Application of PsCLF gene in regulation and control of dormancy and growth in peony flower buds

Abstract

The invention discloses application of a PsCLF gene in regulation and control of dormancy and growth in peony flower buds, and belongs to the technical field of molecular biology, the nucleotide sequence of the PsCLF gene is as shown in SEQ ID NO: 1, and the application method comprises the following steps: overexpressing the PsCLF gene, promoting germination and growth of the peony flower buds, inhibiting the PsCLF gene, and delaying germination and growth of the flower buds. Researches show that the PsCLF gene is related to peony in-bud dormancy and is a candidate gene for breeding of special varieties for peony forcing cultivation.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology and specifically relates to a PsF Application of genes in regulating dormancy and growth in peony flower buds. Background Art

[0002] peony( Paeonia suffruticosa Andr.) is a traditional precious flower native to China. It has high ornamental, oil, medicinal and edible value and is the preferred national flower. After the peony blooms, buds gradually form in the axils of the leaves and differentiate into flower buds. The differentiation of flower buds is basically completed from late September to mid-October, and the outside is covered with well-developed scales. As the daylight shortens and the temperature drops, the flower buds gradually enter a dormant state, which is an internal dormancy phenomenon. Under natural conditions, low temperatures in winter can induce the buds to break dormancy, and they will sprout in the spring of the following year, forming branches and flowering at the top. Studies have found that the peony 'Luhehong' can completely break dormancy after 21 days of artificial low temperature of 0-4℃. The release of internal dormancy is a prerequisite for bud sprouting and flowering in the following year. In warm winter years or when introduced to the south, the flowering time and quality may be affected due to incomplete dormancy release, which affects the healthy development of the peony industry. At the same time, forced cultivation (especially flower forcing during the Spring Festival) is one of the main contents of the peony industry, with an annual output value of about 300 million yuan. Breaking bud dormancy in advance is the key to the success of off-season flower forcing. Exploring genes related to dormancy regulation can provide candidate genes for the breeding of peony varieties for forced cultivation, and also lay the foundation for a deeper understanding of the mechanism of dormancy release in buds and the optimization of artificial regulation technology of peony flowering.

[0003] Polycomb Group (PcG) proteins are a class of evolutionarily conserved epigenetic regulatory factors that usually modify chromatin in the form of protein complexes to regulate the transcription of genes in the corresponding region and regulate development. They include two major categories: PRC1 (Polycomb Repressive Complex 1) and PRC2.

[0004] CLF (CURLY LEAF) is one of the important components of the PRC2 protein complex. It is a methyltransferase with H3K27 specificity and is involved in regulating plant growth and development. clf Mutant analysis revealed CLF It plays an important role in plant growth and development, and its absence affects the morphology of flowers, fruits, leaves, etc. It is currently unclear whether CLF regulates the release of dormancy in buds. Summary of the invention

[0005] The present invention provides a PsF Application of genes in regulating internal dormancy of peony flower buds.

[0006] The present invention is achieved through the following technical solutions: PsF Application of genes in regulating internal dormancy and growth of peony flower buds, the PsF The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The application method is to overexpress PsF Genes that promote budding and growth of peony buds or inhibit PsF Gene expression delays peony flower bud initiation and growth.

[0007] The present invention determined the H3K27me3 level of the flower buds of peony 'Luhehong' during the accumulation of low temperature. With the accumulation of low temperature, the H3K27me3 level gradually increased and reached the maximum value at 21 days (internal dormancy release), suggesting that the PRC2 complex is involved in the regulation of internal dormancy. Quantitative PCR was further used to analyze the members of the PRC2 complex. PsF Gene expression patterns, genetic analysis showed PsF Overexpression of this gene promotes the release of dormancy in peony buds and is a candidate gene for breeding of peony varieties for forced cultivation. PsF The expression of genes delays the germination and growth of peony flower buds. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 This is a graph showing the changes in H3K27me3 levels during low temperature accumulation; Figure 2 is the phylogenetic tree diagram of PsCLF; Figure 3 The expression pattern of PsCLF during the period of low temperature accumulation; Figure 4 Schematic diagram of constructing gene function analysis vector, a: TRV vector; b: overexpression vector; Figure 5 PsCLF amplification and colony PCR identification, a: ORF amplification; b: overexpression vector colony PCR identification; c: PsCLF fragment amplification for TRV vector; d: TRV vector colony PCR identification; Figure 6 Figure 2 shows the functional identification of PsCLF. a: overexpression analysis; b: TRV silencing analysis; Figure 7 The relative growth analysis diagram is shown in Figure 1. a: the effect of overexpression on relative growth width; b: the effect of overexpression on relative growth height; c: the effect of TRV silencing on relative growth width; d: the effect of TRV silencing on relative growth height; Figure 8 The expression analysis of PsCLF, a: TRV silencing; b: overexpression; Fig. 9 The following are the analysis diagrams of marker gene expression patterns: a: TRV silencing; b: overexpression. DETAILED DESCRIPTION

[0009] The technical solution of the present invention is further explained below by way of embodiments, but the protection scope of the present invention is not limited in any form by the embodiments.

[0010] Example 1

[0011] 1 Materials and methods 1.1 Test materials: The terminal buds of tree peony 'Luhehong' treated with low temperature for 5-10 days were cut for gene expression and functional analysis.

[0012] Escherichia coli DH5a; Agrobacterium tumefaciens EHA105.

[0013] Plasmid: TRV1, TRV2, pSuper 1300-GFP vector or pBI121 vector.

[0014] Kan (Kanamycin): Weigh 1 g of powder and add ddH2O to dissolve and dilute to 20 mL. Filter and dispense at a concentration of 50 mg / mL.

[0015] Rif (Rifampicin): Weigh 500 mg of powder and dissolve in DMSO to make up to 25 mL. Filter and dispense at a concentration of 50 mg / mL.

[0016] LB medium: (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH=7.0, agar was added to the solid medium to a final concentration of 1.5%).

[0017] 1 / 2MS culture medium: (NH4NO3825 mg / L, KNO3950 mg / L, CaCl2·2H2O 220 mg / L, MgSO4·7H2O185 mg / L, KH2PO485 mg / L, KI 0.83 mg / L, H3BO36.2 mg / L, MnSO4·H2O 16.9 mg / L, ZnSO4·7H2O 8.6 mg / L, Na2MoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2·6H2O0.025 mg / L, FeSO4·7H2O 27.8 mg / L, Na2-EDTA 37.3 mg / L, inositol 100 mg / L, niacin 0.5 mg / L, thiamine hydrochloride 0.1 mg / L, pyridoxine hydrochloride 0.5 mg / L, glycine 2 mg / L, sucrose 30 g / L, agar 7 g / L, pH 5.8~6.0).

[0018] 1.2 Gene cloning The AtCLF sequence was obtained using the Arabidopsis TAIR website (https: / / www.arabidopsis.org / cgi-bin / Blast / TAIRblast.pl) and blasted against the peony genome. PsF Sequence. Based on the sequence information obtained, specific PCR primers were designed, CLF-F: 5'-ATGGCGTCAACGGTCTCGC-3' (SEQ ID NO.17), CLF-R: 5'-TTATGCTAGCTTCTTAGCACGACC-3' (SEQ ID NO.18), and amplified from the buds of 'Luhehong' PsF The full length of cDNA is 2679 bp, and the nucleotide sequence is shown in SEQ ID NO.1.

[0019] The amino acid sequence of PsCLF was obtained by DNAMAN translation, and the sequence is shown in SEQ ID NO: 2. Multiple sequence alignment of CLFs from different species was performed, and PsCLF had a conserved Set domain of CLFs. A phylogenetic tree was further constructed, and PsCLF had the highest similarity with ZjCLF (e.g. Figure 2 as shown in the figure), and named it PsCLF.

[0020] PsF The nucleotide sequence of gene cDNA (SEQ ID NO.1):

[0021] PsF Amino acid sequence of the gene-encoded protein (SEQ ID NO.2): MASTVSPSVSGSDLLKDLQMKVPQDTSPTSTEILSVIDSLKEQVAANRCVFIKKRMEENRKKLANVTSHLYKSSVERKNDKPFDSDNSVDLLTKRQKDAIDMQNGVGVSNGDKDSNSSQDDGHASSAVLLGSSIAVKNTVRPIKLIEVNKLPPYTAWIFLERNQRMTEDQSVVGRRRIYYDQNGGEALICSDSEEEVIDDEEDKREFAESEDYILRMTIDEVGSSNAVLESLAHCFSRKTSEVKARYEVLIKGEKAVEDASQTLNLDKDLDAALDSFDNLFCRRCLVFDCRLHGCSQDLVFPAEKQHARSLPDEVNAPCGLHCYRLALKSENAATTSFPDNDLEDNPASLSGGAGEQISSTKKSDPSVRREKSSHSESSSSNLSDSSDSETRPSQDAISTHLSSSTPKTKLVGRSENPKRNSKRFAERVLVSKRKKQKKMTTSDSEDASSSSQKKTRSPTVGRPRRKDSSTDDNTRRLLPGDVPEGLSNVKIRDPLAFSHDDSLRKDERVDENMCKQVSSEGKSWRTIEKGLFEKGVEIFGRNSCLIARNLLSGMKTCAEVYQYMKRFENKLSGRGGGDGNSLVEGYSKGDFSETKGNEIRRRSKFLRRRGKVRRLKYSWKSAGYHSFRKRISERKDQPCRQYNPCNCQSACGKECSCHLSGTCCEKYCGCPKTCKNRFRGCHCAKSQCRSRQCPCFAANRECDPDVCRNCWIGCGDGTLGVPYQRGDNYECRNMKLLLKQQQRVLLGRSDVSGWGAFLKNNVSKHEYLGEYTGELISHREADKRGKIYDRENSSFLFNLNDQFVLDAYRKGDKLKFANHSPDPNCYAKVIMVAGDHRVGIFAKERICAGEELFYDYRYEPDRAPAWARKPEAPGTKKEDAAPSTGRAKKLA。

[0022] 1.3 Expression analysis Flower bud RNA was extracted using the plant RNA extraction kit TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian), and the first-strand cDNA was synthesized using the reverse transcription kit TaKaRa PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian). The cDNA template after reverse transcription was diluted 2.5 times as the cDNA for qRT-PCR reaction, with 3 biological replicates and 3 technical replicates, and Actin was used as the internal reference (PsActin-real-F: GAGAGATTCCGTTGCCCTGA, PsActin-real-R: CTCAGGAGGAGCAACCACC), using 2 -△△Ct The relative expression was calculated by qRT-PCR kit. PsF Gene expression patterns in peony buds at different stages of low temperature accumulation ( Figure 3 ).

[0023] According to the qPCR SYBR Green Premix Pro Taq HS qPCR Kit Ⅱ (Hunan, Aikerui), a 20 μL reaction system was prepared. SYBR Premix Ex TaqⅡ 10 μL, forward primer (PsCLF-real-F: TGTGCGAAAAGTCAATGCCG) 10 μM 0.6 μL, reverse primer (PsCLF-real-R: AGCTCCCCACCCAGATACAT) 10 μM 0.6 μL and ddH2O 6.4 μL, cDNA 2 μL, ROX II Dye (50×) 0.4 μL. Reaction conditions: 95℃ 10s; 95℃ 30s, 55℃ 30s, 72℃ 30s, 40 cycles. The reaction was run on an Applied Biosystems QuantStudioTM 5 fluorescence quantitative PCR instrument.

[0024] 1.4 Functional analysis of overexpressed genes 1.4.1 Vector construction The vector construction structure is as follows Figure 4 As shown. Using seamless cloning primer design software, design PsFPrimers (Super1300-PsCLF-F: atacaccaatcgactctagaATGGCGTCAACGGTCTCGC, Super1300-PsCLF-R: gcccttgctcaccatggtaccTTATGCTAGCTTCTTAGCACGACC) (Table 1) were used to amplify the DNA using Takara high-fidelity amplification enzyme Prime star. PsF , and restriction endonucleases XB I. Kpn I digested the Super1300 vector (or pBI121 vector) and used homologous recombinase to PsF The ORF of the gene was connected to the Super1300 vector, and the recombinant plasmid was transformed into Escherichia coli DH5a (Shanghai, Weidi). The culture was carried out at 37℃ overnight, and a single colony was picked for colony PCR identification. The positive strain was sent to the company (Shanghai, Shenggong) for sequencing. The correct recombinant plasmid was transformed into Agrobacterium EHA105 (Shanghai, Weidi), cultured at 28℃ for 48h, and colony PCR was performed to obtain the target strain, and glycerol was added to store at -80℃ for later use ( Figure 5 ); Table 1 Primer sequence information used in the present invention .

[0025] 1.4.2 Preparation of Peony Buds From November 15 to 30, cut the robust, plump and firm top flower buds from the dormant peony 'Luhehong' plants as materials. Peel off the outer 1-2 layers of bud scales and rinse with tap water for 40-60 min. Transfer to 0.1% detergent solution and soak for 10 min, rinse with running water for 15 min, and remove the remaining detergent. Then transfer to the clean bench for further disinfection, first disinfect with 75% alcohol for 20 s, rinse with sterile distilled water once, then disinfect with 0.1% mercuric chloride for 10 min, rinse with sterile distilled water 4-5 times, and set aside.

[0026] 1.4.3 Preparation of infection solution Select Super1300, Super1300- PsF Inoculate a single colony into a 50 mL tube containing 10 mL LB liquid medium (with antibiotics Kan + Rif) and shake overnight at 200 rpm and 28°C. Dilute 1:50 or 1:100 into 100 mL LB liquid medium containing Kan + Rif antibiotics (500 mL Erlenmeyer flask) and shake overnight at 200 rpm and 28°C until the OD value reaches 1.0-1.2.

[0027] Centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend the precipitate in infection buffer (10 mM MgCl2, 10 mM MES and 100 mM acetosyringone, pH = 5.6), adjust OD600≈1.0, and incubate at 25°C for 3 h before using to infect peony flower buds.

[0028] 1.4.4 Infection of flower buds On the clean bench, immerse the treated peony flower buds in the prepared infection solution. Place the beaker in a vacuum pump, connect the vacuum pump, evacuate to -0.07 MPa, maintain for 5 minutes, and slowly release the air; repeat 3 times.

[0029] After infection, the flower buds were rinsed 2-3 times with sterile distilled water, inoculated into co-culture medium (1 / 2MS + 100 mM acetosyringone), and cultured in the dark at 8°C for 3 days. The flower buds were then transferred to the selection medium (1 / 2MS + timentin) and cultured at 25°C under light (16 h light / 8 h dark). RNA was extracted after 5 days of light culture, and gene expression was detected by qRT-PCR. The flower bud growth parameters were observed and recorded for 10-30 days ( Figure 6 , Figure 7 ).

[0030] 1.4.5 Gene expression analysis and phenotypic identification Dormancy release and germination status were evaluated by relative growth ( Figure 7 ). The control Super1300 (Mock) and Super1300- PsF (OE-CLF) Flower bud height (H x ) and width (W x ), where x represents the number of days of light culture after infection, and the relative growth rate R width =(W x -W0) / W0; R height =(H x -H0) / H0. At 14 days, Super1300- PsF The relative growth width was 2.83 times that of the control, and 3.05 times that of the control at 28 days; the relative growth height was 1.61 times that of the control at 14 days, and 1.7 times that of the control at 28 days. PsF Promotes the germination and growth of flower buds.

[0031] The RNA extraction, reverse transcription, and qPCR analysis of transformed flower buds were the same as in 1.3. The flower buds transformed with Super1300 were used as controls, and the qRT-PCR kit (SYBR Green Premix Pro Taq HS qPCR Kit Ⅱ, Hunan, Aikerui) was used to detect the expression of Super1300- PsF middle PsF The relative expression of genes ( Figure 8 ), and calculate the transformation efficiency. PsCLF-OE-1, OE-2, OE-3 The expression level was significantly higher than that of the control, indicating successful overexpression. These three strains were selected to further analyze the expression changes of marker genes related to dormancy release. CYCD , EBB3 , BG9 The expression of the three genes was significantly higher than that of the control (quantification primers: PsCYCD-real-F: GAGGCCGTGGATTGGATTCT, PsCYCD-real-R: AAAAGGGGCACTTGGGTCTC; PsEBB3-real-F: GGTGAGATTACTCCGCCACC, PsEBB3-real-R: CGACCCTGAATCTGAGACCG; PsBG9-real-F: TCATCTTCGCTCCGATGCTC, PsBG9-real-R: TCGGCCACAACTATGTCCAC.) Fig. 9 ).visible, PsF It is a positive regulatory gene for dormancy release.

[0032] Example 2: Analysis of silent gene function 1.1 Vector construction According to the SGN VIGS Tool (https: / / vigs.solgenomics.net / ?tdsourcetag=s_pctim_aiomsg), gene-specific sequences were retrieved and specific primers (PsCLF-TRV2-F:gtgagtaaggttaccgaattcATTGATTC TTTGAAGGAACAAGTTGC, PsCLF-TRV2-R:cgtgagctcggtaccggatccGACAGCA ATACTAGATCCTAGAAGAACTG) were designed to amplify the PCR product. PsF Specific sequence of Eco RI and Bam TRV2 was linearized by HI and subjected to ClonExpress®II recombination reaction (ClonExpress®II One Step Cloning Kit) with the amplified band to obtain recombinant plasmid DNA. According to the vector construction and transformation steps in 1.4.1, TRV2- PsF vector and transformed into Agrobacterium EHA105.

[0033] Amplification using specific primers PsF Fragments were tested by gel electrophoresis to see if the band size was consistent with the expected value ( Figure 5). According to the seamless cloning method, the target band was recombined with the TRV2 vector, and the recombinant plasmid was transformed into the Escherichia coli DH5ɑ strain. The target single clone was identified by colony PCR combined with sequencing. Extract the recombinant plasmid TRV2- PsF The transformed bacteria were plated on LB medium containing Kan and Rif, and the target clones were identified and used for later use ( Figure 5 ).

[0034] 1.2 Peony bud preparation and infection The preparation of peony flower buds, preparation of infection solution, infection of flower buds, gene expression analysis and phenotypic identification are the same as 1.4.2-1.4.5 of Example 1.

[0035] qPCR analysis of transformed flower buds PsF Expression changes, 6 out of 8 flower buds tested PsF The expression level decreased significantly, and the silencing effect was good ( Figure 8 ). The growth of the transformed flower buds was observed. PsF Causes flower bud initiation and growth to slow down ( Figure 6 , Figure 7 ). After 14 days of cultivation, the flower buds slightly elongated, the leaflets did not stretch, and they were silent. PsF The height growth of the flower buds was 45.3% of that of the control group, and the width growth was 38.9% of that of the control group. At 28 days, the leaflets of the flower buds were still not stretched obviously, and the height growth was 63.8% of that of the control group, and the width growth was 37.8% of that of the control group. PsF It delays the release of dormancy and growth of peony flower buds.

[0036] Three strains with better silencing effects, PsCLF-TRV-3, PsCLF-TRV-4, and PsCLF-TRV-6, were selected and the expression levels of dormancy release-related genes were analyzed by real-time quantitative PCR. Fig. 9 As shown, silence was found PsF Significantly inhibited dormancy release-related genes CYCD , EBB3 , BG9 This further proves that PsF It is a positive regulator of dormancy release.

Claims

1. PsCLF The application of the gene in regulating the internal dormancy and growth of peony flower buds is characterized in that: Said PsCLF The nucleotide sequence of the gene is shown in SEQ ID NO:

1. The application method is to overexpress PsCLF Genes that promote budding and growth of peony buds or inhibit PsCLF Gene expression delays peony flower bud initiation and growth.

Images