Application of NLD gene in regulating leaf angle of maize

Abstract

The application discloses application of an NLD gene in regulating leaf angle of corn. A corn mutant el20 with small leaf angle is obtained through mutant screening, and a gene NLD causing the mutant phenotype is located through a map-based cloning technique. Overexpression of the NLD gene can restore the leaf straightening phenotype of the el20. Rapid creation of compact corn is realized by editing the NLD gene through a gene editing technique. The application provides a new method and molecular module for breeding compact corn suitable for close planting.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of agricultural biotechnology, and relates to application of an NLD gene in regulating leaf angle of maize. BACKGROUND

[0002] Maize is not only an important feed source for livestock and poultry, but also an important raw material for edible oil and starch. In addition, maize can also be used to ferment ethanol as a clean energy to reduce air pollution. Improving yield per unit area has always been an important topic in maize breeding. One important reason limiting maize yield is planting density, and leaf angle is a major factor limiting the density tolerance of maize. Excessive leaf angle will cause different plants to be in close contact, which is not conducive to ventilation and will aggravate the occurrence and spread of diseases and pests. In addition, excessive leaf angle will also cause the upper layer of maize leaves to block the light of the lower layer of leaves, which is not conducive to the photosynthesis of the whole maize plant, thereby affecting the yield. Therefore, one important task of maize density tolerance breeding is to identify new genetic materials with upright leaves, clone key genes controlling maize leaf angle, analyze the molecular mechanism of maize leaf angle formation, and apply it to molecular design breeding.

[0003] CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) is a genome editing technology that has developed rapidly in recent years. According to the base complementary principle, the guide RNA guides the Cas9 nuclease to cut the target gene. Next, the DNA repair system in the cell repairs the double-strand break through homologous recombination or non-homologous end joining, and in the process, causes base mismatches, insertions, and deletions, thereby achieving site-directed editing of the target gene. This technology has been widely used in many fields such as agriculture, biotechnology, and biomedicine, and has played a very important role in the functional analysis of important genes in agriculture and molecular design breeding. SUMMARY

[0004] The purpose of the present application is to solve the problem of low planting density and low yield caused by excessive leaf angle of maize. The application provides application of an NLD gene in regulating leaf angle of maize, and the nucleotide sequence of the NLD gene is shown as SEQ ID NO. 1.

[0005] Another purpose of the present application is to provide a method for quickly creating leaf upright type maize genetic materials by using gene editing technology to improve planting density.

[0006] The purpose of the present application can be achieved by the following technical solutions:

[0007] The application of NLD gene in regulating the leaf angle of corn, wherein the nucleotide sequence of the NLD gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

[0008] An erect leaf 20 (el20) mutant with stable heredity is identified by screening and phenotype analysis of M2 generation strains of an EMS chemical mutagenesis mutant library of corn.

[0009] An F2 generation gene mapping population of el20 and corn inbred line 178 is prepared, a candidate gene is located between 15.66M-15.73M of the fifth chromosome by a map-based cloning technology, and only two expressed coding genes Zm00001d0136120 and Zm00001d0136122 (Narrow Leaf and Dwarfism, NLD) exist in the interval. Overexpression of the NLD gene in the el20 background can restore the leaf erect phenotype of el20, and it is determined that the deletion of NLD can cause the leaf angle of corn to become smaller.

[0010] As a preferred embodiment of the application, the deletion or mutation of the NLD gene can reduce the leaf angle of corn. According to the application of claim 1, the mutation types of the NLD gene include one or more of base substitution, frameshift mutation, deletion mutation or insertion mutation.

[0011] As a preferred embodiment of the application, the mutation of the NLD gene is realized by CRISPR / Cas9 gene editing technology.

[0012] The application of the CRISPR / Cas9 gene editing system of NLD gene in creating corn materials with reduced leaf angle of corn.

[0013] As a preferred embodiment of the application, the sgRNA sequence for the NLD gene in the CRISPR / Cas9 gene editing system of the NLD gene is shown as SEQ ID NO. 3.

[0014] A method for quickly obtaining leaf erect corn materials based on CRISPR / Cas9 technology, the method comprising the following steps: designing a target sequence of an sgRNA recognition site for editing the NLD gene, constructing a CRISPR / Cas9-NLD gene editing vector, and transforming corn to obtain leaf erect corn.

[0015] As a preferred embodiment of the application, the sgRNA sequence is shown as SEQ ID NO. 3.

[0016] As a preferred embodiment of the present application, the primer sequence for constructing the CRISPR / Cas9-NLD gene editing vector pCBX053-NLD is as follows:

[0017] NLD-gRNAF: GGTCTCTATTGGAGGTGCTTCTTACATCATGGGTTTTAGAGCTAGAA (SEQ ID NO. 4),

[0018] NLD-gRNAR: GGTCTCTAAACCCATGACCAGGAGAATTCACCCAATTCGGTGCTTGCG (SEQ ID NO. 5).

[0019] Application of the NLD gene in breeding compact type corn.

[0020] The present application has the beneficial effects of:

[0021] The present application finds that the deletion or mutation of the NLD gene can effectively reduce the leaf angle of corn and produce compact plant type through genetic means. Editing the NLD gene through gene editing technology can quickly create corn genetic materials with compact plant type. The present application provides a new molecular module and technical means for the regulation and molecular design breeding of corn leaf angle. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 : Phenotype of corn mutant el20. A, whole plant phenotype of wild type (QW) and mutant el20. B-C, side view of leaf angle structure of wild type (QW) and mutant el20. D-E, cross-sectional view of leaf angle structure of wild type (QW) and mutant el20

[0023] Figure 2 : Map-based cloning of NLD gene. A, el20 leaf straightness trait is linked to molecular markers 5D-16 and 5D-22 on chromosome 5. B, fine mapping of NLD gene. C, expression amount of two candidate genes in the fine mapping interval in wild type and mutant.

[0024] Figure 3: NLD-GFP overexpression restores the erect leaf phenotype of el20. A, the plasmid map of pZ005-Ubi::NLD-GFP. B, PCR identification of NLD-GFP insert in wild type KN5585 and three NLD-GFP transgenic lines. C, the relative expression of NLD gene in wild type KN5585 and three NLD-GFP transgenic lines. D, PCR detection of NLD-GFP insert and endogenous NLD gene in wild type QW, mutant el20 and el20 NLD-GFP lines. E-G, the phenotype of wild type QW, mutant el20 and el20 NLD-GFP lines.

[0025] Figure 4 : Identification and phenotype observation of NLD-cri gene edited lines. A, sequence alignment of NLD gene in NLD-cri edited lines and wild type KN5585. B, sequencing map of NLD gene in NLD-cri edited lines and wild type KN5585. C, the erect phenotype of NLD-cri edited lines. DETAILED DESCRIPTION

[0026] Example 1

[0027] A corn EMS chemical mutagenesis mutant library was phenotypically screened at the Nanjing Agricultural University Teaching and Research Base in Baima Town, Lishui District, Nanjing City. The M1 generation of the mutagenized population was planted at a density of 65 cm in rows and 30 cm in spacing, and seeds were collected from each single plant to produce M2 generation materials. Twenty seeds of each strain in the M2 generation materials were randomly sown, and the leaf angles of the growing single plants were observed. Strains that produced at least two single plants with erect leaves were selected as candidate strains that were likely to be heritable. Single plants with erect leaves were self-pollinated to produce M3 generation. Twenty seeds of the M3 generation were randomly sown, and strains that exhibited the erect leaf phenotype were selected as mutants for further study.

[0028] Through the above screening, we obtained a mutant with extremely erect leaves, which was named erect leaf 20 (el20). Compared with the wild type inbred line (QW), the leaves of el20 were erect, with little curvature between the leaf sheath and the leaf, exhibiting an erect leaf phenotype (A). Figure 1 A) The leaves and leaf sheaths were cut in half, and it was found that the el20 mutant almost lacked the structures of the leaf ear and ligule, resulting in the inability of the mutant to form a curvature between the leaf and the leaf sheath, and thus producing an erect leaf phenotype (B-C, D-E). Figure 1

[0029] Example 2

[0030] ​We crossed the el20 mutant with maize inbred line 178, which has normal leaf angles. All F1 plants exhibited normal leaf angles, indicating that the upright leaf phenotype caused by the mutant gene is a recessive trait. After planting the F2 generation, among more than 2300 F2 individuals, 486 mutant individuals with upright leaves and a phenotype identical to el20 were identified. Leaves from these mutant individuals were collected, and DNA was extracted. Utilizing the base differences in the genomes of the QW and 178 inbred lines, a set of insertion and deletion markers (InDels) evenly distributed across the 10 maize chromosomes were selected. Using the DNA from these individuals as templates, recombination of these markers in the 486 mutant individuals was identified. The results showed that the molecular markers 5D-16 and 5D-22 from chromosome 5 were largely identical to the el20 mutant in these individuals, indicating that these two markers were linked to the mutant gene. Therefore, we initially located the candidate gene between the molecular markers 5D-16 and 5D-22 on chromosome 5. Figure 2 A). Next, we developed more molecular markers on chromosome 5 (Table 1) and used linkage analysis to finely map candidate genes to a 75kb interval between 5H-12 (physical location 15.66M) and 5H-7 (physical location 15.73M). Figure 2 C). Further primer design within this region failed to yield amplification products in mutant plants, indicating a base deletion in this region. Alignment of the sequence within this region with the maize reference genome revealed only two expressed coding genes: Zm00001d013620 and Zm00001d013624. Zm00001d013622 encodes the Narrow Leaf and Dwarfism (NLD) protein. Figure 2 C). Both genes were expressed at high levels in wild-type QW and B73 leaves, but were almost undetectable in the el20 mutant, further confirming that these two genes were deleted in this mutant. Figure 2 (C) To identify the key gene determining leaf angle, we first edited the Zm00001d013624 gene, obtaining an edited progeny that produced frameshift and premature termination, but without any developmental defect phenotypes, indicating that this gene is not the cause of upright leaves in el20. Therefore, we hypothesize that NLD deletion is the direct factor leading to upright leaves.

[0031] Table 1 Primers for fine mapping of the NLD gene

[0032] Primer name Sequence 5-1-D-1F AGGCTTGCTTGGGCCT 5-1-D-1R CTCAACATCTGCACTCTCGATCA 5H-7F GTGAACAGCAGTTGCGTT 5H-7R TACTTTGGCGGCTCGTTCA 5D-22F CAGATTGGTGTCTCTTACTTTCC 5D-22R TGACTGCGATGGAACTCTTCT 5H-12F ACGCCAACTGCCATATCTG 5H-12R AACCAATGCAGCGATATCGAGG 5G-2F AGCTTGTAAGAAAGAAAGGCAG 5G-2R GAGCCGAAGCCGAGCG 5D-16F ACTGTGTCTGAGAGGC 5D-16R GACACGTCTAGTGACTATATTG

[0033] Example 3: Verification of transgenic maize with reduced leaf angle due to NLD gene deletion

[0034] Based on the coding sequence (SEQ ID NO 1) of the NLD gene provided in the maize genome database (www.maizegdb.org), we commissioned Shanghai Sangon Biotech Co., Ltd. to synthesize the full-length coding sequence of this gene de novo. Next, using this synthesized sequence as a template, we synthesized amplification primers NLD F1 and NLD R1 for PCR amplification. The primer sequences are as follows:

[0035] NLD F1: AACAGGTCTCAGGCTATGGATCCGGAGCAGACGT

[0036] NLD R1: AACAGGTCTCACTGATGTCACCTGATCATTCCAT

[0037] PCR products were purified using a gel extraction kit and digested with BsaI. The pGreenGate cloning vector pGGC000 (Lampropoulos, A., Sutikovic, Z., Wenzl, C., Maegele, I., Lohmann, JU, and Forner, J. (2013). GreenGate - a novel, versatile, and efficient cloning system for plant transgenesis. PLoS One 8, e83043) was digested with BasaI and recovered. The digested PCR products were ligated to the vector using T4 DNA ligase at 16°C overnight, and then transformed into E. coli DH5α competent cells. The correct pGGC-NLD clones were selected by colony PCR and plasmid sequencing. Following the cloning strategy of the pGreenGate system, equal volumes of 1 μL of intermediate vector plasmids pGGC-NLD, pGGA-Ubi, pGGB003, pGGD001, pGGE001, and pGGF002, and 1.5 μL of final vector plasmid Z005 were mixed. Then, 1.5 μL of CutSmart buffer, 1.5 μL of ATP (10 mM), 1 μL of T4 DNA ligase (30 u / mL), and 1 μL of BsaI-HF were added, and the mixture was placed in a PCR instrument for enzyme digestion and ligation reactions. The reaction conditions were: 37℃ for 5 minutes, 16℃ for 5 minutes, 50 cycles. Finally, the mixture was incubated at 50℃ for 5 minutes and 80℃ for 5 minutes. The ligation product was transformed into *E. coli* DH5α competent cells using the heat shock method, and the correct pZ005-Ubi::NLD-GFP clone was selected by colony PCR and plasmid sequencing. Figure 3 A).

[0038] pZ005-Ubi::NLD-GFP plasmid was transformed into Agrobacterium EHA105, infected the callus of maize inbred line KN5585, and through Basta screening and regeneration, NLD-GFP overexpression lines were generated. Three transgenic lines were genotyped according to the NLD and GFP sequences respectively.

[0039] Detection primers are:

[0040] NLD gtF: CTACCAGGAGCCAGCAAGAG

[0041] GRF gtR: GATGAACTTCAGGGTCAGCTTG

[0042] The results show that no target product can be amplified in the negative control KN5855, and strong and specific amplification products are detected in the three NLD-GFP overexpression lines, indicating that the pZ005-Ubi::NLD-GFP insert has indeed been integrated into the genomes of these lines Figure 3 B) We next designed specific fluorescent quantitative PCR primers according to the NLD transcript, extracted RNA from the leaves of wild type and NLD-GFP overexpression lines, and performed reverse transcription and fluorescent quantitative PCR.

[0043] Fluorescent quantitative PCR primer sequences are:

[0044] qNLD F: CAGATGCCCTATTGGTTCAGG

[0045] qNLD R: GGGTACTTCCAGCTCGCTGA

[0046] The results show that the expression level of NLD in the three transgenic lines has been significantly improved by 30-50 times compared with the wild type KN5585 Figure 3 C).

[0047] To confirm that NLD is the real cause of the el20 mutant phenotype, we crossed the NLD-GFP overexpression lines with the el20 mutant, identified NLD-GFP overexpression plants in the F2 population by primers NLD gtF and GFP gtR, and then used primers qNLD F and qNLD R to detect whether these single plants were nl20 background. The results identified the lines containing both endogenous NLD gene deletion (el20 mutant) and NLD-GFP overexpression Figure 3 D) Phenotypic analysis of these single plants showed that the leaf angle of NLD-GFP el20 plants was restored to the same extent as the wild typeFigure 3 E-G), fully demonstrating that NLD is indeed the cause of the el20 leaf blade erectness.

[0048] Example 4

[0049] The ccdB between ZmU6 promoter and sgRNA scaffold in pCBX053-Cas9 vector was excised by restriction enzyme Bsal, and replaced by the sequence containing gRNA (Liu, H. J., Jian, L., Xu, J., Zhang, Q., Zhang, M., Jin, M., Peng, Y., Yan, J., Han, B., Liu, J., Gao, F., Liu, X., Huang, L., Wei, W., Ding, Y., Yang, X., Li, Z., Zhang, M., Sun, J., Bai, M., Song, W., Chen, H., Sun, X., Li, W., Lu, Y., Liu, Y., Zhao, J., Qian, Y., Jackson, D., Fernie, A. R., and Yan, J. (2020). High-Throughput CRISPR / Cas9 Mutagenesis Streamlines Trait Gene Identification in Maize. Plant Cell 32, 1397-1413). The guide RNA design was performed by online tool CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Two complementary sequences were synthesized, annealed and ligated with the linearized pCBX053-Cas9 vector after Bsal digestion. The E. coli DH5a competent cells were transformed by heat shock method, and the correct pCBX053-NLD clone was selected by colony PCR and plasmid sequencing.

[0050] The synthetic sequence of pCBX053-NLD plasmid was constructed as follows:

[0051] NLD-gRNAF: GGTCTCTATTGGAGGTGCTTCTTACATCATGGGTTTTAGAGCTAGAA (SEQ ID NO. 4)

[0052] NLD-gRNAR: GGTCTCTAAACCCATGACCAGGAGAATTCACCCAATTCGGTGCTTGCG (SEQ ID NO. 5)

[0053] The gRNA sequence matched to NLD gene is: CAGAGGTGCTTCTTACATCA (SEQ ID NO. 3)

[0054] The plasmid with correct sequence was transformed into Agrobacterium and used to infect calli of maize inbred line KN5585. Transgenic lines with pCBX053-NLD were generated through Basta selection and regeneration. DNA was extracted from these single plants and primers were designed according to the position of NLD gene sequence matched to gRNA. The amplified products were sequenced and aligned to wild type sequence. One gene edited line with 7 bp deletion in the third exon of NLD gene was identified. We named this mutant line NLD-cri. Figure 4 A-B). Wild type NLD gene encodes 644 amino acids, but in NLD-cri mutant, 7 base deletion leads to frame shift and a premature stop codon. Edited NLD gene only encodes 102 amino acids, so NLD-cri is a loss-of-function mutant. NLD-cri plants have straight up leaves, showing similar mutant phenotype to el20 Figure 4 C). The primer sequence to identify NLD gene edited lines is:

[0055] NLD-cri F: CTCGTCCTCGAGTACCTCTAC NLD-cri R: TTGTCTCCTTTCCAAGTTCT.

Claims

1. Missing NLD The application of genes in reducing the angle between maize leaves, as described NLD The gene nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the NLD protein is shown in SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, Deletion NLD Genes were edited using CRISPR / Cas9 gene editing technology.

3. NLD The application of CRISPR / Cas9 gene knockout system of the gene in creating maize material with reduced leaf angle in maize, wherein the NLD The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

4. Use according to claim 3, characterized in that The described NLD sgRNA sequences for the CRISPR / Cas9 gene knockout system for NLD The sgRNA sequence for the gene is shown as SEQ ID NO.

3.

5. The method for quickly obtaining leaf erect type maize material based on CRISPR / Cas9 technology, characterized in that, The method described is designed for editing. NLD The target sequence of the sgRNA recognition site of the gene was used to construct a CRISPR / Cas9-NLD gene knockout vector. This vector was then transformed into maize to obtain maize with upright leaves. NLD The gene nucleotide sequence is shown in SEQ ID NO.

1.

6. The method of claim 5, wherein, The sgRNA sequence is shown as SEQ ID NO.

3.

7. The method of claim 5, wherein, The primer sequence for constructing the CRISPR / Cas9-NLD gene knockout vector pCBX053-NLD is as follows: NLD-gRNA F: SEQ ID NO. 4, NLD-gRNA R: SEQ ID NO.

5.

8. Knockout NLD The application of the gene in breeding compact corn plant type, the NLD The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

Images