4mL SKL (sodium lauryl sarcosine), DTT was added at a concentration of 5mM, and the inclusion bodies were shaken at 37℃ until they were completely dissolved. Centrifuged at 10000rpm / min and 4℃ for 10min, and the supernatant protein solution was taken.

[0052] (4) Refolding of inclusion body protein. ① Dilute the protein solution with 2 volumes of 3M guanidine hydrochloride, and add dropwise to 200 mL of refolding solution (weigh 0.077 g oxidized glutathione, 0.385 g reduced glutathione, 0.186 g EDTA·2Na, 17.42 g arginine, 3.03 g Tris base, dissolve in deionized water, add concentrated hydrochloric acid to adjust pH = 8.0, and make up to 250 mL) at 4°C with a syringe, adjust the speed to the maximum, and stir for 24 h; reduce the speed and continue stirring for 24 h; ② Take the protein solution in a dialysis bag, concentrate the volume to 50-100 mL with PEG20000, and dialyze in TE buffer at 4°C overnight; ③ Take the protein solution, concentrate the volume to 2-4 mL with PEG20000; dialyze in TE buffer at 4°C overnight, and take the protein solution for SDS-PAGE detection.

[0053] (5) Affinity purification of renatured protein. ① The renatured protein solution in (5) was filtered through a 0.22 μm filter and then purified by Ni-NTA column; ② The protein solution was loaded at a flow rate of 1 mL / min; the column was washed with NTA-0 buffer (pH 8.0) until the effluent contained no protein (the G250 detection solution did not change color); ③ The elution was respectively eluted with eluents containing 20 mM, 60 mM, 200 mM and 500 mM imidazole, and the eluent was collected in sections until the G250 detection solution did not change color; ④ The column material was washed with 3 times column volume of deionized water, the column was sealed with 20% ethanol, and the collected eluent was subjected to SDS-PAGE electrophoresis. ⑤ The components with the required purity were dialyzed with TE at 4°C; the dialyzed product was concentrated by ultrafiltration at 4°C, and the protein purification was detected by SDS-PAGE. The SDS quality control results showed that the MCP recombinant protein after inclusion body purification, protein renaturation and Ni-NTA column purification had a target band with a molecular weight of 60 kDa, a protein concentration of about 3 mg / mL, and a purity of about 85% ( Figure 1 ). Thus, the purified recombinant SGIV MCP protein is obtained to meet the subsequent immunization requirements.

[0054] Example 2: Preparation of WB-guaranteed monoclonal antibodies against the MCP gene of grouper iridovirus

[0055] (1) Immunity

[0056] Purified recombinant SGIV MCP protein was used as an antigen to immunize SPF female BALB / c mice, and 8 mice were immunized in total in the present invention. The immunization was performed in 4 times, all of which were subcutaneous injections: ① one immunization: each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal amount of Freund's complete adjuvant (V / V), and the immunization time was 2-3 weeks; ② two immunizations: each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal amount of Freund's incomplete adjuvant (V / V), and the immunization time was 2 weeks; ③ three immunizations: each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal amount of Freund's incomplete adjuvant (V / V), and the immunization time was 1 week, and the titer was detected by ELISA after the three immunizations; ④ four immunizations: each mouse was subcutaneously injected with 50 μg of purified recombinant SGIV MCP protein and an equal amount of Freund's incomplete adjuvant (V / V), and the immunization time was 2 weeks, and the titer was detected by ELISA after the four immunizations. ⑤ Intraperitoneal impact: Each mouse was intraperitoneally injected with 50 μg of purified recombinant SGIV MCP protein, and the immunization time was 3 days.

[0057] (2) Cell fusion

[0058] ① Preparation of immune spleen cells: Take immunized BALB / c mice, remove the eyeballs to collect blood, and separate the serum as the positive control serum for antibody detection. After killing the mice by dislocating the neck, soak them in 75% alcohol for 5 minutes, remove the spleen aseptically and place it in a 3.5cm culture dish, and remove the fat and connective tissue on the spleen. Grind with a grinding rod to make the lymphocytes in the spleen pass through the silk mesh to make a single cell suspension, and collect the single cell suspension in a 15mL centrifuge tube. Centrifuge at 1000rpm / min for 5 minutes, discard the supernatant, and resuspend the precipitate with RPMI-1640 solution for later use.

[0059] ② Preparation of SP2 / 0 myeloma cells: Resuscitate SP2 / 0 myeloma cells frozen at -80℃, dissolve in a 37℃ water bath; centrifuge at 1000rpm / min for 5min, aspirate the supernatant, add 1mL GIT culture medium (Hyclone DMEM, Thermo), and transfer to a 24-well plate. Expand and subculture the next day. Observe the cell state after about two days, and select cells with good growth and morphology in the logarithmic growth phase for subsequent fusion. Change the culture medium 12h before fusion.

[0060] ③Preparation of feeder layer cells: Remove the spleen of healthy BALB / c mice under sterile conditions, and make a single spleen cell suspension using HAT medium containing 20% ​​fetal bovine serum, and then pre-plate it into a 96-well plate according to the number of plates.

[0061] ④SP2 / 0 myeloma cells and spleen cells were mixed in a certain ratio (quantity ratio 1:5), 50% PEG1450 was used for 1 min, and the mixture was terminated by dilution with basal medium DMEM. After low-speed centrifugation, the mixture was gently suspended and mixed with HAT medium containing 20% ​​fetal bovine serum.

[0062] ⑤ Fusion cells were counted at 2×10 7 Cells / plate were spread into the prepared feeder cell plate and cultured at 5% CO2 and 37°C. After fusion, the cell growth and contamination were checked every day. When the fused cells formed cell clusters, the culture supernatant was taken for screening.

[0063] (3) Screening, cloning and subtype identification of hybridoma cells

[0064] 1) Fusion plate detection: When the cells in the fusion plate are replaced with medium, they grow to a medium size of about 1×10 4 The positive hybridoma cells were screened by indirect enzyme-linked immunosorbent assay. The specific steps are as follows: ① Antigen coating: the purified recombinant SGIV MCP protein was coated on the ELISA plate at a concentration of 1 μg / mL and coated overnight at 4°C; ② Blocking: Block with 5% skim milk powder at 37°C for 2 hours and wash 3 times with TBST; ③ Add different dilutions of the culture supernatant of the hybridoma cells to be tested to a 96-well plate, 100 μL / well, incubate at 37°C for 1 hour, and PBS was used as a blank control; ④ After incubation with the primary antibody, rinse with TBST 3 times, add 1:10000 horseradish peroxidase (HRP)-labeled goat anti-mouse IgG secondary antibody, 100 μL / well, and incubate at 37°C for 40 minutes; After incubation with the secondary antibody, rinse with TBST 5 times; ⑤ Color development: Add 90 μL of substrate color developer (TMB color development solution) to each well and incubate at room temperature in the dark for 15 minutes; ⑥ Stop reaction and colorimetry: Add 50 μL of H2SO4 to each well to stop the reaction, and measure the absorbance at 450nm with an enzyme marker. After the ELISA quality control is qualified (ie, negative control < 0.2, positive control > 1.0), the positive wells (generally OD450 ≥ 0.5) are selected for subcloning.

[0065] 2) Subcloning method and detection: Select cell lines with higher titer and affinity in the fusion plate for limiting dilution, count 60% of the number of monoclonal wells on each plate for subcloning, select monoclonal wells with higher positive values ​​for limiting dilution each time, and perform ELISA detection 4-5 days after each subclone. After secondary subclone screening, the monoclonal cell lines that can stably secrete positive antibodies are finally screened out for fixed-line expansion culture. The supernatant of each round of subclone cell culture is detected by the above-mentioned ELISA method. After ELISA detection, the present invention screened out a total of 8 cell lines that can stably secrete positive antibodies.

[0066] 3) Establishment and expansion of cell lines: The cell lines that stably secrete positive antibodies screened in the subcloning stage are expanded and cultured in 24-well plates. After expansion, the supernatant is collected and the recognition of the antibody in the supernatant to the antigen is detected by immunoblotting. The collected cells are expanded in a 10 cm culture dish, and the supernatant is collected again and the titer of the antibody is detected. The specific steps of the immunoblotting method are as follows: SGIV-infected cells are used as samples, proteins are separated by SDS-PAGE, and the proteins on the gel are transferred to polyvinylidene fluoride (PVDF) membranes by an electrotransfer instrument, and blocked with 1% casein PBS solution for 30 minutes, and monoclonal antibody hybridoma cell supernatant and immune mouse serum are added, incubated overnight at 4°C, rinsed 3 times with PBS solution (PBS solution containing 0.05% Tween-20), and then added with alkaline phosphatase-labeled goat anti-mouse IgG antibody (1:10000 dilution), and continued to incubate at 37°C for 1.5 hours, and rinsed 3 times with PBS solution (PBS solution containing 0.05% Tween-20). Add substrate mixture for display observation. The results of immunoblotting showed that 8 hybridoma cell lines were identified after subcloning, and the cell supernatants with higher antibody titers were selected for WB verification of endogenous samples. The results showed that the culture supernatants of hybridoma cells 7C8 1F4, 4A9 1E7, and 7H8 2F7 could effectively detect a relatively single target band, and the hybridoma cell 7C8 1F4 had the best effect ( Figure 2 ), and then hybridoma cells 7C8 1F4 were selected to prepare ascites.

[0067] The above-mentioned hybridoma cell 7C8 1F4 is named: hybridoma cell line SGIV-MCP-7C8 1F4, which was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on May 11, 2024, address: Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Postal Code: 510070, and the deposit number is: GDMCC No: 64609.

[0068] 4) Ascites preparation and purification

[0069] First, liquid paraffin was injected into the mouse peritoneum, and then hybridoma cells 7C8 1F4 were inoculated into the mouse peritoneum one week later. After 7-10 days, the ascites was collected for purification. The collected ascites was pretreated and then purified by Protein G-agarose affinity chromatography column. The specific steps are as follows: ① Preparation of buffer: the starting buffer was pH 7.0, 20mmol / L phosphate buffer; the elution buffer was pH 3, 0.1mmol / L glycine hydrochloride; ② Preparation of collection tubes: Take 1.5mL centrifuge tubes, add 70μL pH9.0, 0.1mmol / L Tris-HCL to each centrifuge tube; ③ Sample preparation: the sample obtained by 50% SAS precipitation was dialyzed overnight in the starting buffer and filtered through a 0.22μm microporous filter membrane; ④ Purification process: chromatography column pretreatment, rinse 3-5 times with 10 column volumes of deionized water at a flow rate of 1mL / min, and equilibrate the Protein G-agarose affinity chromatography column (HiTrap Protein G 1ml, Pharmacia Biotech) with 10 column volumes of starting buffer (containing 0.3M NaCl), rinse 3-5 times at a flow rate of 1mL / min. Sample loading: Take 15-25mL of the sample to be purified (after the ascites is diluted with the starting buffer) and load it onto the column at a flow rate of 0.6mL / min. Washing: Rinse with the starting buffer until no protein flows out during detection (G250 does not turn blue), at a flow rate of 1.5mL / min. Antibody elution: Elute with elution buffer, collect the eluate and detect the elution product with G250 until it does not turn blue. pH adjustment: Adjust the pH of the eluted product to neutral with saturated sodium carbonate. Sample concentration: Ultrafiltration and concentration to 1-5mL using a 10kDa ultrafiltration tube. Dialysis: Dialyze overnight with 5L0.01M pH 7.4 PBS, and change the solution once the next day. ⑤ Purity and activity identification: The purity of the purified monoclonal antibody was identified by SDS-PAGE.

[0070] In this embodiment, 7.5 mL of ascites was taken from each sample to co-purify one antibody. The results of SDS-PAGE purity test of the purified monoclonal antibody showed that there were two protein bands with molecular weights of approximately 51 kDa and 25 kDa, respectively. Figure 3 ), the antibody purity was above 90%, indicating that the antibody purity after purification was high.

[0071] Example 3: Identification of the properties of the WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus

[0072] 1) Determination of monoclonal antibody concentration in ascites purified antibody

[0073] The concentration of the monoclonal antibody purified from ascites was determined by indirect ELISA. The purified recombinant SGIV MCP protein was used as the coating antigen to determine the concentration of the purified antibody. The ELISA results showed that the concentration of the antibody prepared by 7C8 1F4 was 3 mg / mL.

[0074] 2) Identification of monoclonal antibody subtypes

[0075] The Thermo Scientific monoclonal antibody typing kit was used to identify the subtype of the monoclonal cell supernatant by indirect ELISA. The results showed that the antibodies of the 8 cell lines were all of a single subtype (Table 1).

[0076] Table 1 Results of clone subtype detection

[0077] Strain No. 2D1 3B5 2H6 3D7 1E8 3C11 7H8 2F7 7C8 1F4 4A9 1E7 3F7 1A11 6D1 1H7 Subtype IgG1 IgG1 IgG1 IgG1 IgG2b IgG1 IgG1 IgG1

[0078] 3) Monoclonal antibody titer detection

[0079] The titer of the antibody prepared by 7C8 1F4 was determined by indirect ELISA method. The titer of 7C8 1F4 antibody was determined using purified recombinant SGIVMCP protein as coating antigen. The results are shown in Table 2.

[0080] Table 2 7C8 1F4 antibody titer detection

[0081]

[0082]

[0083] The results of indirect ELISA showed that 7C8 1F4 antibody had good affinity and high detection sensitivity.

[0084] 4) Specific recognition and identification of monoclonal antibodies

[0085] The above-mentioned immunoblotting method was used to detect the recognition of endogenous MCP by antibody 7C8 1F4 obtained after ascites purification. The results showed that a positive band of MCP with a size of about 51 kDa ( Figure 4 ), indicating that the monoclonal antibody 7C8 1F4 described in the present invention can recognize the major capsid protein MCP of SGIV.

[0086] Example 4: Application of WB-guaranteed monoclonal antibody against MCP gene of grouper iridovirus

[0087] Grouper iridovirus MCP gene WB guaranteed monoclonal antibody is used to specifically detect virus infection:

[0088] Indirect immunoblotting method was used to determine the WB guaranteed monoclonal antibody of the MCP gene of grouper iridovirus in the present invention for specific detection of virus infection. The results showed that the positive band of MCP with a size of about 51 kDa could be detected in the sample of SGIV infected cells, while no band was detected in the cell samples infected with RGNNV, ISKNV, LMBV and virus-uninfected cells ( Figure 5 ), indicating that the monoclonal antibody 7C8 1F4 described in the present invention can specifically detect viral infection.

[0089] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Hybridoma cell line SGIV-MCP-7C8 1F4, whose deposit number is: GDMCC No: 64609.

2. WB guaranteed monoclonal antibody against MCP gene of grouper iridovirus, characterized in that: The hybridoma cell line SGIV-MCP-7C8 1F4 is produced by the hybridoma cell line SGIV-MCP-7C8 1F4 described in claim 1.

3. Use of the hybridoma cell line SGIV-MCP-7C8 1F4 according to claim 1 in producing WB-guaranteed monoclonal antibodies against the MCP gene of grouper iridovirus.

4. Use of the WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus according to claim 2 in the preparation of a product for detecting grouper iridovirus.

5. The use according to claim 4, characterized in that: It is used in the preparation of products for detecting grouper iridovirus MCP protein antigen.

6. The use according to claim 4 or 5, characterized in that: The product is selected from any one of a reagent or a kit.

7. The use according to claim 6, characterized in that: The kit is selected from any one of a colloidal gold immunoassay kit, a chemiluminescence kit, a radioimmunoassay kit, an enzyme-linked immunosorbent assay kit or a fluorescent immunoassay kit.

8. A product for detecting grouper iridovirus, characterized in that: The invention comprises the WB guaranteed monoclonal antibody against the MCP gene of grouper iridovirus according to claim 2.

9. A method for detecting grouper iridovirus, characterized in that: The sample to be tested is tested using the WB guaranteed monoclonal antibody against the MCP gene of grouper iridovirus according to claim 2, or the product for detecting grouper iridovirus according to claim 8.

10. Use of the WB-guaranteed monoclonal antibody against the MCP gene of grouper iridovirus according to claim 2 and the product for detecting grouper iridovirus according to claim 8 in detecting grouper iridovirus.

Images