SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of the SNP molecular marker, and belongs to the technical field of biology. The SNP molecular markers 1-3 are remarkably related to the growth traits of the litopenaeus vannamei, genomic DNA of muscular tissue of the litopenaeus vannamei to be detected is extracted and then serves as template DNA to be subjected to PCR amplification and sequencing, the genotypes of the three molecular markers are determined, and the litopenaeus vannamei with obvious growth advantages can be rapidly screened out. The molecular marker can accelerate the breeding process of the improved variety of the litopenaeus vannamei, and provides a theoretical basis for mining application of related genetic markers in litopenaeus vannamei molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a SNP molecular marker related to growth traits of Litopenaeus vannamei and an application thereof. Background Art

[0002] The Vannamei shrimp is the shrimp with the highest aquaculture yield in the world. It is native to the Pacific coastal waters of South America and is most concentrated along the coast of Ecuador. It has delicious meat and rich nutrition, making it an excellent variety for intensive aquaculture. Growth traits are one of the most important economic traits of shrimp. The growth rate of shrimp directly affects the economic benefits of aquaculture. Cultivating shrimp varieties with fast growth rates is beneficial to pond utilization, reducing disease risks and aquaculture costs, and increasing production.

[0003] In recent years, many scholars have studied the biological characteristics and breeding techniques of Penaeus vannamei. However, compared with other species, especially crops, the breeding research to improve the production performance of Penaeus vannamei is relatively slow. That is because the traditional breeding methods have problems such as high cost, large workload, long cycle, low efficiency, and separation of offspring traits. An effective way to solve the problem is to use molecular marker-assisted breeding on the basis of traditional breeding. Molecular marker-assisted breeding can improve the accuracy of selection, identify individuals with excellent traits at an early stage, and screen excellent parents, thereby accelerating the breeding process and shortening the breeding cycle.

[0004] ZBTB24 (Zinc Finger-andBTB Domain-Containing Protein 24) belongs to the zinc finger protein family. At present, the research on the related functions of ZBTB24 gene is mainly in humans, while there are few related studies on Litopenaeus vannamei. Studies have shown that the ZBTB24 gene is involved in the transcription induced by bone morphogenetic protein 2 (BMP2), and its mutation may cause immunodeficiency, centromere instability, and facial abnormalities (ICF2) syndrome. One of the characteristics of ICF2 syndrome is growth retardation, which suggests that ZBTB24 may be a growth-related gene. The results of this study will provide relevant information for this purpose. Summary of the invention

[0005] The present invention provides a SNP molecular marker related to the growth traits of Penaeus vannamei, wherein the SNP molecular marker is at least one of SNP1, SNP2 and SNP3;

[0006] The SNP1 is located at the 295 bp position of the nucleotide sequence shown in SEQ ID NO.1, and the base of the position is G or A; the GG genotype of the SNP1 is the dominant genotype;

[0007] The SNP2 is located at the 493bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is T or C; the TT genotype of the SNP2 is the dominant genotype;

[0008] The SNP3 is located at the 595bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is A or G; the AA genotype of the SNP3 is the dominant genotype.

[0009] The present invention also provides an application of a reagent for detecting the SNP molecular marker in selective breeding related to growth traits of Penaeus vannamei.

[0010] Preferably, the application is to use the genomic DNA of the tested Litopenaeus vannamei as a template, and to determine the genotype of the SNP molecular marker by PCR amplification and sequencing. When the genotype of SNP1 is GG, the individual is selected as a reserve parent for breeding; when the genotype of SNP2 is TT, the individual is selected as a reserve parent for breeding; when the genotype of SNP3 is AA, the individual is selected as a reserve parent for breeding; when the haplotype combination genotype of SNP1, SNP2 and SNP3 is GGTTAA, the individual is selected as a reserve parent for breeding.

[0011] More preferably, the PCR primer sequences used in the PCR amplification are shown in SEQ ID NO.2-3.

[0012] More preferably, the PCR amplification system is as follows: 13.4 μL ddH2O; 2 μL 10×Buffer; 1.6 μL 2.5 mM dNTP; 0.4 μL 10 mM upstream primer; 0.4 μL 10 mM downstream primer; 0.2 μL Taq enzyme; and 2 μL 30 ng / μL DNA template.

[0013] More preferably, the PCR amplification conditions are as follows:

[0014] a. Pre-denaturation at 94℃ for 10min;

[0015] b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min;

[0016] c. Final extension at 72°C for 10 min.

[0017] The present invention also provides a method for evaluating the growth traits of Penaeus vannamei, wherein the genotype of SNP1-SNP3 of the Penaeus vannamei to be tested is obtained by detection, and then the growth performance thereof is evaluated by the genotype;

[0018] The SNP1 is located at the 295 bp position of the nucleotide sequence shown in SEQ ID NO.1, and the base of the position is G or A; the GG genotype of the SNP1 is the dominant genotype;

[0019] The SNP2 is located at the 493bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is T or C; the TT genotype of the SNP2 is the dominant genotype;

[0020] The SNP3 is located at the 595bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is A or G; the AA genotype of the SNP3 is the dominant genotype.

[0021] The present invention also provides a product for evaluating the growth performance of Penaeus vannamei, wherein the product contains primers capable of amplifying a nucleotide sequence as shown in SEQ ID NO.1.

[0022] Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO.2-3.

[0023] More preferably, the product is a kit.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention takes Penaeus vannamei as the object, provides several molecular markers for evaluating the growth traits of Penaeus vannamei and a method for using the related molecular markers in Penaeus vannamei breeding, which can be applied to the early breeding of new varieties of Penaeus vannamei with excellent growth traits, reduce the breeding cost, shorten the breeding cycle and improve the efficiency, and provide a theoretical basis for the variety improvement of Penaeus vannamei. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The electrophoresis diagram shows the PCR product of the molecular marker on the ZBTB24 gene of Penaeus vannamei amplified by the primer pair SEQ ID NO.2 and SEQ ID NO.3; M: DL1000 DNAMaker.

[0027] Figure 2 The three genotypes of SNP1 on the ZBTB24 gene of Litopenaeus vannamei are shown: GG, GA and AA.

[0028] Figure 3 The three genotypes of SNP2 at the ZBTB24 gene of Litopenaeus vannamei are shown: TT, TC and CC.

[0029] Figure 4 The three genotypes of SNP3 at the ZBTB24 gene of Litopenaeus vannamei are shown: AA, AG and GG.

[0030] Figure 5 Showing the results of linkage disequilibrium analysis of three SNPs loci in the ZBTB24 gene of Penaeus vannamei. DETAILED DESCRIPTION

[0031] Example 1 Collection of growth phenotypic data of Litopenaeus vannamei and amplification of ZBTB24 gene sequence

[0032] 1. Obtaining genomic DNA of Penaeus vannamei and collecting growth phenotypic data

[0033] The experimental Penaeus vannamei shrimp used in this example was from Fujian Dongfang Liyang Seedling Breeding Co., Ltd. Under the same breeding environment and feeding conditions, 100 Penaeus vannamei shrimp were randomly selected, and the growth trait-related indicators such as weight (g), total length (cm), body length (cm), cephalothorax length (cm) and meat yield (%) of each Penaeus vannamei shrimp were measured and recorded in detail. At the same time, muscle tissue of each Penaeus vannamei shrimp was taken, and sample DNA was extracted using a marine animal tissue DNA extraction kit (Beijing Tiangen), and the whole genome DNA sample of each Penaeus vannamei shrimp was obtained and stored at -80°C.

[0034] 2. Primer Design

[0035] According to the ZBTB24 gene sequence of Litopenaeus vannamei found on the NCBI website (LOC113824337), the primer sequences were designed using PrimerPremier 5.0 software as shown in Table 1.

[0036] Table 1 Primer sequences

[0037]

[0038] 3. Pooled PCR Amplification and Sequencing

[0039] 1 μL of the DNA samples of 100 Litopenaeus vannamei extracted in step 1 were respectively extracted and mixed to prepare a DNA pool, and PCR amplification was performed using the primers shown in step 2 and the DNA pool as a template.

[0040] The 20 μL system of the PCR amplification reaction is: 13.4 μL of ddH2O; 2 μL of 10×Buffer; 1.6 μL of 2.5 mM dNTP; 0.4 μL of 10 mM upstream primer; 0.4 μL of 10 mM downstream primer; 0.2 μL of Taq enzyme; and 2 μL of 30 ng / μL DNA template.

[0041] The program of the PCR amplification reaction was set as follows: a. 94° C. pre-denaturation for 10 min; b. 35 cycles of chain reaction, including: 94° C. denaturation for 1 min, 58° C. annealing for 1 min, and 72° C. extension for 1 min; c. final extension at 72° C. for 10 min.

[0042] After the PCR products passed the quality inspection, Sanger sequencing was performed, and SeqMan software was used to observe whether there were overlapping peaks in the sequencing peak graph.

[0043] 4. Analysis of mixed pool sequencing results

[0044] Three overlapping peaks were found in the sequencing results of the PCR amplification products of the DNA pool.

[0045] The first overlapping peak is located at the 295 bp site of the nucleotide sequence shown in SEQ ID NO.1, located at the 66th base on the 4th exon of the ZBTB24 gene, where G mutated to A, i.e., E4-66 G>A, recorded as SNP1;

[0046] The second overlapping peak is located at the 493 bp site of the nucleotide sequence shown in SEQ ID NO.1, located at the 264th base on the 4th exon of the ZBTB24 gene, where T mutated to C, i.e., E4-264 T>C, recorded as SNP2;

[0047] The third overlapping peak is located at the 595bp site of the nucleotide sequence shown in SEQ ID NO.1, located at the 366th base on the 4th exon of the ZBTB24 gene, where A mutated to G, namely E4-366A>G, ​​recorded as SNP3.

[0048] >SEQ ID NO.1

[0049] CAAGATGGGTGATGGAATGCTCT(SEQ ID NO.2)CATTATCGTGGAACAACCACAAAGCCACA TTTTGTCACATCCTGTCAACATTACGCGAAAAGGTTTGTAACAATTTGATCTTGTATCTCAATTGCTGTATAGAAGGTGAAACAAAGGATATGTAATAGGTAATGGGAATATCAAAAAATAAATAATACTATTGCAGATATAAGTATATAATTTCCTCTTTTTCTTCTAATGAACAGGAGAGATATACAGATGTTACTTTAGCTTTGTGAAGGGAAGTTCTACCCAGTCCACAAGCTGGTATT G(A)TCAACATGTAGTGAATACTTTGAGAAGATGTT TGAGCACACACCTTGTAAGCATCCAGTCATAGTTTTGAAGGACGTTAAACCTGACGAGTTAGAAGCAT TATTAAGTTATATGTATGCTGGTGTTGTCAGTGTAGCTCAGAATGACCTGGCTAGGTTGATCAAAGCAG CCGAGTTACTTCAAATTAAAGGCTTAGC T(C) GTGCCTGATGAACCACCTTCAAGACAAGAATGCAAA AAATACATCCCACGGGACGACCGAGCGAGTCCACACCCAAAAAGACGGAGACGAGAAGATCCTTT A(G) CCGATCGCCACAGTTCCTCCGGGGGTAGCAGTTGCGTCAGAGAGTCCTCCGTCCTCACCTCACCAT GTAGACACTGAACACAACTGGGACCAACCGACACACACCTGGAAGAGCCAAAGGGAGACAGTTCC GACCAGAGGCTTAATGACAGTACAGATCAAAGGGAAGAATTCAGTTCAACGAAACAGGAA (SEQ ID NO. 3)TCGACAGCGCATAGTCAGGTAGG

[0050] Example 2 Population genetic characteristics of three SNP sites in the ZBTB24 gene of Penaeus vannamei

[0051] 1. Sanger sequencing to identify the genotype of individual SNP loci of Litopenaeus vannamei

[0052] PCR amplification was performed using the whole genomic DNA of muscle tissue of 100 individual Penaeus vannamei in Example 1 as templates (amplification primers, PCR system and reaction procedure were the same as in Example 1), and the PCR products were subjected to Sanger sequencing to determine the genotype of the SNPs of each Penaeus vannamei after passing the quality inspection.

[0053] 2. Calculation of genetic characteristics of Penaeus vannamei population

[0054] According to the sequencing results in step 1, mutation site screening and genotype statistics were performed on the shrimp individuals, and the gene frequency and genotype frequency of the alleles were calculated using Excel software. 2 Popgen32 software was used to calculate genetic heterozygosity (H) and effective number of alleles (Ne), and PIC software was used to calculate PIC value.

[0055] 3. Analysis of genetic characteristics of Penaeus vannamei population

[0056] The results showed that SNP site 1 had three genotypes, the GG genotype had 80 tails with a genotype frequency of 0.8; the GA genotype had 16 tails with a genotype frequency of 0.16; the AA genotype had 4 tails with a genotype frequency of 0.04; the gene frequencies of alleles G and A were 0.88 and 0.12 respectively, the gene frequency of allele G was higher than that of allele A, and it was a dominant gene in the population.

[0057] SNP site 2 has three genotypes, the TT genotype has 80 tails and a genotype frequency of 0.8; the TC genotype has 16 tails and a genotype frequency of 0.16; the CC genotype has 4 tails and a genotype frequency of 0.04; the gene frequencies of alleles T and C are 0.88 and 0.12 respectively. The gene frequency of allele T is higher than that of allele C, and it is a dominant gene in the population.

[0058] SNP site 3 has three genotypes, AA genotype has 80 tails and a genotype frequency of 0.8; AG genotype has 16 tails and a genotype frequency of 0.16; GG genotype has 4 tails and a genotype frequency of 0.04; the gene frequencies of alleles A and G are 0.88 and 0.12 respectively. The gene frequency of allele A is higher than that of allele G, and it is a dominant gene in the population.

[0059] The heterozygosity (H) of SNP1, SNP2 and SNP3 loci was 0.2112 (<0.25), which was a low degree of polymorphism; 2 The test results showed that SNP1, SNP2 and SNP3 loci χ 2 The values ​​are all in χ 2 < 2 0.05(k-1) , P>0.05, which means that the population of Penaeus vannamei is in Hardy-Weinberg equilibrium. The genotype frequency and gene frequency distribution of the three SNP loci of the ZBTB24 gene of Penaeus vannamei are shown in Table 2.

[0060] Table 2 Population genetic characteristics of three SNPs in ZBTB24 gene of Litopenaeus vannamei

[0061]

[0062] Note: 2 0.05 (df ​​= 2) = 5.99, χ 2 0.01 (df=2)=9.21.

[0063] Example 3 Analysis of the correlation between ZBTB24 gene polymorphism and growth traits of Litopenaeus vannamei

[0064] The multiple comparisons of one-way variance in SPSS26.0 software were used to test the relationship between the growth phenotypic data (weight / cm, total length / cm, body length / cm, cephalothorax length / cm and meat yield / %) of the 100 vannamei shrimp in Example 1 and the genotypes of the three SNP sites of the 100 shrimp in Example 2. When P<0.05, it indicated a significant difference, and when P<0.01, it indicated an extremely significant difference. The results were expressed as mean ± standard deviation.

[0065] The results showed that different genotypes of SNP site 1 were significantly correlated with the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei. Among them, the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei individuals with genotype GG were significantly higher than those of individuals with genotype GA.

[0066] Different genotypes of SNP site 2 were significantly correlated with the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei. Among them, the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei individuals with genotype TT were significantly higher than those of individuals with genotype TC.

[0067] Different genotypes of SNP site 3 were significantly correlated with the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei. Among them, the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of Penaeus vannamei individuals with genotype AA were significantly higher than those of individuals with genotype AG.

[0068] The following inferences can be made: when the genotype of molecular marker SNP1 is GG, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits; when the genotype of molecular marker SNP2 is TT, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits; when the genotype of molecular marker SNP3 is AA, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits. The results of the correlation analysis between different genotypes of the three SNPs loci of the ZBTB24 gene of Penaeus vannamei and its growth traits are shown in Table 3.

[0069] Table 3 Correlation analysis between different genotypes of three SNPs loci in ZBTB24 gene of Litopenaeus vannamei and its growth traits

[0070]

[0071] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0072] Example 4 Correlation analysis between ZBTB24 gene haplotype and growth traits of Litopenaeus vannamei

[0073] Haploview software was used to perform haplotype linkage disequilibrium analysis on the SNPs sites of the 100 vannamei shrimp in Example 2; the growth trait phenotypic data (weight / cm, total length / cm, body length / cm, cephalothorax length / cm and meat yield / %) of the 100 vannamei shrimp in Example 1 and the haplotype relationship of the three SNP sites of the 100 shrimp in Example 2 were tested for significance of difference using the multiple comparison analysis of variance of the one-way variance in SPSS26.0 software. When P<0.05, it indicated a significant difference, and when P<0.01, it indicated an extremely significant difference. The results were expressed as mean ± standard deviation.

[0074] The results showed that the three SNPs formed a haplotype domain, and there were three biologically statistically significant haplotypes (n≥3), namely H1H1(GG TTAA), H1H2(GATCAG) and H2H2(AACC GG). Among them, the weight (g), total length (cm), body length (cm) and carapace length (cm) of the H1H1(GGTTAA) haplotype Penaeus vannamei individuals were significantly higher than those of the H1H2(GATCAG) haplotype individuals, but there was no significant difference with the H2H2(AACC GG) haplotype individuals.

[0075] The following inference can be made: when the haplotype combination genotype of the three molecular markers is GG TTAA, the individual can be retained as a parent for breeding excellent growth traits of Penaeus vannamei. The results of the correlation analysis between the ZBTB24 gene haplotype of Penaeus vannamei and its growth traits are shown in Table 4.

[0076] Table 4 Correlation analysis between ZBTB24 gene haplotype and its growth traits in Litopenaeus vannamei

[0077]

[0078] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0079] Example 5 Verification of the correlation between the SNP locus genotype and haplotype of the ZBTB24 gene of Litopenaeus vannamei and its growth traits

[0080] In order to further verify the correlation between the genotype and haplotype of the SNP site of the ZBTB24 gene and the growth traits of Penaeus vannamei, this example selects another 60 Penaeus vannamei for analysis. The culture environment and feeding conditions of Penaeus vannamei are the same as those in Example 1. The same method as in Example 1 was used to measure the growth trait-related indicators of 60 Penaeus vannamei, and then the sample DNA was extracted; the PCR amplification, Sanger sequencing and SNPs site genotype statistical steps were the same as in Example 2; the analysis method of the correlation between the growth trait of Penaeus vannamei ZBTB24 and the gene polymorphism was the same as in Example 3; the analysis method of the correlation between the ZBTB24 gene haplotype and the growth trait of Penaeus vannamei was the same as in Example 4.

[0081] The results showed that the weight (g), total length (cm) and body length (cm) of the vannamei shrimp individuals with SNP site 1 genotype GG were significantly higher than those of the individuals with genotypes GA and AA; the cephalothorax length (cm) of the vannamei shrimp individuals with genotype GG was significantly higher than that of the individuals with genotype AA.

[0082] The weight (g), total length (cm) and body length (cm) of Penaeus vannamei individuals with genotype TT at SNP site 2 were significantly higher than those of individuals with genotype TC and CC; the cephalothorax length (cm) of Penaeus vannamei individuals with genotype TT was significantly higher than that of individuals with genotype CC.

[0083] The weight (g), total length (cm) and body length (cm) of the individuals with genotype AA at SNP locus 3 were significantly higher than those with genotypes AG and GG; the head and chest carapace length (cm) of the individuals with genotype AA was significantly higher than that of the individuals with genotype GG. The results of the correlation analysis between the different genotypes of the three SNPs loci of the ZBTB24 gene of the vannamei shrimp and its growth traits are shown in Table 5.

[0084] Table 5 Correlation analysis between different genotypes of three SNPs loci in ZBTB24 gene of Litopenaeus vannamei and its growth traits

[0085]

[0086]

[0087] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0088] In addition, the weight (g), total length (cm) and body length (cm) of the H1H1 (GG TTAA) haplotype Penaeus vannamei were significantly higher than those of the H1H2 (GATCAG) and H2H2 (AA CC GG) haplotypes, and the carapace length (cm) of the H1H1 (GG TTAA) haplotype Penaeus vannamei was significantly higher than that of the H2H2 (AACC GG) haplotype, but there was no significant difference with the H1H2 (GA TCAG) haplotype. The results of the correlation analysis between the ZBTB24 gene haplotype of Penaeus vannamei and its growth traits are shown in Table 6.

[0089] Table 6 Correlation analysis between ZBTB24 gene haplotype and its growth traits in Litopenaeus vannamei

[0090]

[0091] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0092] In summary, Example 5 can verify the inferences obtained in Example 3 and Example 4, that is, when the genotype of the molecular marker SNP1 is GG, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits; when the genotype of the molecular marker SNP2 is TT, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits; when the genotype of the molecular marker SNP3 is AA, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits; when the haplotype combination genotype of the three molecular markers is GG TTAA, the individual can be retained as a parent of Penaeus vannamei for breeding excellent growth traits.

[0093] Example 6 A method for evaluating the growth characteristics of Penaeus vannamei

[0094] A method for evaluating the growth traits of Penaeus vannamei, comprising the steps of:

[0095] (1) Extraction of whole genome DNA from muscle tissue of Penaeus vannamei to be tested.

[0096] (2) PCR amplification was performed using the primer pairs, PCR reaction system composition and reaction conditions shown in Example 1. After the PCR products passed the quality inspection, Sanger sequencing was performed to determine the genotypes of the SNPs of the ZBTB24 gene of the vannamei shrimp.

[0097] (3) When the genotype of the molecular marker SNP1 is GG, the individual can be retained as a parent of Penaeus vannamei for breeding with excellent growth traits; when the genotype of the molecular marker SNP2 is TT, the individual can be retained as a parent of Penaeus vannamei for breeding with excellent growth traits; when the genotype of the molecular marker SNP3 is AA, the individual can be retained as a parent of Penaeus vannamei for breeding with excellent growth traits; when the haplotype combination genotype of the three molecular markers is GG TTAA, the individual can be retained as a parent of Penaeus vannamei for breeding with excellent growth traits.

[0098] Example 7 A kit for evaluating the growth characteristics of Penaeus vannamei

[0099] A test kit for evaluating the growth traits of Penaeus vannamei, comprising:

[0100] (1) Primer pair: ZBTB24-F CAAGATGGGTGATGGAATGCTCT (SEQ ID NO. 2)

[0101] ZBTB24-R CCTACCTGACTATGCGCTGTCGA(SEQ ID NO.3)

[0102] (2) Reaction system (20 μL): ddH2O 13.4 μL; 10× Buffer 2 μL; 2.5 mM dNTP 1.6 μL; 10 mM upstream primer 0.4 μL; 10 mM downstream primer 0.4 μL; Taq enzyme 0.2 μL; 30 ng / μL DNA template 2 μL.

[0103] (3) The method of using the kit is the same as in Example 6.

[0104] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with growth traits of Penaeus vannamei, characterized in that: The SNP molecular marker is at least one of SNP1, SNP2, and SNP3; The SNP1 is located at the 295 bp position of the nucleotide sequence shown in SEQ ID NO.1, and the base of the position is G or A; the GG genotype of the SNP1 is the dominant genotype; The SNP2 is located at the 493bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is T or C; the TT genotype of the SNP2 is the dominant genotype; The SNP3 is located at the 595 bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is A or G; the AA genotype of the SNP3 is the dominant genotype.

2. Use of a reagent for detecting the SNP molecular marker according to claim 1 in selective breeding related to growth traits of Penaeus vannamei.

3. The use according to claim 2, characterized in that: The genomic DNA of the tested Litopenaeus vannamei is used as a template, and the genotype of the SNP molecular marker is determined by PCR amplification and sequencing. When the genotype of SNP1 is GG, the individual is selected as a reserve parent for breeding; when the genotype of SNP2 is TT, the individual is selected as a reserve parent for breeding; when the genotype of SNP3 is AA, the individual is selected as a reserve parent for breeding; when the haplotype combination genotype of SNP1, SNP2 and SNP3 is GG TTAA, the individual is selected as a reserve parent for breeding.

4. The use according to claim 3, characterized in that: The PCR primer sequences used in the PCR amplification are shown in SEQ ID NO.2-3.

5. The use according to claim 4, characterized in that: The PCR amplification system is as follows: 13.4 μL of ddH2O; 2 μL of 10×Buffer; 1.6 μL of 2.5 mM dNTP; 0.4 μL of 10 mM upstream primer; 0.4 μL of 10 mM downstream primer; 0.2 μL of Taq enzyme; and 2 μL of 30 ng / μL DNA template.

6. The use according to claim 5, characterized in that: The PCR amplification conditions are as follows: a. Pre-denaturation at 94℃ for 10min; b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min; c. Final extension at 72°C for 10 min.

7. A method for evaluating the growth traits of Penaeus vannamei, characterized in that: The genotypes of SNP1-SNP3 of the tested Litopenaeus vannamei were obtained by detection, and then the growth performance was evaluated by the genotypes; The SNP1 is located at the 295 bp position of the nucleotide sequence shown in SEQ ID NO.1, and the base of the position is G or A; the GG genotype of the SNP1 is the dominant genotype; The SNP2 is located at the 493bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is T or C; the TT genotype of the SNP2 is the dominant genotype; The SNP3 is located at the 595bp site of the nucleotide sequence shown in SEQ ID NO.1, and the base of the site is A or G; the AA genotype of the SNP3 is the dominant genotype.

8. A product for evaluating the growth performance of Penaeus vannamei, characterized in that: The product contains primers that can amplify the nucleotide sequence shown in SEQ ID NO.

1.

9. The product according to claim 8, characterized in that The nucleotide sequence of the primer is shown in SEQ ID NO.2-3.

10. The product according to claim 8 or 9, characterized in that The product is a test kit.

Images