Plant cultivation method, application and product

Abstract

The invention relates to the field of plant cultivation, in particular to a plant cultivation method, application and a product. The plant cultivation method comprises the steps that an induction medium is introduced into an initial plant, and a target plant which does not contain the induction medium and is optimized in character compared with the initial plant is obtained through cultivation; the inducing medium can be used for inducing demethylation of 6-methylated basic groups in RNA (Ribonucleic Acid) of a plant; according to the plant cultivation method provided by the invention, the plant which is optimized in character and does not contain an initially introduced induction medium can be obtained.

Description

Technical Field

[0001] The present invention relates to the field of plant cultivation, and in particular to a plant cultivation method, application, obtained target plants and products. Background Art

[0002] Artificial intervention breeding methods for plants usually include a variety of methods, such as genetic engineering, cell engineering, microbial engineering, etc. In order to obtain new plant varieties, the above methods are usually adopted; the new variety plants here include the whole plant, plant organs (flowers, fruits, seeds, roots, stems, leaves, etc.), plant tissues, plant cells and other parts that can be obtained from plants.

[0003] The obtained new varieties of plants are usually expected to show more optimized traits, such as optimized growth, increased yield, optimized biomass, optimized structure or optimized cell division, etc. Among the above optimized traits, increased yield can be increased in many ways, such as increased volume or weight of single seeds / thousand seeds, increased number of root tillers, etc., which can affect plant yield, especially increased yield of the part that is expected to be obtained from the plant.

[0004] The above expectation is usually achieved through some transformation methods, such as by transforming the DNA or histone of the plant to achieve the purpose of changing the plant's traits. Prior to the present application, there has been a method of demethylating plant RNA to achieve the purpose of optimizing plant traits. Summary of the invention

[0005] The aforementioned approach can indeed obtain plants with optimized traits, especially plants with increased yield, but the obtained plants still contain the inducing medium that was initially introduced into the plants, and even the screening criteria or standards for obtaining plants still take plants containing the inducing medium and with optimized traits as the standard; therefore, the applicant has found through research that plants with optimized traits can still be obtained even if they do not contain the inducing medium. More optimally, the degree of trait optimization obtained is not lower than that of plants containing the inducing medium.

[0006] In view of this, the plant cultivation method provided by the present invention can obtain plants with optimized traits and without the introduction of inducing medium. The specific scheme adopted is as follows:

[0007] A plant breeding method comprises introducing an induction medium into an initial plant, and obtaining a target plant without the induction medium and having optimized traits compared with the initial plant by breeding; the induction medium can induce the demethylation of 6-methylated bases in RNA of the plant.

[0008] Optionally, the target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.

[0009] Optionally, the initial plant is transiently introduced into the induction medium to directly obtain a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.

[0010] Alternatively, the induction medium is transiently introduced into protoplast cells of the original plant.

[0011] Optionally, an inducing medium is introduced into the initial plant to obtain an intermediate plant; the intermediate plant obtained is cultured through subsequent generations to obtain a target plant that does not contain an inducing medium and has optimized traits compared to the initial plant.

[0012] Optionally, the intermediate plant contains an inducing medium.

[0013] Optionally, the target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.

[0014] Optionally, the intermediate plant has at least one optimized trait compared to the initial plant, and the degree of optimization is X.

[0015] Optionally, Y is a multiple increase compared to the initial plant in the same period, Y≥0.20; Y≥0.50; Y≥1.00; preferably Y≥2.00; preferably Y≥3.00; preferably Y≥4.00.

[0016] Optionally, the trait optimization includes increased yield.

[0017] Optionally, the trait optimization comprises increasing the yield of plant organs.

[0018] Optionally, the trait optimization includes at least one of an increase in volume, an increase in number, an increase in weight, and an increase in the number of tillers of plant organs.

[0019] Alternatively, the inducing agent may induce demethylation of 6-methylated adenine in the plant RNA.

[0020] Optionally, the induction medium is introduced in excess compared to the initial plants.

[0021] Optionally, the inducing medium is a nucleic acid molecule and / or a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof.

[0022] Optionally, when the induction medium is a nucleic acid molecule, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction medium, and does not contain the polypeptide expressed by the induction medium;

[0023] When the induction medium is a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction medium.

[0024] Optionally, the induction medium is selected from RNA m6A demethylase and its encoding nucleic acid.

[0025] Optionally, the inducing medium is selected from at least one of FTO nucleic acid molecules and / or polypeptides, homologs thereof, functional variants thereof or combinations thereof.

[0026] Optionally, the FTO in the induction medium is derived from vertebrates, invertebrates, algae, or their orthologs or paralogs.

[0027] Optionally, the induction medium is shown in the sequence listing Seq.ID.No1 to Seq.ID.No15.

[0028] Optionally, the initial plant is selected from at least one of food crops, fodder crops, fiber crops, oil crops, sugar crops, beverage crops, spice crops, seasoning crops, medicinal crops, dye crops, ornamental crops, fruit crops, and vegetable crops; preferably selected from at least one of rapeseed, tomato, lettuce, and sugar beet; or preferably selected from at least one of rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, and cassava; or preferably selected from at least one of tobacco, alfalfa, rubber grass, cotton, flax, sunflower, mustard, sedge, hemp, and poplar.

[0029] Optionally, the introduced initial plant region includes at least one of a plant organ, a plant tissue, and a plant cell.

[0030] Optionally, the initial plant region introduced is selected from plant meristems.

[0031] Optionally, the induction medium is introduced into at least one of the cell nucleus and cell sap of the initial plant.

[0032] Optionally, the introduction method includes introducing a vector encapsulating the induction medium into the initial plant.

[0033] Optionally, the offspring cultivation method includes at least one of natural genetic screening removal, hybrid genetic screening removal, and active removal.

[0034] The present application also provides an application of the plant cultivation method described above in preparing plants that do not contain an induction medium and have optimized traits.

[0035] The present application also provides a target plant obtained by the plant cultivation method described above, including at least one of a living whole plant, a plant organ, a plant tissue, and a plant cell.

[0036] The present application also provides products obtained by inactivating the target plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is a schematic diagram of the demethylation process of N6-methylated adenine;

[0038] Figure 2It is the electrophoresis diagram obtained by PCR test of plant samples;

[0039] Figure 3 This is an example of transferring the pCAMBIA 1307 vector carrying the FTO gene and the hygromycin resistance gene Hygromycin into Agrobacterium LBA4404 in Example 2;

[0040] Figure 4 This is a comparison diagram of the whole plant and rice of the initial plant (Nipp) and the intermediate plant (FTO) obtained by taking rice as an example in Example 2;

[0041] Figure 5 This is a comparison diagram of the whole plant and rice of the initial plant (Nipp) and the target plant (Progeny FTO) obtained by taking rice as an example in Example 2;

[0042] Figure 6 This is a comparison diagram of the root systems of the initial plant (Nipp), the intermediate plant (FTO) and the target plant (Progeny FTO) obtained in Example 2 using rice as an example. DETAILED DESCRIPTION

[0043] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments.

[0044] The present application has been found through research that in the process of growth and development of plants, there are specific enzymes that can promote the base methylation of their RNA, such as methyl transfer protein MTA can promote the 6-methylation of the adenine base of RNA, where 6- refers to the adenine base connected to the RNA sequence as the starting point, and the N ranked 6th in order or in reverse order, and the methylated RNA is through a series of processes such as subsequent expression, and itself or its produced products can promote the growth and development of plants. Experiments have confirmed that removing this methylated specific enzyme will affect the growth and development of plants (for example, it is impossible to produce surviving seeds or seeds cannot germinate normally). However, it has been found through research that after the RNA after base position methylation removes some methyl groups, itself or its products are more conducive to the growth and development of plants, and promote the optimization of plant traits. The method of removing methyl groups can be achieved by using a certain induction medium.

[0045] Normally, in order to obtain plants with optimized traits, plants that retain such inducing media are usually selected to obtain plants whose optimized traits can be maintained. However, the applicant unexpectedly discovered that plants that have been induced to demethylate RNA by a certain inducing medium can still maintain their optimized traits even in the absence of the inducing medium. More advantageously, the optimized traits can even be genetically retained.

[0046] The present application study found that after introducing a certain induction medium that can promote RNA demethylation into plants, the plant's own traits are optimized, and plants without induction medium and with optimized traits can be obtained, especially increasing plant yield.

[0047] This type of induction mediator that promotes plant RNA demethylation is usually based on RNA that has been methylated at its base position. Most of these induction mediators are related to demethylases, such as FTO, etc. The chemical mechanism of their induction is as follows Figure 1 As shown, the demethylation process of 6-methylated adenine is taken as an example. Through research, it is found that although the specific RNA sequence induced by this type of induction medium to be demethylated is not clear at present, it is clear that this type of induction medium can indeed demethylate RNA after the base position has been methylated, thereby obtaining plants with optimized traits. More advantageously, plants without this type of induction medium and with optimized traits can also be obtained.

[0048] One embodiment of the present application provides a plant breeding method, which includes introducing an induction medium into an initial plant, and obtaining a target plant that does not contain the induction medium and has optimized traits compared to the initial plant; the induction medium can induce demethylation of 6-methylated bases in the RNA of the plant.

[0049] The "plant" to be cultivated herein specifically refers to the whole plant or plant part with activity; including the whole plant, the ancestors and descendants of the plant, and parts of the plant, including seeds, branches, stems, leaves, roots, flowers, fruits, etc. The term "plant" also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, etc., and can also extend to the harvestable parts of the plant of the present invention, such as but not limited to the plant body and its descendants, or other obtainable active plant parts, etc. The "plant" described in this application is not limited to specific species, including, for example, herbaceous plants, woody plants, algae, ferns, and all plants belonging to the superfamily of the plant kingdom, etc., preferably, for example, monocotyledons or dicotyledons.

[0050] The "plant" to be cultivated herein, as mentioned above, can be selected from a variety of plants, for example, plants selected from the following use classifications: food crops (such as rice, corn, soybeans, etc.), feed crops (such as alfalfa, etc.), fiber crops (such as cotton, hemp, etc.), oil crops (such as sesame, peanuts, etc.), sugar crops (such as sugarcane, sugar beets, etc.), beverage crops, spice crops, seasoning crops, medicinal crops (such as ginseng, ganoderma, Fritillaria, etc.), dye crops, ornamental crops, fruit crops, vegetable crops, etc.; or selected from any of the following specific plants: for example, preferably selected from at least one of rapeseed (Brassicanapus L.), tomato (Lycopersiconesculentum Mill.), lettuce (Lactuca sativa L. var. ramosa Hort.), and sugar beet (Betavulgaris L.); or preferably selected from rice (Oryza sativa L.), corn (Zea mays L.), soybean (Glycine max (Linn.) Merr.), potato (Solanum tuberosum), wheat (Triticum aestivum L.), millet (Setaria italica var. germanica (Mill.) Schred.), sugarcane (Saccharum officinarum), sorghum (Sorghum bicolor (L.) Moench), cassava (Manihot esculenta Crantz); or preferably at least one selected from tobacco (Nicotiana tabacum L.), alfalfa (Medicago Sativa Linn), rubber grass (Taraxacum kok-saghyz Rodin), cotton (Gossypium spp), flax (Linumus itatissimum L.), sunflower (Helianthus annuus L.), flax mustard (Camelinasativa (L.) Crantz), sedge (Cyperus esculentus L.), hemp (Cannabis sativa L.), and poplar (Populus L.).

[0051] The term "initial plant" herein refers to a plant that has not been treated by the method of the present application, and its species and structure may specifically include any of the aforementioned plants. The source of the "initial plant" may be a plant obtained from the wild or artificial cultivation.

[0052] The term "target plant" herein refers to the plant that is treated by the method of the present application and is expected to be obtained, and its species and structure may also include any of the aforementioned plants.

[0053] The term "product obtained by processing plants" used in this article specifically refers to the products obtained after the aforementioned "plants" are inactivated and processed, and they are inactive; they are not limited to various industries, such as industrial, medicinal, edible, etc., nor are they limited to specific ingredient products, such as dry granules, powders, oils, fats, fatty acids, starch or proteins, etc., and are also not limited to specific product forms, such as solid, liquid, gaseous or mixed states, etc.

[0054] The term "increased yield" as defined herein means the increased weight of a specific harvested part relative to the initial plant, e.g. for rice, an increase in the weight of rice grains is an increased yield, for potatoes, an increase in the weight of tubers is an increased yield, etc.

[0055] The term "increased biomass" as defined herein refers to the increased weight of the whole plant excluding the above-mentioned yield increase evaluation part; for example, for rice, the increased weight of the remaining part excluding the rice grains is the increased biomass.

[0056] The yield and biomass described in this article are all compared with the dry weight of plants in the same period.

[0057] The implementation of the method of the present invention provides a plant with an increased growth rate. Therefore, the present invention provides a method for increasing the growth rate of a plant, the method comprising introducing an induction medium that can promote RNA demethylation into the plant to obtain a corresponding target plant that does not carry the induction medium.

[0058] Therefore, the present invention provides a method for increasing plant yield, which comprises introducing an induction medium into an initial plant, and obtaining a target plant that does not contain the induction medium and has increased yield compared to the initial plant; the induction medium can induce RNA demethylation in the plant.

[0059] The traits of the plant can be adjusted and optimized by introducing an induction agent for RNA demethylation. Alternatively, the traits of the plant can also be adjusted and optimized by using homologues, functional variants / combinations, etc. of the induction agent.

[0060] The term "inducing medium" as defined herein refers to a medium that can induce demethylation of RNA in plants. "Inducing" can refer to any one of catalysis and participation in reaction, preferably catalysis. Such medium can be, for example, a demethylase, such as FTO, etc. Furthermore, "RNA" includes one or more RNAs of plants, such as ribosomal RNA (rRNA), messenger RNA (mRNA), transfer RNA (tRNA), etc.; "demethylation" refers to demethylation of RNA that has been methylated, which can be demethylation at one or more sites of RNA, such as demethylation of bases that have been methylated in RNA, such as demethylation of bases methylated at 1-, or demethylation of bases methylated at 6-. Here, 1- and 6- are both positions that define methylation, and can be, for example, the N starting position of RNA connected with bases is 1-, and the 6th position is 6- when counting clockwise or counterclockwise. Here, "base" can be, for example, common bases in nucleic acid molecules, such as adenine (A), cytosine (C), guanine (G), etc.

[0061] The source of the "inducing medium" may be any one or more sources, such as from animals or microorganisms; more preferably, the inducing medium may be derived from vertebrates or algae, preferably from humans or green algae; the "source" defined herein may be directly derived from vertebrates or algae, or may be indirectly derived from vertebrates or algae, such as an ortholog or a paralog thereof of vertebrates or algae, preferably an ortholog or a paralog thereof of humans or green algae.

[0062] The term "paralogous" refers to the duplication of genes within the genome of a species, resulting in paralogous genes.

[0063] The term "orthologous" relates to homologous genes in different organisms resulting from speciation.

[0064] The term "homology" herein refers to homologous sequences that have the same function as the inducing mediator sequence; the term "functional variant / combination" herein refers to variants / combinations of inducing mediators with the same function obtained by mutation, combination, etc. using the inducing mediator.

[0065] The term "introduction" herein includes one or more aspects, such as introduction route, introduction area, introduction amount, and the like.

[0066] There are many ways of introduction, for example, the vector carrying the induction medium can be used to infect the plant, the induction medium can be inserted into the plant's DNA, or the vector carrying the induction medium can be inserted into the cell, and there is no limitation on the introduction area, such as the nucleus or the cell sap. In addition, the introduction can be instantaneous or long-term, or a small amount or an excessive amount, which is specifically related to the characteristics of the plant and the introduced induction medium.

[0067] The term "free of inducing agents" herein means that the obtained target plants at least do not contain the introduced inducing agents.

[0068] For example, when the induction mediator is a nucleic acid molecule, a homologue thereof or a functional variant thereof, the target plant does not contain the induction mediator and the polypeptide expressed by it.

[0069] When the induction mediator is a polypeptide, a homologue thereof or a functional variant thereof, the target plant does not contain the induction mediator.

[0070] More specifically, the present application provides a method for cultivating a plant, the method comprising the following steps:

[0071] The initial plant is introduced with an inducing medium to obtain an intermediate plant; the intermediate plant is cultured through subsequent generations to obtain a target plant that does not contain an inducing medium and has optimized traits compared to the initial plant.

[0072] The target plant obtained in the present application, which does not contain an inducing medium and has optimized traits compared to the initial plant, can be obtained directly or indirectly. Direct acquisition, for example, can be the instantaneous introduction of the inducing medium into the initial plant, especially the instantaneous introduction of the inducing medium into the protoplast cells of the initial plant; indirect acquisition can be obtained through an intermediate plant, that is, the first plant obtained after the introduction of the inducing medium, and the second plant (target plant) can be obtained through the cultivation of its offspring. Both the former and the latter have an effect on the RNA demethylation of the plant. The difference lies in whether it passes through an intermediate plant. Similarly, the terms "intermediate plant" and "target plant" in this article are the same as the aforementioned plants in structure or species.

[0073] The "inducing medium" described in this article is selected from RNA m6A demethylase and its encoding nucleic acid, wherein the encoding nucleic acid is the amino acid sequence of RNA m6A demethylase of the present application, various nucleic acids encoding its amino acid sequence obtained by conventional reverse engineering in the art, or a nucleic acid directly obtained from the source of RNA m6A demethylase.

[0074] The term "intermediate plant" herein may be any subsequent generation of the initial plant. The "intermediate plant" may contain an induction medium.

[0075] The "target plant" described herein may be any subsequent generation of the initial plant, wherein when no intermediate plant is produced, the target plant is a plant directly cultivated from the initial plant. When an intermediate plant is produced, the target plant is obtained from its offspring after being cultivated from the intermediate plant.

[0076] The present application method may not specifically limit the numerical value of the trait optimization degree, that is, it may not be quantitatively described, but only qualitatively described. In the present application method, the trait that can be improved or beneficially increased to the plant belongs to trait optimization. In addition, the trait optimization degree X, Y defined herein can also be limited by specific numerical values, which are all based on the same trait of the initial plant as the basis for comparison, such as the number of seeds increases X, Y, and the total weight of seeds increases X, Y.

[0077] The trait optimization degree Y of the target plant can be the same as the trait optimization degree X of the intermediate plant, or not more than X, or even more than X. If calculated by increase multiple, Y is the increase multiple compared with the initial plant in the same period, Y≥0.20; Y≥0.50; Y≥1.00; preferably Y≥2.00; preferably Y≥3.00; preferably Y≥4.00. Here, the increase multiple can be, for example, weight gain multiple or others.

[0078] In the method of the present application, the induction medium can be selected as a nucleic acid molecule and / or a polypeptide, a homologue thereof or a functional variant / combination thereof.

[0079] The term also means that the inducing medium can be a nucleic acid molecule or a polypeptide, or a mixture of nucleic acid molecules and polypeptides; it can even refer to a paralog or ortholog having the aforementioned homology with the nucleic acid molecule or polypeptide, or a corresponding vector, hybridization, or fusion obtained substance. Specifically, the existing demethylation inducing medium can be, for example, one or more of the sequences listed in the subsequent sequence table. It should be understood that the inducing medium is not limited to the sequences listed in the sequence table.

[0080] The "nucleic acid molecule and / or polypeptide, a homologue or a functional variant thereof" may be any natural or synthetic substance.

[0081] The term "hybridization" as defined herein is the process of mutual return of complementary nucleotide sequences of basic homology. The hybridization process can occur completely in solution, that is, complementary nucleic acids are all in solution. The hybridization process can also be carried out in such a way that one of the complementary nucleic acids is fixed on a matrix such as magnetic beads, agarose beads or any other resin. In addition, the hybridization process can also be carried out in such a way that one of the complementary nucleic acids is fixed on a solid support such as nitrocellulose membrane or nylon membrane, or is fixed on a silica glass support such as by photolithography. In order to make hybridization occur, usually the nucleic acid molecules are thermally denatured or chemically denatured so that the double-stranded chain is melted into two single strands and / or hairpins or other secondary structures are removed from single-stranded nucleic acids. The stringency of hybridization is affected by conditions such as temperature, salt concentration and hybridization buffer composition.

[0082] Nucleic acid molecules or their variants can be from any natural or artificial sources. Can be from microbial sources such as bacteria, yeast or fungi, or from plant, algae or animal (including human) source to isolate nucleic acid / gene or its variant. Can be modified from the native form of nucleic acid in terms of composition and / or genomic environment by rigorous artificial manipulation. Nucleic acid is preferably algae-derived, especially for example green algae-derived.

[0083] The term "homolog" covers two special forms of homology, orthologous sequences and paralogous sequences, which relate to evolutionary concepts used to describe the genetic relationships of genes.

[0084] Homologues can also be in the form of "insertion variants" of proteins, i.e., one or more amino acid residues are introduced into a predetermined site in a protein. Insertion can include fusion of the amino terminus and / or carboxyl terminus, and insertion within the sequence of a single or multiple amino acids. Typically, the insertion within the amino acid sequence will be less than the fusion of the amino terminus or carboxyl terminus, being about the number of 1 to 10 residues. Examples of amino terminus or carboxyl terminus fusion proteins or peptides include binding domains or activation domains of transcriptional activators such as for yeast two-hybrid systems, bacteriophage coat proteins, (histidine) 6-tags, glutathione S-transferase-tags, A proteins, maltose binding proteins, dihydrofolate reductase, Tag.100 epitopes, c-myc epitopes, FLAG epitopes, lacZ, CMP (calmodulin binding peptide), HA epitopes, C protein epitopes, and VSV epitopes.

[0085] Functional variants that can be used in the present application's methods also include optional nucleic acid molecules or gene splice variants. The term "selectable splice variant" used herein encompasses such nucleotide sequence variants, wherein selected introns and / or exons have been excised, replaced or added. Such variants are those in which the biological activity of the protein remains unaffected, and they can be obtained by selectively retaining the functional fragments of the polypeptide. Such splice variants can be naturally found or can be artificial. Methods for producing such splice variants are well known in the art.

[0086] The advantages of the new plants obtained by the plant breeding method of the present application in terms of increased yield or increased root system will be described below through specific examples.

[0087] Example 1: Method for inducing target plants by co-culturing induction medium and protoplasts

[0088] 1. Expression and purification of induction mediators

[0089] Experimental group: The induction medium was cloned into the pET28a vector expressed in Escherichia coli to obtain the induction medium with N-terminal fusion His6 tag. The cloned plasmid was transformed into gold competent cells of Escherichia coli (E.coli) for culture. When OD600 was 0.6-0.8, 0.5mM IPTG was added for induction, expressed at 16℃ for 20h, and the bacteria were harvested. Ultrasonic disruption for 10min, high-speed centrifugation at 13000rpm, 30min. The supernatant was taken for subsequent purification experiments. First, Ni column affinity purification, then cation exchange column, and finally size exclusion chromatography column. The collected protein was concentrated to a higher concentration of 10-20mg / mL, and the purity of the protein was detected by polyacrylamide gel electrophoresis.

[0090] Control group: except that the induction medium was not used, the other steps and parameters were the same as those of the experimental group.

[0091] 2. Preparation of protoplasts

[0092] The first method: seeds were sterilized in 70% ethanol, 0.4% hypochlorite solution for 15 min, washed 3 times with distilled water, and sown on 1 / 2MS solid medium. Seedlings were grown in a 25°C greenhouse with a photoperiod of 16 hours of light and 8 hours of darkness. In order to isolate protoplasts, leaves of 14d plant seedlings, stems and sheaths of 14d plant seedlings were incubated with enzyme solution (1.0% cellulase R10, 0.5% macerozyme R10, 0.45M mannitol, 20mM MES [pH5.7], CPW solution) in the dark at 25°C with shaking (40 rpm) for 12 hours, and then diluted with an equal volume of W5 solution. After filtration, the protoplasts at the bottom of the tube were collected by centrifugation at 100g for 5 minutes. The protoplasts were resuspended in CPW21S solution (CPW solution containing 21% [w / v] sucrose, pH5.8), and then centrifuged at 80g for 7 minutes to collect the protoplasts at the bottom of the tube. Resuspend the protoplasts in W5 solution and centrifuge at 70g for 5 minutes to collect the protoplasts at the bottom of the tube. Finally, resuspend the protoplasts in W5 solution and count them using a hemocytometer under a microscope. Dilute the protoplasts to 1×10 6 The density of protoplasts / ml MMG solution (0.4M mannitol, 15mM MgCl2, 4mM MES [pH5.7]) is suitable for plants such as Arabidopsis and rice.

[0093] The second method: Take plant leaves grown in B5 medium for 3 weeks and digest them with enzyme solution (1% cellulose R10, 0.25% macerozyme R10, 0.5M mannitol, 8mM CaCl2, 5mM MES [pH5.7], 0.1% BSA) in the dark at 25°C for 5 hours. Resuspend the protoplasts twice with an equal volume of W5 solution. In order to obtain complete protoplasts, place the protoplasts in the W5 solution in an equal volume of 21% sucrose gradient 50g centrifugation for 5 minutes, collect the complete protoplasts and resuspend them in W5 solution. Before PEG-mediated transfection, place the prepared protoplast solution at 4°C for at least 1 hour. Applicable to plants such as tobacco.

[0094] 3. Protoplast transfection

[0095] Before transfection, 1-5×10 5 Protoplasts were suspended in 200 μL MMG solution, gently mixed with 5-20 μL protein solution (10-60 μg induction mediator protein) (control and experimental groups were separated) and 210 μL freshly prepared PEG solution (40% [w / v] PEG4000, 0.2 M mannitol and 0.1 M CaCl2), and incubated at 25°C in the dark for 10 minutes. After incubation, 950 μL W5 solution (2 mM MES [pH 5.7], 154 mM NaCl, 125 mM CaCl2 and 5 mM KCl) was slowly added, and the resulting solution was thoroughly mixed by inverting the test tube. Protoplasts were collected by centrifugation at 100 g for 3 minutes and gently resuspended in 1 ml WI solution (0.5 M mannitol, 20 mM KCl and 4 mM MES [pH 5.7]). Finally, the protoplasts were transferred to multi-well plates and cultured at 25°C in the dark for 24 to 48 hours.

[0096] 4. Protoplast regeneration

[0097] The transfected protoplasts were resuspended in 0.5×B5 supplemented medium (0.5×B5 medium, 375 mg / L CaCl2·2H2O, 18.35 mg / L NaFe-EDTA, 270 mg / L sodium succinate, 103 g / L sucrose, 0.2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.3 mg / L 6-benzylaminopurine (BAP), and 0.1 g / L MES), and an equal volume of 2.4% agarose solution was added to dilute the protoplasts to 2.5×10 5 Protoplasts were embedded in agarose and spread in 6-well plates, covered with 2 ml of 0.5×B5 liquid medium, and cultured at 25°C in the dark. After 7 days, fresh 2 ml of 0.5×B5 liquid medium was replaced. The 6-well plates were transferred to the light (16 h light [30 μmol / m-2 s -1 ] and 8 hours of darkness) and cultured at 25°C. After 3 weeks of culture, the microcallus that grew to a diameter of several millimeters was transferred to MS regeneration medium containing 30g / L sucrose, 0.6% plant agar, 0.1mg / l α-naphthaleneacetic acid (NAA), and 0.5mg / L BAP. After about 4 weeks on the regeneration medium, the induction formation of new shoot tissue was observed.

[0098] 5. Plant bud tissue regeneration, transplanting and management

[0099] The newly generated bud tissue was cut off and transferred to the rooting medium to form complete seedlings. The surviving plants were transplanted to the greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.

[0100] 6. Obtaining genetically improved plants without induction media

[0101] The harvested transformed seedlings do not carry the induction medium and can be identified by genomic DNA PCR detection. These plants that do not carry the induction medium are planted in the field, and their yield is evaluated through at least two field experiments to screen out plants with increased yield, and finally obtain the target plants that do not carry the induction medium.

[0102] The following data are calculated based on the target plants of the experimental group and the target plants of the control group collected at the maturity stage. The measured data refer to the above content, and the yield of different plants is calculated as the percentage increase value Y relative to the yield of the control group plants. The yield is calculated based on the harvested products or root systems of different plants, not limited to roots, stems, leaves, flowers, fruits, and seeds.

[0103] The yield of the control group of the present application is the yield of the initial plant without the introduction of the induction medium, and Y is the percentage data of the increase or increase of each trait based on the initial plant, in %; the above data involve weight as dry weight, specifically the data obtained by weighing after 20 minutes of drying in an oven at 105°C and 20 hours of drying in an oven at 80°C. Example 1 The induction medium is a polypeptide or a nucleic acid molecule encoding it, and the specific sequence can use the same as SEQ ID NOs: 1 to 4 in the sequence table of the specification, or a homologous sequence with equivalent functions, or a variant / combination with equivalent functions; the induction medium can be derived from vertebrates, invertebrates or algae.

[0104] The data obtained below are all based on a single variable (i.e., introducing an inducing medium sequence-experimental group or not introducing an inducing medium sequence-control group), and the other factors affecting plant yield and root increase are artificially unified, such as soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, cultivation time period, etc. are all the same; all the substances or components used can be obtained through commercial purchase.

[0105] Table 1—Induction medium from human (Homo sapiens) FTO (experimental group)

[0106]

[0107]

[0108] The above Table 1 may use the human FTO-polypeptide sequence of SEQ ID NOs: 1 in the sequence list or a DNA encoding and expressing the polypeptide sequence, or a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.

[0109] Table 2—Induction medium from porcine (Sus scrofa) FTO (experimental group)

[0110]

[0111]

[0112] The above Table 2 may use the porcine FTO polypeptide sequence of SEQ ID NOs: 2 in the sequence list or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent function or a variant / combination with equivalent function thereof.

[0113] Table 3 - Induction medium from cattle (Bos taurus) FTO (experimental group)

[0114]

[0115]

[0116] The above Table 3 may use the bovine FTO polypeptide sequence of SEQ ID NOs: 3 in the sequence list or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.

[0117] Table 4—Induction medium from green flagellate (Ostreococcus lucimarinus) FTO (experimental group)

[0118]

[0119]

[0120] The above Table 4 may use the green flagellate FTO-polypeptide sequence of SEQ ID NOs: 4 in the sequence list or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.

[0121] Example 2: Method for obtaining intermediate plants by infecting callus tissue with Agrobacterium and screening target plants in subsequent generations

[0122] 1. Inducing callus using plant seeds as test materials

[0123] 1) Disinfection:

[0124] Take mature seeds of the plant, shell them manually, select plump, smooth and sterile seeds, put the seeds in a 100 ml sterile beaker, pour in 70% alcohol for disinfection for 2 minutes; pour out the alcohol, add 20% sodium hypochlorite (NaClO) solution, and soak for 30 minutes; pour out the sodium hypochlorite solution, wash the seeds with sterile distilled water for 4 to 5 times, and finally soak the seeds in sterile distilled water for 30 minutes.

[0125] 2) Induction culture (sterile operation required):

[0126] After the sterilized seeds are placed on sterile filter paper to absorb the surface moisture, they are placed in NB medium (PH5.8) containing 2.0 mg / L 2,4-D, with 12 to 14 seeds per dish; to ensure the induction rate, it is best to keep the germination direction of the seeds parallel to the culture medium or slightly downward during inoculation, and do not let the germination direction be upward or vertically downward. After the operation is completed, seal the culture dish with a sealing film, and induce and culture in the dark in a light incubator at 30°C and a humidity of about 50% for 20 to 30 days until obviously loose callus tissue appears, and then subculture or pre-culture transformation is performed.

[0127] 3) Subculture (sterile operation required):

[0128] Open the culture dish on the clean bench, pick up naturally split, vigorous growth, hard texture, tender yellow color, and callus with a particle diameter of about 3mm with tweezers, and place it in NB medium (PH5.8) containing 2.0mg / L 2,4-D and 0.5mg / L 6-BA, and place 10 callus in each dish, and culture in the dark at 30℃; if the callus is found to be seriously softened, it is recommended to subculture under light. The subculture time is about 10 to 15 days (the next subculture time is determined according to the growth of the callus), and the total subculture is two times. Note: If there is a lot of water on the lid during the flat dish culture process, it is not suitable, which may cause the culture to fail. The reason is that the bottom of the culture dish is heated, and the cover temperature is lower than the culture medium temperature, causing water vapor to condense on the cover of the culture dish.

[0129] 2. Agrobacterium culture

[0130] Experimental group: The vector carrying the induction medium and the hygromycin resistance gene Hygromycin is transferred into the parasitic bacteria, for example, the pCAMBIA 1307 vector carrying the induction medium and the hygromycin resistance gene Hygromycin is transferred into Agrobacterium LBA4404 and inoculated onto a YEP solid culture medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0131] Control group: The vector of the hygromycin resistance gene Hygromycin is transferred into the parasite, for example, the pCAMBIA 1307 vector of the hygromycin resistance gene Hygromycin is transferred into Agrobacterium LBA4404, and inoculated onto a YEP solid medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0132] After the control group and the experimental group were cultured at 28°C for 2 days, single clones of Agrobacterium were picked for colony PCR to verify whether the induction medium had been transferred into Agrobacterium, and positive single clones were selected and cultured in 4 ml YEP (containing 50 mg / L Kan and 20 mg / L RIf) culture medium at 28°C and 220 rpm for 20 to 36 h until the OD600 of the bacterial solution was 0.8 to 1.0.

[0133] 3. Infection and co-cultivation

[0134] 1) The cultured Agrobacterium culture (control group and experimental group are separated) is centrifuged at 4°C, 4000 rpm for 10 min, and the supernatant is removed. A suspension is prepared with AAM culture medium containing 100 umol / L acetosyringone, so that the final concentration of the culture liquid OD600 is about 0.2.

[0135] 2) Pick out rice callus that has grown to a certain size and infect it with Agrobacterium suspension for 20 to 30 minutes.

[0136] 3) Remove the callus tissue and place it on sterile filter paper to drain for 20 to 30 minutes to prevent excessive growth of Agrobacterium during co-cultivation and excessive damage to the callus tissue.

[0137] 4) The callus was placed in NB medium (pH 5.2) containing 2.0 mg / L 2,4-D and 100 umol / L acetosyringone and cultured in the dark at 25°C for 48 to 72 h.

[0138] Note: The co-culture should be followed up and observed. If Agrobacterium is obviously seen, it means that the infection is over-infected and it is easy to grow bacteria in subsequent screening.

[0139] 4. Screening of resistant callus

[0140] Take out the callus and wash it with sterile water for 5-6 times, shaking it continuously. Then place the callus on sterile filter paper to air dry, and evenly place it on NB medium (PH 5.8) containing 50mg / L hygromycin for the first round of selection. Culture it in the dark at 28℃. If mold or Agrobacterium growth is found, transfer the callus with bacteria to a new screening plate in time.

[0141] After new callus tissue grows out after about 30 days of screening, transfer it to new NB medium (PH5.8) containing 50 mg / L hygromycin and screen it for another 7 to 10 days. If it grows obviously, it is a positive callus tissue. If it does not grow, it may be a false positive even if it does not turn brown and die.

[0142] 5. Induction of differentiation and rooting of positive callus

[0143] Place the yellow callus particles (to ensure that the callus used for differentiation is flawless) that have strong growth in the second screening on NB medium (PH5.8) containing 2.0mg / L 6-BA, 0.5mg / L kinetin, and 50mg / L hygromycin. Place 2 to 3 positive clones in each bottle. Place a small amount of callus for each clone. The callus placed should be of high quality, not quantity. Cultivate in the dark at 27℃ for 10 days, then illuminate and differentiate for 10 to 20 days. After growing green leaves, rooting can be carried out. The light intensity is 4000lux, 14h / d.

[0144] Place the robust seedlings differentiated from each clone in 1 / 2N6 medium (PH5.8) containing 0.5mg / L naphthaleneacetic acid and 50mg / L hygromycin to induce rooting, with 2-3 seedlings placed in each bottle. Culture under light at 27-30℃, light intensity 4000lux, 14h / d, open the sealing film after 7-10 days and add appropriate amount of sterile water. Transplant after 2-3 days.

[0145] Note: The callus cannot be subcultured during the differentiation process. The time from differentiation to transplanting of intermediate plants is about three months.

[0146] 6. Training and transplanting of middle plants

[0147] Pick out the seedlings of the intermediate plants with relatively complete differentiation of roots, stems and leaves (when the seedlings grow to the top of the test tube, open the lid in time), open the sealing film, add appropriate amount of distilled water or sterile water (to prevent bacteria from growing in the culture medium), harden the seedlings for about 3 days to a week, then wash off the agar, transplant them into soil pots in the greenhouse for growth, test, and obtain the intermediate plants.

[0148] 7. Testing and verification of intermediate plants

[0149] 1) PCR detection: design induction mediator primers, such as FTO-F: ATGAAGCGCACCCCGACTG; FTO-R: GGGTTTTGCTTCCAGAAGCTGA; PCR reaction program: 95°C 5min, 95°C 15s, 58°C 15s, 72°C 30s, 35 cycles, 72°C extension 10min, 4°C storage. After the reaction, the PCR product was analyzed by 1% agarose gel electrophoresis.

[0150] 2) Method for rapid detection of intermediate plants with hygromycin: Cut and collect fresh green leaves of about 1 cm long from the seedlings to be tested (with incisions at both ends), place them flat on the test culture medium (0.7% agar, 1 ml / L 6-BA, 50 mg / L hygromycin), and culture them at 28°C, 16 h light / 8 h dark for 48 h. Plants with leaves that remain bright green are positive plants, while leaves of negative seedlings show blocky necrosis.

[0151] 8. Evaluation of the effect of induction medium in intermediate plants

[0152] The following data are calculated based on the middle plants of the experimental group and the control group collected at maturity. The measured data refer to the above content, and the yield of different plants is calculated as the percentage increase value X relative to the yield of the control group plants. The yield is calculated based on the harvested products or root systems of different plants, not limited to roots, stems, leaves, flowers, fruits, and seeds.

[0153] The yield of the control group plants in the present application is the yield of the initial plants without the introduction of the inducing medium, and Y is the percentage data of the increase or increase of each trait based on the initial plants, and the unit is %; the above data involve weight as dry weight, specifically the data obtained by weighing after drying in an oven at 105°C for 20 minutes and drying in an oven at 80°C for 20 hours.

[0154] The data obtained below are all based on a single variable (i.e., introducing an inducing medium sequence-experimental group or not introducing an inducing medium sequence-control group), and the other factors affecting plant yield and root increase are artificially unified, such as soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, cultivation time period, etc. are all the same; all the substances or components used can be obtained through commercial purchase.

[0155] 9. Obtaining genetically improved target plants without induction media

[0156] 1) Isolated from intermediate plants.

[0157] In a plant that overexpresses an inducing medium, when cells undergo meiosis to form reproductive cells, the inducing medium will separate with the separation of homologous chromosomes and enter one of the gametes. After self-pollination, it will be independently inherited by the gametes to the offspring, thereby generating gene separation to produce offspring that do not carry the inducing medium type and offspring that overexpress the inducing medium type. Plants whose genomes do not carry the inducing medium and hygromycin genes can be screened by genomic DNA PCR detection. These plants that do not carry the inducing medium and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments, and target plants with optimized traits are screened, and finally target plants with optimized traits whose genomes do not carry the inducing medium and hygromycin genes are obtained.

[0158] 2) Obtained by hybridization between an intermediate plant and the wild type.

[0159] Crop hybridization is to allow the pistil of one variety to accept the pollen of other varieties to complete the fertilization process and obtain hybrid seeds. For example, rice is a self-pollinating crop with monoecious plants and the same flowers. It is necessary to remove the male organs of the T3 generation of the pure and strains that overexpress the inducing medium, and artificially fertilize with pollen of wild rice for hybridization to obtain hybrid seeds. The hybrid seeds are intermediate plants that overexpress the inducing medium. Self-pollination will cause gene separation, thereby producing progeny that do not carry the inducing medium type and progeny that overexpress the inducing medium type. Rice whose genome does not carry the inducing medium and hygromycin genes can be screened by genomic DNA PCR detection. These plants that do not carry the inducing medium and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments to screen out the target plants with optimized traits, and finally obtain the target plants with optimized traits whose genome does not carry the inducing medium and hygromycin genes.

[0160] 3) Obtained through natural loss during the genetic process of intermediate plants from generation to generation.

[0161] During the reproduction and seed breeding process of crops, meiosis occurs to form reproductive cells. The sperm (pollen) and egg combine to complete the fertilization process to form a zygote, which then develops into a seed. This process increases species diversity and promotes the evolution of species genotypes. In the process of seed plant breeding from generation to generation, the natural loss of exogenous genes will occur. After the loss of exogenous genes, the target plants with optimized traits that do not carry induction media are obtained. In the process of inheritance from generation to generation of the overexpression induction medium strain, the exogenous genes in the genome are lost through continuous genomic DNA PCR detection from generation to generation, that is, the induction medium and hygromycin genes cannot be detected. According to existing experience, the loss of exogenous genes can be observed in the T2 generation. These plants that do not carry induction medium and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments. The target plants with optimized traits are screened out, and finally the target plants with optimized traits whose genomes do not carry induction medium and hygromycin genes are obtained.

[0162] Note: Genomic DNA PCR detection method:

[0163] Design gene primers such as FTO-F: AGGAAGTTCATTTCATTTGGAGAGGAC; FTO-R: GGGTTTTGCTTCCAGAAGCTGA; PCR reaction program: 95°C 5min, 95°C 15s, 60°C 120s, 72°C 30s, 35 cycles, 72°C extension 10min, 4°C storage. After the reaction, the PCR product was analyzed by 1% agarose gel electrophoresis.

[0164] Hygromycin gene primers Hyg-F: CTTCTACACAGCCATCGGTC; Hyg-R: ACAATCCCACTATCCTTCGC were designed; the PCR reaction program was: 95℃5min, 95℃15s, 55℃120s, 72℃30s, 35 cycles, 72℃ extension 10min, 4℃ storage. After the reaction, the PCR products were analyzed by 1% agarose gel electrophoresis.

[0165] Here’s how to do it:

[0166] 1. Plant DNA Extraction Method

[0167] Kit name: DNAquick Plant System Quick Plant Genomic DNA Extraction System

[0168] Brand: TIANGEN

[0169] 1. Processing materials:

[0170] Take 100mg of fresh plant tissue, put it into a 2ml test tube with a steel ball or put 10mg into the well of a 96-well plate (the solution below the 96-well plate extraction is halved), place it in a -80 degree refrigerator for more than half an hour, shake it in a grinder for 1 minute, add 400ul buffer FP1 and 6ul RNase A (10mg / ml), vortex and shake for 1min, and place it at room temperature for 10min. Note: Due to the rich diversity of plant materials, the optimal amount of experimental materials taken needs to be explored according to different materials, or different tissues of the same material, etc.

[0171] 2. Add 130ul buffer FP2, mix thoroughly, and vortex for 1min.

[0172] 3. Centrifuge at 12,000 rpm (~13,400 x g) for 5 min and transfer the supernatant to a new centrifuge tube.

[0173] 4. Optional step: Centrifuge the supernatant again at 12000 rpm (~13,400 x g) for 5 min and transfer the supernatant to a new centrifuge tube.

[0174] Note: The purpose of this step is to remove the precipitated impurities in the supernatant to make the extracted genomic DNA purer.

[0175] 5. Add 0.7 times the volume of isopropanol to the supernatant and mix thoroughly. At this time, flocculent genomic DNA will appear. (For example, add 350ul of isopropanol to 500ul of supernatant), centrifuge at 12,000rpm (~13,400xg) for 2min, discard the supernatant, and keep the precipitate.

[0176] 6. Add 600ul of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000rpm (~13,400xg) for 2 minutes, and discard the supernatant.

[0177] 7. Repeat step 6.

[0178] 8. Open the lid and invert it at room temperature for 5-10 minutes to completely dry the remaining ethanol.

[0179] Note: Ethanol residue will affect subsequent enzyme reactions (enzyme digestion, PCR, etc.)

[0180] 9. Add 200ul of elution buffer TE and dissolve the DNA in a 65 degree water bath for 10-60 minutes. Invert and mix several times to help dissolution, and finally obtain a DNA solution.

[0181] 2. PCR reaction

[0182] 1. Reagents

[0183] Specific primer: FTO primer

[0184] PCR enzyme mix: New blue fuel high-fidelity Taq enzyme mix, brand: Polymer

[0185] Primers: FTO primers, forward primer FTO-F, reverse primer FTO-R

[0186] 2. Configure the reaction system

[0187] Add each component in turn to a 0.2 ml centrifuge tube or a well on a PCR plate.

[0188]

[0189]

[0190] 3. Set the time and temperature as follows, and perform electrophoresis identification after amplification.

[0191] Pre-denaturate at 95℃ for 3 min, then enter the cyclic amplification stage: 95℃ for 30 s → 58℃ for 30 s → 72℃ for 20 s, cycle 30-35 times, and keep warm at 72℃ for 5 min.

[0192] 3. Agarose nucleic acid electrophoresis

[0193] 1. Wash the electrophoresis equipment with distilled water and set up the comb.

[0194] 2. Prepare agarose gel of appropriate concentration of 1.5%, accurately weigh 1.5 g of agarose and add it to a conical flask, and add about 100 ml of electrophoresis buffer (TAE).

[0195] 3. After melting in a microwave oven, take it out and wait for a while to cool down before adding 10ul of dye (10000X), mix thoroughly and pour into the electrophoresis tank.

[0196] 4. Allow to solidify at room temperature for about 40 minutes, carefully remove the comb, and place the gel in the electrophoresis tank for spotting.

[0197] 5. Add electrophoresis buffer to the electrophoresis tank until it covers the surface of the gel. There should be no bubbles in the sample wells.

[0198] 6. Before spotting the sample, add 5ul of sample and marker (in the eight-tube strip), and use a gun to slowly inject the mixed sample into the spotting wells, taking care not to cross the wells.

[0199] 7. According to the positive and negative poles (red positive and black negative), turn on the power supply, the voltage is 40-60V, the time is 30-40min, and the position of bromophenol blue can be used to determine whether to terminate the electrophoresis.

[0200] 8. After electrophoresis is completed, turn off the power, observe the gel image, and compare with the marker to determine the fragment size.

[0201] 4. Test results:

[0202] like Figure 2 The electrophoresis diagram shown: the presence of bands indicates that the sample contains the FTO gene, and the absence of bands indicates that the sample does not contain the FTO gene.

[0203] 10. Evaluation of target plant traits

[0204] The following data are calculated based on the target plants of the experimental group and the target plants of the control group collected at the maturity stage. The measured data refer to the above content, and the yield of different plants is calculated as the percentage increase value Y relative to the yield of the control group plants. The yield is calculated based on the harvested products or root systems of different plants, not limited to roots, stems, leaves, flowers, fruits, and seeds.

[0205] The yield of the control group plants in the present application is the yield of the initial plants without the introduction of the inducing medium, and Y is the percentage data of the increase or increase of each trait based on the initial plants, and the unit is %; the above data involve weight as dry weight, specifically the data obtained by weighing after drying in an oven at 105°C for 20 minutes and drying in an oven at 80°C for 20 hours.

[0206] The data obtained below are all based on a single variable (i.e., introducing an inducing medium sequence-experimental group or not introducing an inducing medium sequence-control group), and the other factors affecting plant yield and root increase are artificially unified, such as soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, cultivation time period, etc. are all the same; all the substances or components used can be obtained through commercial purchase.

[0207] In Example 2, the inducing medium is a nucleic acid molecule or a polypeptide. The specific sequence can be the same as SEQ ID NOs: 1 to 8 or SEQ ID NOs: 12 to 15 in the sequence table of the specification, or a homologous sequence with equivalent functions, or a variant / combination with equivalent functions; the inducing medium can be derived from vertebrates or algae.

[0208] The solution used in Example 2 can be specifically exemplified as follows:

[0209] 1. YEP liquid culture medium formula for Agrobacterium growth (content per liter): yeast extract 10g / L + peptone 10g / L + NaCl5g / L, PH 7.2, solid culture medium with 15g / L agar.

[0210] 2. AAM culture medium for Agrobacterium resuspension: 50ml 20×AA macroelements, 10ml 100×FeEDTA, 10ml100×B5 macroelements, 10ml 100×B5 vitamins, 100ml 10×AA amino acids, 1ml 100mM acetosyringone, 68.5g sucrose, 36g glucose, 0.5g hydrolyzed casein, make up to 1000ml, adjust pH to 5.2, and sterilize through 0.22mm cellulose acetate membrane.

[0211] 3. 20×AA macroelements: 59g KCl, 3g CaCl2·2H2O, 10g MgSO4·7H2O and 3g NaH2PO4·H2O, dilute to 1L with distilled water and store at 4℃.

[0212] 4. 10×AA amino acids: 8.76 g Gin, 2.66 g Asp, 1.74 g Arg and 75 mg Gly are diluted to 1 L with distilled water, sterilized by passing through a 0.22 mm cellulose acetate membrane, and stored at 4°C.

[0213] 5. 100×B5 vitamins: 10g inositol, 1g thiamine hydrochloride, 100mg pyridoxine hydrochloride and 100mg niacin, dilute to 1L with distilled water and store at 4℃.

[0214] 6. 100×B5 macroelements: 1.320mg MnSO4·4H2O, 200mg ZnSO4·7H2O, 2.5mg CuSO4·5H2O, 25mg Na2MoO4·2H2O, 2.5mg CoCl2·6H2O, 300mg H3BO3 and 75mg KI, make up to 1L with distilled water and store at 4℃.

[0215] 7. NB medium: macroelements and trace elements of N6 medium, organic elements of B5 medium, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 30 g / L sucrose and 8 g / L agar.

[0216] Example 3: Method for obtaining intermediate plants by infecting stem tip tissue with Agrobacterium and screening target plants in subsequent generations

[0217] 1. Inducing callus using mature plant embryos as test materials

[0218] Take mature seeds and soak them in clean water, change the water every 1 to 2 hours, and wait for 2 days until the seeds burst and turn white, then germinate and root them at 37℃. When the embryo grows to 1.5 to 2.0 cm, use a scalpel to cut off the embryo and coleoptile from the stem ring at the stem tip to expose the stem tip meristem.

[0219] 2. Agrobacterium culture (same as step 2 in Example 2)

[0220] 3. Infection and co-cultivation

[0221] The treated plants were placed in AAM resuspension (see step 3 of Example 2), 200 l / L of surfactant Silwet L-77 was added, vacuum treated at 1.5 KPa for 8 min, the resuspension was discarded, and the plants were placed on clean and moist perlite and cultured in the dark at 28°C for 3 days.

[0222] 4. Screening, transplanting and management of intermediate plants

[0223] The plants after dark culture were moved to the plant nursery, and leaves of the transformed plants were collected at the three- to four-leaf stage for transformation seedling PCR detection and identification: design gene primers, such as FTO-F: ATGAAGCGCACCCCGACTG; FTO-R: GGGTTTTGCTTCCAGAAGCTGA; PCR reaction program: 95℃5min, 95℃15s, 58℃15s, 72℃30s, 35 cycles, 72℃ extension 10min, 4℃ storage. After the reaction, the PCR product was analyzed by 1% agarose gel electrophoresis. After 7 days, the surviving plants were transplanted to the greenhouse of the transgenic plant demonstration base and routine fertilizer and water management was carried out. The transformed seedlings were harvested.

[0224] 5. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)

[0225] 6. Obtaining genetically improved target plants without induction media

[0226] The transformed seedlings and seeds of the harvest will undergo gene separation to produce progeny that do not carry the inducing medium type and progeny that overexpress the inducing medium type. The plant whose genome does not carry the inducing medium and hygromycin gene can be screened by the mode of genomic DNA PCR detection (same as step 9 of Example 2). These plants that do not carry the inducing medium and hygromycin gene are planted, and their optimized traits are evaluated by at least two experiments, and the target plants with optimized traits are screened out, and the target plants with optimized traits that the genome does not carry the inducing medium and hygromycin gene are finally obtained.

[0227] The induction medium may be naturally lost in the harvested transformed seedlings and seeds. These plants that do not carry the induction medium and hygromycin gene (the method of genomic DNA PCR detection is the same as step 9 of Example 2) are planted, and their optimized traits are evaluated through at least two experiments to screen out target plants with optimized traits, and finally obtain target plants with optimized traits whose genome does not carry the induction medium and hygromycin gene.

[0228] 7. Evaluation of target plant traits (same as step 10 in Example 2)

[0229] Example 4: A method for obtaining intermediate plants by inducing meristems through infection with Agrobacterium and screening target plants in the offspring (this method can be applied to any living plant to directly obtain target plants by inducing meristems)

[0230] 1. Plant cultivation

[0231] The mature seeds were planted in nutrient soil and grown in a 24°C greenhouse environment with 16 h light / 8 h dark until maturity (approximately 63 to 66 days).

[0232] 2. Agrobacterium culture

[0233] DRs (growth regulatory elements) are a type of growth regulatory elements that induce plants to form meristems. Commonly used ones include BBM, ipt, ΔMP, STM, Wus2, etc.

[0234] Experimental group: The vector carrying the induction medium, hygromycin resistance gene Hygromycin and DRs was transferred into Agrobacterium GV3101, and cultured overnight at 28°C for 12 hours in a growth medium (10mM MES, pH5.6, 20μM acetosyringone, 50mg / L kanamycin, 50mg / L gentamicin), centrifuged at 5000rpm for 10 minutes, and the cells were collected and resuspended in an infiltration medium (10mM MES, 150μM acetosyringone, 10mM MgCl2) to an OD600 value of 0.2-0.3. The Agrobacterium infection solution was placed at room temperature (about 25°C) for 2-4 hours before inoculation.

[0235] Control group: The vector carrying the hygromycin resistance gene Hygromycin and DRs was transferred into Agrobacterium GV3101, and cultured overnight at 28°C for 12 hours in a growth medium (10mM MES, pH5.6, 20μM acetosyringone, 50mg / L kanamycin, 50mg / L gentamicin), centrifuged at 5000rpm for 10 minutes, and the cells were collected and resuspended in an infiltration medium (10mM MES, 150μM acetosyringone, 10mM MgCl2) to an OD600 value of 0.2 to 0.3. The Agrobacterium infection solution was placed at room temperature (about 25°C) for 2 to 4 hours before inoculation.

[0236] 3. Infection and screening of intermediate plants

[0237] Remove visible shoot meristems from all plants, leaving 2-3 nodes and supporting leaves. Immediately inoculate the wound site with an Agrobacterium infection solution using a syringe and a 31G needle. Observe the bud formation of the plant at the cut site 38-48 days after inoculation. Each injection site with newly formed tissue or meristem is counted as a single event. The appearance of bud tissue is identified by genomic PCR (see Example 2, step 7) as an indicator of transgenic presence and expression.

[0238] 4. Transplantation and management of intermediate plants

[0239] The newly generated bud tissue was cut off and transferred to the rooting medium to form complete seedlings. The surviving plants were transplanted to the greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.

[0240] 5. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)

[0241] 6. Obtaining target plants with optimized traits without induction media

[0242] The harvested transformed seedlings and seeds will undergo gene segregation to produce progeny that do not carry the induction medium type and progeny that overexpress the induction medium type. Plants whose genomes do not carry the induction medium and hygromycin genes can be screened by genomic DNA PCR detection. These plants that do not carry the induction medium and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments to screen out target plants with optimized traits, and finally obtain target plants whose genomes do not carry the induction medium and hygromycin genes and have optimized traits.

[0243] The induction medium may be naturally lost in the harvested transformed seedling seeds. These plants that do not carry the induction medium and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments to screen out target plants with optimized traits, and finally obtain target plants with optimized traits whose genomes do not carry the induction medium and hygromycin genes.

[0244] 7. Evaluation of target plant traits (same as step 10 in Example 2)

[0245] Example 5: Method for obtaining target plants by mechanical inoculation of PVX vectors

[0246] 1. Plant cultivation

[0247] The mature seeds were planted in nutrient soil and grown in a 24°C greenhouse environment with 16 h light / 8 h dark until maturity (approximately 63 to 66 days).

[0248] 2. Agrobacterium culture

[0249] Experimental group: The vector pPZPVX carrying the induction medium was transferred into Agrobacterium C58C1, and the cells were collected after culture in Luria broth medium and suspended in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to an OD600 value of 0.2 to 0.3. The Agrobacterium infection solution was placed at room temperature (about 25°C) for 2 to 4 hours before inoculation.

[0250] Control group: The vector pPZPVX without the induction medium was transferred into Agrobacterium C58C1, and the cells were collected after culture in Luria broth medium and suspended in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to make the OD600 value 0.2-0.3. The Agrobacterium infection solution was placed at room temperature (about 25°C) for 2-4 hours before inoculation.

[0251] 3. Infection and screening of intermediate plants

[0252] Use a syringe to infiltrate tobacco leaves with Agrobacterium carrying the inducing medium expression plasmid. After 7 days, homogenize the inoculated leaves with 10mM NaPi buffer (pH 7.0) (Western blot verifies the expression of the inducing medium). After homogenization, centrifuge at 16,000g for 3 minutes and filter the supernatant with a 0.45μm filter. Apply the filtered supernatant and corundum (600 mesh) to the fourth or fifth true leaf and rub it gently by hand to mechanically inoculate PVX. After inoculation, the plants are placed in a 16-hour light / 8-hour dark photoperiod at 16°C for growth, and the formation of new shoots at the inoculation site is observed after 7 to 8 days.

[0253] Note: Western blot detection of induction mediator expression: Take the inoculated leaf tissue powder and mix it with 1×1 oading buffer, heat it at 95℃ for 10 minutes, centrifuge it at 15000rpm for 10 minutes at room temperature, take the supernatant, load it to 10% SDS-PAGE, transfer it to the membrane after electrophoresis, and after blocking, use the induction mediator antibody to detect the induction mediator expression.

[0254] 4. Transplantation and management of intermediate plants

[0255] The newly generated bud tissue was cut off and transferred to the rooting medium to form complete seedlings. The surviving plants were transplanted to the greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.

[0256] 5. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)

[0257] 6. Obtaining target plants with optimized traits without induction media

[0258] The harvested transformed seedlings do not carry the induction medium and can be identified by genomic DNA PCR detection. These plants that do not carry the induction medium are planted, and their optimized traits are evaluated through at least two experiments to screen out target plants with optimized traits, and finally obtain target plants with optimized traits whose genome does not carry the induction medium and hygromycin gene.

[0259] 7. Evaluation of target plant traits (same as step 10 in Example 2)

[0260] Example 6: Method for obtaining target plants by haploid induction-editing (HI-Edit) technology

[0261] Haploid induction (HI) technology can induce haploids by appropriate modification of CENTROMERIC HISTONE3 (CENH3) or knockout of MATRILINEAL (MATL) and then double chromosomes, obtain homozygous candidate materials in a short time, and fix the genotype of crops, which is of great significance in crop breeding practice. Haploid induction-editing (HI-Edit) technology combines haploid induction breeding with gene editing technology, and can directly improve a wide range of plants in a short time, including commercial varieties, and get rid of the species and genotype restrictions of the existing gene editing system; since the chromosomes of the donor carrying the gene editing element will be eliminated during the hybridization process after being introduced through the haploid induction line, the hybrid obtained will not contain the genetic information of the father, and there is no need for multiple backcrossing. Only chromosome doubling of the target haploid plant can obtain an improved diploid strain, shortening the breeding cycle; the target crop can be improved through distant hybridization, with a wide range of applications, and transgene-free strains can be obtained.

[0262] 1. Construct an induction medium vector and introduce it into the non-haploid induction inbred line NP2222 to obtain stable transformed plants

[0263] Use 9-day-old immature embryos isolated from inbred line NP2222, and mix the isolated immature embryos with Agrobacterium strain LBA4404 (experimental group) carrying a carrier of an induction medium or Agrobacterium strain LBA4404 (control group) not carrying a carrier of an induction medium. The infected embryos are cultured on a recovery medium and a callus induction medium. Callus is selected on a medium containing mannose, and resistant callus is regenerated as an intermediate plant to obtain a stable transformed plant.

[0264] 2. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)

[0265] 3. Select the intermediate plants carrying the induction medium and hybridize them with the natural haploid induction line RWKS, and select the individuals carrying the induction medium and the homozygous matl mutation.

[0266] The natural haploid induction line RWKS contains the haploid inducer matl allele and the R1 color marker. After the RWSK is crossed with the strain carrying the induction medium, its progeny will produce trait segregation. The hybrid progeny containing the induction medium and the haploid inducer matl allele from RWKS and the R1 color marker are selected and self-pollinated, and individuals carrying the induction medium and the homozygous matl mutation are selected from the F2.

[0267] 4. Screening and acquisition of target plants

[0268] The F2 plants homozygous for mat1 and the induction medium were hybridized again with various plant inbred lines, and haploid plants with the genotype of MATL and not carrying the induction medium were screened out by the unique grain color marker of RWKS, and the target plants were obtained by embryo rescue. The harvested transformed plants that do not carry the induction medium can be identified by genomic DNA PCR detection. These plants that do not carry the induction medium are planted, and their optimized traits are evaluated through at least two experiments, and the target plants with optimized traits are screened out, and finally the target plants with optimized traits whose genome does not carry the induction medium and hygromycin gene are obtained.

[0269] 5. Evaluation of target plant traits (same as step 10 in Example 2)

[0270] The above-mentioned Examples 2 to 6 all require the use of intermediate plants to obtain the target plants, and all measure the degree of trait optimization. The following table data is presented based on the data of Example 2. The data of the remaining examples basically differ from the data of Example 2 by no more than ±5%, and will not be repeated here.

[0271] Table 5—Induction medium from human (Homo sapiens) FTO (experimental group)

[0272]

[0273]

[0274] The above Table 5 may use the human FTO polypeptide sequence of SEQ ID NOs: 1 in the sequence list or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.

[0275] Table 6 - Induction medium from pig (Sus scrofa) FTO (experimental group)

[0276]

[0277]

[0278]

[0279] The above Table 6 may use the porcine FTO polypeptide sequence of SEQ ID NOs: 2 in the sequence list or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent function or a variant / combination with equivalent function thereof.

[0280] Table 7—Induction medium from cattle (Bos taurus) FTO (experimental group)

[0281]

[0282]

[0283] The above Table 7 may use the bovine FTO polypeptide sequence of SEQ ID NOs: 3 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.

[0284] Table 8—Induction medium from green flagellate (Ostreococcus lucimarinus) FTO (experimental group)

[0285]

[0286]

[0287] The above Table 8 can use the green flagellate FTO-polypeptide sequence of SEQ ID NOs: 4 in the sequence list or a DNA that can express the polypeptide sequence, its homologous sequence with equivalent functions or its variant / combination with equivalent functions.

[0288] Table 9 - Examples of FTO introduced into plants where the induction medium is derived from various algae and invertebrates

[0289]

[0290]

[0291] The above Table 9 may use various algae sequences and invertebrate sequences of SEQ ID NOs: 5 to 15 in the sequence list or DNA expressing the sequences, homologous sequences with equivalent functions or variants / combinations with equivalent functions thereof.

[0292] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A plant cultivation method, characterized in that: The method comprises introducing an induction medium into an initial plant, and obtaining a target plant without the induction medium and having optimized traits compared with the initial plant through cultivation; the induction medium can induce demethylation of 6-methylated bases in RNA of the plant.

2. The plant cultivation method according to claim 1, characterized in that The target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.

3. The plant cultivation method according to claim 1, characterized in that The initial plant is instantaneously introduced with the induction medium, and the target plant which does not contain the induction medium and has optimized traits compared with the initial plant is directly obtained.

4. The plant cultivation method according to claim 1, characterized in that The induction medium is transiently introduced into the protoplast cells of the initial plant.

5. The plant cultivation method according to claim 1, characterized in that The initial plant is introduced with an inducing medium to obtain an intermediate plant; the intermediate plant is cultured through subsequent generations to obtain a target plant that does not contain an inducing medium and has optimized traits compared to the initial plant.

6. The plant cultivation method according to claim 5, characterized in that The intermediate plant contains the inducing medium.

7. The plant cultivation method according to claim 5, characterized in that The target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.

8. The plant cultivation method according to claim 7, characterized in that The intermediate plant has at least one optimized trait compared to the initial plant, and the degree of optimization is X.

9. The plant cultivation method according to any one of claims 2 or 7, characterized in that: Y is the multiple increase compared to the initial plant in the same period, Y≥0.20; Y≥0.50; Y≥1.00; preferably Y≥2.00; preferably Y≥3.00; preferably Y≥4.

00.

10. The plant cultivation method according to claim 1, characterized in that The trait optimization includes increased yield.

11. The plant cultivation method according to claim 1, characterized in that: The trait optimization includes increased yield of plant organs.

12. The plant cultivation method according to claim 1, characterized in that: The trait optimization includes at least one of an increase in volume, an increase in number, an increase in weight, and an increase in the number of tillers of plant organs.

13. The plant cultivation method according to claim 1, characterized in that: The inducing medium can induce the demethylation of 6-methylated adenine in plant RNA.

14. The plant cultivation method according to claim 1, characterized in that: Compared to the initial plants, an excess of induction medium was introduced.

15. The plant cultivation method according to claim 1, characterized in that: The induction medium is a nucleic acid molecule and / or a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof.

16. The plant cultivation method according to claim 1, characterized in that: When the induction medium is a nucleic acid molecule, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction medium, and does not contain the polypeptide expressed by the induction medium; When the induction medium is a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction medium.

17. The plant cultivation method according to claim 1, characterized in that: The induction mediator is selected from RNA m6A demethylase and its encoding nucleic acid.

18. The plant cultivation method according to claim 1, characterized in that: The inducing medium is selected from at least one of FTO nucleic acid molecules and / or polypeptides, homologues thereof, functional variants thereof or combinations thereof.

19. The plant cultivation method according to claim 1, characterized in that: The FTO in the induction medium is derived from vertebrates, invertebrates, algae, or their direct homologs or paralogs.

20. The plant cultivation method according to claim 1, characterized in that The induction medium is shown in the sequence table Seq.ID.No1 to Seq.ID.No15.

21. The plant cultivation method according to claim 1, characterized in that: The initial plant is selected from at least one of food crops, fodder crops, fiber crops, oil crops, sugar crops, beverage crops, spice crops, seasoning crops, medicinal crops, dye crops, ornamental crops, fruit crops, and vegetable crops; preferably selected from at least one of rapeseed, tomato, lettuce, and sugar beet; or preferably selected from at least one of rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, and cassava; or preferably selected from at least one of tobacco, alfalfa, rubber grass, cotton, flax, sunflower, flax mustard, sedge, hemp, and poplar.

22. The plant cultivation method according to claim 1, characterized in that: The introduced initial plant region includes at least one of a plant organ, a plant tissue, and a plant cell.

23. The plant cultivation method according to claim 1, characterized in that: The initial plant region introduced is selected from the plant meristem.

24. The plant cultivation method according to claim 1, characterized in that The induction medium is introduced into at least one of the cell nucleus and cell sap of the initial plant.

25. The plant cultivation method according to claim 1, characterized in that: The introduction method includes introducing a vector encapsulating the induction medium into the initial plant.

26. The plant cultivation method according to claim 1, characterized in that: The offspring cultivation method includes at least one of natural genetic screening removal, hybrid genetic screening removal, and active removal.

27. Use of the plant breeding method according to claim 1 in preparing plants without induction medium and with optimized traits.

28. A product obtained by inactivating the target plant obtained by the plant breeding method according to claim 1.

Images