OsEIE3 gene and its application in salt tolerance of rice

Abstract

The present invention discloses OsEIE3 Gene and its application in improving salt tolerance of rice. OsEIE3 The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO: 1. The present invention also discloses OsEIE3 Application of gene mutant plants in improving plant salt tolerance. The protein and its encoding gene of the present invention have important theoretical and practical significance for the study of plant salt tolerance mechanism, and for improving plant salt tolerance and related traits. It will play an important role in the genetic engineering improvement of plant salt tolerance and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biological gene technology and specifically relates to OsEIE3 Genes and their applications in salt tolerance. Background Art

[0002] Rice is one of the most important food crops in the world and the main food source for more than half of the world's population. The salt tolerance of rice is of great significance. It can increase food production, ensure food security, effectively utilize marginal land such as saline-alkali land, and increase food production area. At the same time, salt-tolerant rice cultivation helps improve the soil structure of saline-alkali land, promote ecological balance, and increase biodiversity. In addition, it can optimize water resource utilization, reduce dependence on freshwater resources, and ease water resource tension. In terms of economy, salt-tolerant rice can increase agricultural output value, reduce economic losses caused by soil salinization, and drive the development of related industries.

[0003] Mining salt-tolerant genes plays an important role in rice breeding and agricultural production. The discovery of these genes provides important genetic resources for molecular breeding. Through modern technologies such as gene editing, salt-tolerant genes can be quickly introduced into rice varieties to accelerate the breeding process. The mining and functional research of salt-tolerant genes has promoted a deeper understanding of the mechanism of rice salt tolerance and provided a theoretical basis for plant salt tolerance research. Summary of the invention

[0004] The object of the present invention is to provide OsEIE3 Genes and their application in improving salt tolerance in rice.

[0005] A sort of OsEIE3 Gene, OsEIE3 The polynucleotide of the gene is shown as (a), (b), (c) or (d):

[0006] (a) a polynucleotide as shown in SEQ ID No: 1; or

[0007] (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of salt tolerance;

[0008] (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or

[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has salt-tolerance activity.

[0010] An OsEIE3 protein, wherein the amino acid sequence of the OsEIE3 protein is as shown in (a), (b) or (c):

[0011] (a) the amino acid sequence as shown in SEQ ID No: 2 in the sequence listing; or

[0012] (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or

[0013] (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids in the protein shown in SEQ ID No: 2, and the protein still has salt-tolerance activity.

[0014] Contains the OsEIE3 Gene vector.

[0015] Contains the OsEIE3 Engineered bacteria that carry gene vectors.

[0016] Detection OsEIE3 Primers for any fragment of a gene.

[0017] Said OsEIE3 Application of genes in breeding salt-tolerant rice varieties.

[0018] A method for improving the salt tolerance of rice, reducing OsEIE3 Protein expression level in rice.

[0019] The method comprises transforming rice cells with the DNA molecule or polypeptide or silencing or mutating the DNA molecule or polypeptide contained in target rice, and then cultivating the transformed rice cells into plants to obtain transgenic rice with altered salt tolerance, wherein the salt tolerance can be increased or decreased.

[0020] Beneficial effects of the present invention: The present invention identifies knockout rice for the first time OsEIE3 Gene expression can significantly improve the tolerance of rice seedlings to salt stress, so that the growth inhibition of plant mutant transgenic strains is reduced compared with the wild type after a period of salt stress treatment. The protein and its encoding gene of the present invention have important theoretical and practical significance for the study of plant salt tolerance mechanism, and for improving plant salt tolerance and crop yield traits, and will play an important role in crop genetic breeding, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Shown OsEIE3 DNA identification results of mutant transgenic plants.

[0022] Figure 2 Shown OsEIE3Statistical graph of fresh weight of mutant plants after salt stress (75 mM NaCl) treatment.

[0023] Figure 3 Shown OsEIE3 Phenotype of mutant plants after salt stress (75 mM NaCl) treatment. DETAILED DESCRIPTION

[0024] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0025] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0026] Embodiment 1: OsEIE3 Obtaining mutant transgenic plants

[0027] 1. OsEIE3 Creation of mutant vector transgenic lines

[0028] exist OsEIE3 Select a suitable PAM site at the 5' end of the gene, and design a specific single-stranded guide RNA (sgRNA) based on the selected PAM site. Usually a 20-base long sequence is selected to ensure its binding specificity with the target gene. The designed sgRNA sequence is cloned into the vector to form a complete CRISPR-Cas9 expression vector. The constructed vector is transferred into Agrobacterium EHA105, and then transferred into the Nipponbare (NIP) variety through callus infection to obtain mutant plants. eie3 , DNA fragments were amplified using primer pair LP / RP and then sequenced. eie3 The DNA identification results of the mutant plants and the corresponding encoded amino acid sequences are as follows Figure 1 shown.

[0029] LP: GGCATTCCAGGGCACATGAGGGCT;

[0030] RP: AAACACGCCTCATGTGCCCTGGAA;

[0031] Embodiment 2: OsEIE3 Analysis of salt tolerance in mutant transgenic plants

[0032] right OsEIE3 Mutant strains eie3To identify the salt tolerance at the seedling stage, seeds with uniform germination were soaked at 37°C for 1 day and then germinated. The uniformly germinated seeds were selected and planted in 96-well plates for hydroponics. The seeds were cultured with Yashida medium until they reached the two-leaf and one-heart stage, and then the nutrient solution containing 75 mM NaCl was replaced for treatment. After a period of treatment, the fresh weight before and after treatment was statistically analyzed, and a significance analysis was performed. Under 75 mM NaCl salt stress, there was a significant difference in fresh weight before and after treatment of the wild-type NIP, while the mutant eie3 There was no significant difference in fresh weight before and after treatment, indicating OsEIE3 The mutation can improve the salt tolerance of rice seedlings. Figure 2 , Figure 3 shown.

[0033] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of OsEIE3 protein in breeding salt-tolerant rice varieties, characterized in that: The amino acid sequence of the OsEIE3 protein is shown in SEQ ID No: 2 in the sequence listing, and the rice variety is Nipponbare.

2. A method for improving salt tolerance of rice, characterized in that: Reducing the expression level of the OsEIE3 protein according to claim 1 in rice, wherein the rice is Nipponbare.

Images