Application of Cla97C06G112090 gene in creation of thin-seed-shell watermelon germplasm

Abstract

The invention relates to application of a Cla97C06G112090 gene in creation of thin-seed-shell watermelon germplasm, and belongs to the technical field of gene function verification and watermelon gene editing. An editing carrier of the Cla97C06G112090 gene is constructed and transformed into a watermelon plant, the function of the Cla97C06G112090 gene is researched, and it is found that the thickness of a watermelon seed shell can be remarkably reduced by knocking out the gene. The Cla97C06G112090 gene has the advantages that the influence of the Cla97C06G112090 gene on the development of watermelon seeds is clear for the first time, and after the gene expression is knocked out, the thickness of watermelon seed shells is obviously reduced. Over-thick watermelon seed shells can affect the taste of the watermelons during eating, conversion of related nutrient substances is wasted during seed development, and the watermelons with thin seed shells can better meet the requirements of consumers.

Description

Technical Field

[0001] The invention relates to application of Cla97C06G112090 gene in creating thin-shell watermelon germplasm, and belongs to the technical field of gene function verification and watermelon gene editing. Background Art

[0002] Genome editing is a technology that can accurately modify specific target genes in the genome of an organism. It mainly uses sequence-specific nucleases to cut DNA at specific sites in the genome, thereby forming a double strand break (DSB). After the DNA double strand break, it will activate the organism's own repair mechanism, thereby achieving specific modification of the genome. Common nucleases mainly include: meganuclease (MegN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN) and clustered regularly interspaced short palindromic repeats system CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein). Among them, the clustered regularly interspaced short palindromic repeat system CRISPR / Cas system is part of the adaptive immune system of bacteria and archaea. It can specifically recognize and degrade exogenous DNA (bacteriophages and plasmids, etc.) that enters the bacteria. It is mainly composed of CRISPR sequences and Cas gene families. The CRISPR sequence is a special DNA repeat sequence, which is a repeat sequence in the genome of prokaryotes. It is composed of a series of spacer sequences and highly conserved direct repeat sequences arranged alternately. Cas is a nuclease. The protein encoded by the Cas gene can recognize and specifically cut exogenous DNA.

[0003] At present, CRISPR / Cas is the most widely used technology in gene editing of melon crops. This technology is simpler and more efficient in the application of multi-gene editing. It only requires the design of sgRNA (single guide RNA) to perform multi-gene editing at the same time, and has the advantages of precise targeting, low off-target rate and low cytotoxicity.

[0004] In 2017, Xu Yong's team successfully applied CRISPR / Cas9 technology to watermelon species and knocked out the watermelon albino gene. In 2018, Tian et al. used CRISPR / Cas9 technology to edit the watermelon acetolactate synthase (ALS) gene, and finally obtained 199 transgenic plants. They successfully established an efficient single-base editing system for watermelon and created new germplasm resistant to the herbicide bensulfuron-methyl. In 2020, Zhang et al. used the CRISPR / Cas9 system to knock out the gene Clpsk1 encoding the plant sulfonyl peptide precursor and found that the loss of Clpsk1 function could enhance watermelon's resistance to wilt pathogens. In the same year, Zhang Yueqiao et al. used CRISPR / Cas9 technology to edit watermelon ClWIP1 and successfully created the first artificial female watermelon plant, providing a theoretical and technical basis for the breeding of excellent female watermelon lines. In 2021, Zhang et al. used CRISPR / Cas9 gene editing technology to verify the function of ClATM1 in regulating anther development and its self-regulatory role in tapetum development, and discovered and cloned the first male sterility gene in watermelon. With the completion of the whole genome sequencing of watermelon, research on its gene function and trait improvement has developed rapidly, and watermelon has become the second species in the Cucurbitaceae family to have its genome successfully edited.

[0005] The lignification of the seed coat of watermelon seeds is important for protecting the internal embryo, but this hard seed coat tissue is not conducive to seed germination and further processing and utilization. The seed coat development process is long, time-consuming and labor-intensive, and the seed coat is often regarded as a useless byproduct, causing waste disposal problems. Therefore, in modern breeding programs, less shell has become an important breeding trait for seed crops such as barley, corn, beans and wheat, and this shell-free trait is usually controlled by a single or multiple genes. At present, there are very few reports on the regulatory genes of watermelon seed coat. Therefore, the development of new genes that can effectively regulate watermelon seed coat is of great significance for constructing thin-shell watermelon using genetic engineering methods. Summary of the invention

[0006] The purpose of the present invention is to provide the application of Cla97C06G112090 gene in creating thin-shell watermelon germplasm, and to provide a gene site that can effectively control the thickness of watermelon seed shell for the existing technology.

[0007] In order to achieve the above object, the technical solution adopted by the application of Cla97C06G112090 gene in creating thin-shell watermelon germplasm in the present invention is:

[0008] The application of Cla97C06G112090 gene in creating thin-shell watermelon germplasm, the nucleotide sequence of the Cla97C06G112090 gene is shown in SEQ ID NO.1.

[0009] The beneficial effect of the above technical solution is that the application of the Cla97C06G112090 gene of the present invention in creating thin seed shell watermelon germplasm is a pioneering invention. In the previous study, the present invention located a QTL interval that can regulate the thickness of the watermelon seed shell, and found that the interval contains the Cla97C06G112090 gene, and there is little research on the function of this gene in the prior art. The present invention constructs an editing vector of the Cla97C06G112090 gene and transforms it into a watermelon plant to study the function of the Cla97C06G112090 gene. After knocking out the gene, the thickness of the watermelon seed shell can be significantly reduced. The present invention verifies for the first time that the Cla97C06G112090 gene is involved in the development process of watermelon seeds. After knocking out the gene, the thickness of the watermelon seed shell is significantly thinned.

[0010] As a further improvement, gene editing technology was used to inhibit the expression of the Cla97C06G112090 gene in watermelon, and the seed coat of watermelon seeds became thinner.

[0011] As a further improvement, the method of inhibiting the expression of the Cla97C06G112090 gene in watermelon is to construct a gene editing vector to knock out the Cla97C06G112090 gene.

[0012] As a further improvement, the gene editing vector is constructed by designing a gene editing target based on the Cla97C06G112090 gene, connecting it to the pMD402-T vector after PCR amplification, and sequencing identification.

[0013] As a further improvement, the sequence of the gene editing target is as follows:

[0014] BAR1:CCAACCGAGCTACCGCGGCT (as shown in SEQ ID NO.4);

[0015] BAR2: CTGGTCGTGACAAAGTCATT (as shown in SEQ ID NO. 5).

[0016] As a further improvement, the variety of the watermelon is "Yulin".

[0017] Specifically, "Yulin" is referred to as "YL" below. Currently, there are relatively few watermelon varieties that can be transformed, and "Yulin" is a relatively representative watermelon variety that can be transformed. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a schematic diagram of the amplification results of the Cla97C06G112090 gene in Example 1 of the present invention;

[0019] Figure 2 Schematic diagram of target amplification and vector restriction enzyme digestion of the editing vector pMD402-T-LR-8X2 in Example 2 of the present invention;

[0020] Figure 3 This is a schematic diagram of the positive clone verification of the editing vector pMD402-T-LR-8X2 in Example 2 of the present invention;

[0021] Figure 4 This is a schematic diagram of genetic transformation of watermelon in Example 3 of the present invention;

[0022] Figure 5 This is a schematic diagram of the sequence amplification results of the watermelon "24A" containing the target site in Example 3 of the present invention;

[0023] Figure 6 This is a schematic diagram of the editing of the target site "24A" of watermelon detected in Example 3 of the present invention;

[0024] Figure 7 The thickness of the seed coat of "24A" and "YL" in Example 4 of the present invention is measured (the left side is "24A" and the right side is "YL");

[0025] Figure 8 This is the measurement of the seed shell thickness of "24B" and "JY" in Example 4 of the present invention (the left side is "24B" and the right side is "JY"). DETAILED DESCRIPTION

[0026] The thick seed shell of watermelon will affect the taste of watermelon during consumption, and waste the transformation of watermelon nutrients and the development of seeds. For this reason, the present invention locates the thick seed shell trait of watermelon based on the previous genetic population. The QTL interval contains a Cla97C06G112090 gene, and the functional annotation of the gene is shown as NAC domain-containing protein. Based on this, the present invention edits this gene, and produces watermelon with thin seed shell germplasm by editing the gene Cla97C06G112090 for watermelon seed shell development. The present invention provides a new gene resource for the regulation of the thickness of watermelon seed shell and enriches the gene network for regulating the watermelon seed shell trait. Moreover, watermelons with thin seed shells are conducive to meeting the needs of different consumers in the market and improving the income of growers.

[0027] The present invention is further described below in conjunction with specific implementation methods, but the protection scope of the present invention is not limited thereto; unless otherwise specified, various reagents, instruments, etc. used in the examples are commercially available products.

[0028] Specific examples of the application of the Cla97C06G112090 gene of the present invention in creating thin-shell watermelon germplasm:

[0029] The present invention first amplifies the Cla97C06G112090 gene, constructs a gene editing vector after sequencing is correct, and after transformation into a watermelon plant, verifies the phenotype of the gene editing strain. The specific implementation operations are as follows:

[0030] Example 1 Cloning and sequencing of Cla97C06G112090 gene

[0031] In this example, the total DNA of watermelon was extracted (Tiangen Biochemical Technology (Beijing) Co., Ltd.: Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit), and PCR was performed using it as a template to obtain the Cla97C06G112090 gene. The specific implementation operation is as follows:

[0032] 1. Extraction of total DNA from watermelon

[0033] (1) Take the young and tender leaves of "YL" watermelon, freeze them quickly with liquid nitrogen, and store them at -80°C for later use;

[0034] (2) Grind about 0.1 g of freshly collected sample into powder in a cryo-grinder, immediately add lysis buffer and RNase A, vortex and shake, mix thoroughly to help lysis, centrifuge instantly, and place in a 65°C water bath for 10 min. In the water bath, invert and centrifuge 2-3 times to mix the sample;

[0035] (3) Then add 130 μL of Buffer A2 to the mixture, mix thoroughly, and place on ice for 5 min to better remove impurities such as proteins and cell debris. Centrifuge at 14,000 rpm for 10 min and carefully pipette the supernatant into a new centrifuge tube.

[0036] (4) Calculate the amount of supernatant and add 1.5 times the volume of Buffer A3 to provide a column loading environment. Mix by pipetting immediately.

[0037] (5) Transfer the mixture obtained in the previous step (including the precipitate) to Fast Pure gDNA Columns IV (the adsorption column has been placed in the collection tube), centrifuge at 12000 rpm for 30-60 seconds, and discard the filtrate;

[0038] (6) Add 600 μL Buffer AW, centrifuge at 12000 rpm for 30 sec, and discard the filtrate;

[0039] (7) Repeat step (6);

[0040] (8) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove as much rinse solution as possible to prevent residual ethanol in the rinse solution from inhibiting downstream reactions;

[0041] (9) Place the adsorption column in a new 1.5 mL centrifuge tube (self-prepared) and let it stand for 2 minutes to allow the residual ethanol to evaporate. Add 50 μL of double distilled water preheated to about 65°C to the center of the membrane of the adsorption column, leave it at room temperature for 5 minutes, and centrifuge it at 12,000 rpm for 1 minute (if the highest yield is required, add the first eluate back to the adsorption column and repeat the elution step);

[0042] (10) Discard the adsorption column and obtain the DNA after centrifugation. Take 1 μL of the DNA solution and measure the DNA concentration and quality using an ultra-micro UV spectrophotometer. The remaining DNA solution is stored at -20°C.

[0043] Note: When OD 260 / OD 280 The value is between 1.8-2.0, OD 260 / OD 230 If it is greater than 2.0, it means that the DNA is of good quality and can be used as a PCR template.

[0044] 2. Cloning of watermelon Cla97C06G112090 gene

[0045] According to the watermelon genome (Watermelon 97103genome v2.5) data in the Cucurbitaceae database (http: / / cucurbitgenomics.org / v2 / ), the Cla97C06G112090 gene sequence was found, and amplification primers were designed and synthesized based on the reference sequence:

[0046] F: 5'-ATGCCAAAAATGAGCATCTCTGT-3' (as shown in SEQ ID NO. 2);

[0047] R: 5'-TTATATTGGAGTGTCGGACACG-3' (as shown in SEQ ID NO. 3).

[0048] Primer synthesis was completed by Beijing Liuhe BGI Technology Co., Ltd., and the total watermelon DNA extracted in step 1 was used as a template to amplify the Cla97C06G112090 gene by PCR. The PCR amplification system is shown in Table 1.

[0049] Table 1 PCR amplification system

[0050]

[0051] The PCR amplification procedure is as follows:

[0052] Step 1: 95℃3min; Step 2: 94℃30s, 55℃30s, 72℃30s, 35 cycles; Step 3: 72℃5min, PCR products were separated by 1.0% agarose gel electrophoresis, and the position of the target band was consistent with the expected position, between 1000-2000bp, such as Figure 1 The PCR product was sent to Beijing Liuhe BGI Gene Technology Co., Ltd. for sequencing to obtain the sequence of the gene in the "YL" material, and the nucleotide sequence is shown in SEQ ID NO.1.

[0053] Example 2 Construction of Cla97C06G112090 gene editing vector

[0054] This example constructs a Cla97C06G112090 gene editing vector, and the specific implementation operations are as follows:

[0055] According to the sequence of the Cla97C06G112090 gene obtained by sequencing in Example 1, the online software Breaking-Cas (Breaking-Cas: off-targets-free gRNAs for CRISPR / Cas technology) was used to design and search for suitable gene editing targets. The sequence is as follows:

[0056] BAR1:CCAACCGAGCTACCGCGGCT (as shown in SEQ ID NO.4);

[0057] BAR2: CTGGTCGTGACAAAGTCATT (as shown in SEQ ID NO. 5).

[0058] Homologous arms of the connection vector (underlined parts at both ends of the primers) were added to both ends of the above gene editing target sequence, and primers were synthesized by Beijing Liuhe BGI Technology Co., Ltd. The sequences are as follows:

[0059] LR-F:

[0060] 5'- TCGAAGTAGTGATTG CCAACCGAGCTACCGCGGCT GTTTTAGAGCTAGAAATA GC -3' (as shown in SEQ ID NO.6);

[0061] LR-R:

[0062] 5'- TTCTAGCTCTAAAAC CTGGTCGTGACAAAGTCATT CAATCTCTTAGTCGACTCT AC -3' (as shown in SEQ ID NO. 7).

[0063] The above primers were used to perform PCR amplification with the intermediate vector PCBC of the gene editing vector as a template, and the pMD402-T vector was digested with the restriction endonuclease Bsa I. The digestion system was: 1 μg of plasmid, 5 μL of 10× digestion buffer, 1 μL of Bsa I (10 U / μL), and ddH2O was added to supplement the reaction system to 50 μL, and digested at 37°C for 4 hours.

[0064] The above PCR products and pMD402-T digestion products were separated by 1.0% agarose gel electrophoresis ( Figure 2 After electrophoresis, the vector formed two fragments, and the fragment size was consistent with the expected fragment size after enzyme digestion, indicating that the vector had been accurately cut by the enzyme. Then, the DNA gel recovery kit of Beijing PolyMei Biotechnology Co., Ltd. was used to recover the PCR fragments and the pMD402-T linearized vector.

[0065] The recovered PCR target fragment and pMD402-T linearized vector were connected using the Norwegian recombinase (C112) according to the following system: 5 μL PCBC amplification and purification product, 2 μL pMD402-T enzyme-digested large fragment, 1 μL (10 U / μL) C112 ligase and 2 μL 5× ligase buffer. After ligation at 37°C for 35 minutes, the ligation product was transformed into Escherichia coli DH5α competent cells. After screening on a resistance plate containing kanamycin (100 μg / mL), a single clone was picked to detect the target band, which was 636 bp in length. Figure 3 The electrophoresis results were consistent with the target band position, and positive clones were obtained after sequencing.

[0066] The detection primers are as follows:

[0067] U626-IDF2: 5'-AAAGGCCCCTGGGAATCTGA-3' (as shown in SEQ ID NO. 8);

[0068] U629-R: 5'-AGCCCTCTTCTTTCGATCCATCAAC-3' (as shown in SEQ ID NO. 9).

[0069] The recombinant plasmid from the positive clone was extracted and named pMD402-T-LR-8X2.

[0070] Example 3: Detection of genetic transformation and gene-edited plants in watermelon

[0071] In order to further understand the role of nucleic acid genes in regulating the thickness of watermelon seed husk, the gene editing vector constructed in Example 2 was transformed into watermelon, and the transformed plants were tested. The specific implementation operations are as follows:

[0072] 1. Genetic transformation of watermelon

[0073] In this embodiment, the genetic transformation of watermelon was carried out by Agrobacterium-mediated infection to transfer the pMD402-T-LR-8X2 recombinant vector into the newly germinated cotyledons of the seeds of watermelon "YL". The specific operation process is as follows: Figure 4 shown.

[0074] (1) The recombinant plasmid pMD402-T-LR-8X2 was transformed into Agrobacterium EHA105 by heat shock transformation method. After positive verification, 50% glycerol was added and stored in a -80°C refrigerator for later use.

[0075] (2) Soak the "YL" seeds at 50-55°C for 25-30 min, take them out and wipe the surface of the seeds dry and remove the shells. Sterilize the watermelon seeds in a clean bench: wash with 75% alcohol for 20 seconds, rinse with sterile water 2-3 times, wash with 5% sodium hypochlorite for 10 minutes, and wash with sterile water 4-5 times; place the sterilized seeds in the sowing medium.

[0076] (3) After the "YL" seeds germinate, use a sterile blade on a clean bench to cut off the distal end of the cotyledon embryonic axis, the embryonic axis, and part of the tissue at the proximal end of the cotyledon embryonic axis, and cut the remaining upper and lower cotyledons into 2-4 explants.

[0077] (4) Place the bacterial solution to be infected in a shaker at 28°C overnight and adjust the concentration of the bacterial solution to OD 600 After the bacterial solution reached 0.8, the bacterial cells were collected by centrifugation and resuspended in MS liquid medium to an OD of 600 It is about 0.4.

[0078] (5) The above bacterial solution and the explants were transformed by vacuum negative pressure infection using a 20 mL syringe for about 10 minutes with continuous shaking. After the negative pressure was over, the explants were dried with filter paper and placed in co-culture medium and cultured in a constant temperature and humidity incubator at 28°C for 3-4 days in the dark.

[0079] (6) After the co-cultivation, the explants were transferred to a recovery medium to induce adventitious buds. The fluorescent buds were then regularly observed and transferred to an elongation medium for further cultivation until they differentiated into seedlings and took root in a rooting medium.

[0080] Note: In step (6), select tissue culture seedlings with relatively intact roots, stems and leaves, add an appropriate amount of tap water to the solid culture medium, open the bottle cap, and transplant them into the substrate after 3-4 days of hardening. Cultivate them in a light incubator. During this period, cover the fluorescent seedlings with a bag to maintain humidity. After about 4-5 days, they can be cultured normally.

[0081] 2. Identification of positive gene-edited plants

[0082] The DNA of the positive gene-edited plant and the unedited plant "YL" was extracted, and PCR was performed using the detection primers containing the target gene target site with the above DNA as a template. The target fragment size was about 669 bp, such as Figure 5 As shown, the target band after electrophoresis was consistent with expectations. The PCR product was sent to Beijing Liuhe BGI Gene Technology Co., Ltd. for sequencing, and the detection primers were as follows:

[0083] LRJC-F: 5'-TCAATGGCCAATCCCAAGTC-3' (as shown in SEQ ID NO. 10);

[0084] LRJC-R: 5'-TCTTGTCCACCCTCTCCAAT-3' (as shown in SEQ ID NO. 11).

[0085] The three successfully edited watermelon plants were named "24A". After comparing the sequencing results with the unedited sequences, the target editing conditions of the three positive plants were obtained, such as Figure 6 As shown: a single base insertion occurred in target site 1 of "24A1"; a single base deletion and a single base mutation occurred in target site 1 of "24A2", and a two-base mutation occurred in target site 2; a single base mutation occurred in target site 1 of "24A3".

[0086] Example 4 Planting and phenotypic verification of Cla97C06G112090 gene-edited watermelon material "24A"

[0087] In this example, the gene-edited transformant cultivated in Example 3 was cultured and the seed coat thickness was measured. The specific implementation operation was as follows:

[0088] After 2-3 weeks of cultivation, the growth of the plants was observed, and the healthy fluorescent seedlings were transplanted to the experimental field of Luoyang Nongfa Agricultural Science and Technology Co., Ltd. Under normal cultivation and management conditions, the gene-edited plants were in good condition, and self-pollination was carried out during the flowering period; when they were ripe, the melons were picked and cut open, the development of the seed shell was observed and photographed, the seeds were harvested, and the seed kernel, seed shell, and the quality of the whole seed and the thickness of the seed shell were measured.

[0089] By measuring the seed shell thickness, it was found that the seed shell thickness of the editing material "24A" was about 0.07mm, while the seed shell thickness of "YL" reached 0.33mm (such as Figure 7 The thickness of the seed coat of "24A" was reduced by about 78.79% compared with "YL". By measuring the seed coat and the mass of the whole seed, it was found that the seed coat mass of the edited material "24A" was only 5.4% of the seed coat mass of the normal material "YL", the seed coat of "24A" accounted for 10.87% of the total seed mass, and the seed coat of "YL" accounted for 48% of the total seed mass, which was reduced by about 37.13% compared with "YL". The specific results are shown in Table 2.

[0090] Table 2 “24A” and “YL” seed quality determination table

[0091]

[0092] Note: The data in the table are the average of 10 seeds.

[0093] Similarly, the present invention also obtained thin-shell germplasm by transforming the watermelon hybrid material "JY", and named it "24B". Through measurement, it was found that the seed shell thickness of the edited material "24B" was about 0.11 mm, while the seed shell thickness of the hybrid material "JY" was about 0.32 mm (such as Figure 8 The seed coat thickness of "24B" was reduced by about 65.63% compared with "JY". The seed coat mass of the editing material "24B" was 44.7% of the seed coat mass of the hybrid material "JY". The seed coat mass of "24B" accounted for 23.56% of the total seed mass, while the seed coat mass of "JY" accounted for 49.07% of the total seed mass, which was reduced by about 25.5% compared with "JY". The specific results are shown in Table 3.

[0094] Table 3 “24B” and “JY” seed quality determination table

[0095]

[0096] Note: The data in the table are the average of 10 seeds. The watermelon hybrid material "JY" is a hybrid variety bred by Luoyang Nongfa Agricultural Science and Technology Co., Ltd.

[0097] It can be seen from this that the deletion of the Cla97C06G112090 gene affects the development process of the seed coat, thereby making the seed coat of watermelon seeds thinner.

[0098] Finally, it is noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Cla97C06G112090 The application of the gene in creating thin-shell watermelon germplasm is characterized by: Said Cla97C06G112090 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. according to claim 1 Cla97C06G112090 The application of the gene in creating thin-shell watermelon germplasm is characterized by: Using gene editing technology to inhibit the growth of Cla97C06G112090 The expression of the gene causes the seed coat of watermelon seeds to become thinner.

3. According to claim 2 Cla97C06G112090 The application of the gene in creating thin-shell watermelon germplasm is characterized by: The inhibition of watermelon Cla97C06G112090 Gene expression is the construction of gene editing vectors. Cla97C06G112090 Gene knockout.

4. according to claim 3 Cla97C06G112090 The application of the gene in creating thin-shell watermelon germplasm is characterized by: The gene editing vector is constructed according to Cla97C06G112090 Gene editing targets were designed, ligated to the pMD402-T vector after PCR amplification, and sequenced for identification.

5. According to claim 4 Cla97C06G112090 The application of the gene in creating thin-shell watermelon germplasm is characterized by: The sequence of the gene editing target is as follows: BAR1:CCAACCGAGCTACCGCGGCT (as shown in SEQ ID NO.4); BAR2:CTGGTCGTGACAAAGTCATT (as shown in SEQ ID NO.5).

6. The method according to any one of claims 1 to 5 Cla97C06G112090 The application of the gene in creating thin-shell watermelon germplasm is characterized by: The variety of the watermelon is "Yulin".

Images