SNP molecular marker related to rapid growth traits of cyprinus carpio and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to rapid growth traits of Yellow River carps and application thereof. The SNP molecular marker is shown as 1), 2) or 3) as follows: 1) the SNP molecular marker is located at the 6206162 site of the 12th chromosome of the Yellow River carps and has a polymorphic base of A / G, 2) the SNP molecular marker is located at the 15000329 site of the 23rd chromosome of the Yellow River carps and has a polymorphic base of G / T, and 3) the SNP molecular marker is located at the 490045 site of the 32th chromosome of the Yellow River carps and has a polymorphic base of C / T; the growth character is the weight of the individual. The SNP molecular marker disclosed by the invention can be used for early breeding of the Yellow River carp with a rapid growth character, so that the breeding workload is greatly reduced, the breeding time can be remarkably shortened, the breeding process is accelerated, the breeding efficiency is improved, and the breeding cost is reduced; the method has important guiding significance for improving the production performance of the Yellow River carps, reducing the cultivation cost of the Yellow River carps and increasing the cultivation income, and is suitable for popularization and application.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers for aquatic animals, and more specifically, to a SNP molecular marker associated with the rapid growth trait of Yellow River carp and its application. Background Art

[0002] Yellow River carp (Cyprinus carpio), belonging to the Cypriniformes order, Cyprinidae family, Cyprinus genus, is distributed in freshwater bodies in Eurasia and is found throughout China. Yellow River carp is one of the important species in China's freshwater aquaculture industry. According to the 2023 China Fisheries Statistical Yearbook, the production of Yellow River carp reached millions of tons in 2022, making it one of the main farmed freshwater fish. However, despite the high annual production of Yellow River carp, the current intensive farming also brings a series of problems. The dense farming environment and restricted activities affect its growth and development, and are also prone to the spread of diseases, increasing the risk of carp suffering from diseases, thereby affecting growth, which undoubtedly increases the cost of farming. Therefore, there is an urgent need to develop molecular markers related to growth traits for carp molecular marker-assisted breeding, to screen individuals with fast growth traits for the next generation of breeding.

[0003] In the field of molecular marker-assisted breeding, SNP molecular markers have become a hot topic of research due to their high genetic stability, wide distribution, rapid and accurate detection, etc. By resequencing the whole genome of different strains of Yellow River carp, a large number of SNP sites can be obtained, which can be used to construct genetic linkage maps, and then conduct quantitative trait loci (QTL) positioning analysis to identify key genes or markers that control growth traits. For example, through genome-wide association analysis (GWAS), SNP markers related to the rapid growth trait of Yellow River carp and their typing information can be screened out. These markers can be used to effectively select fast-growing individuals under the same breeding conditions, providing technical support for molecular marker-assisted breeding of Yellow River carp.

[0004] In addition, SNP molecular markers can also be used for the identification of Yellow River carp germplasm. Through a specific combination of SNP markers, different strains of Yellow River carp can be accurately identified, which is of great significance for the protection and utilization of germplasm resources, genetic evolution research, etc. With the development of molecular biology technology, SNP molecular markers have broad application prospects in the Yellow River carp breeding industry, and are expected to provide strong technical support for the breeding of high-yield, high-quality, and stress-resistant new varieties of Yellow River carp. Summary of the invention

[0005] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0006] Another object of the present invention is to provide a SNP molecular marker associated with the rapid growth trait of Yellow River carp.

[0007] Another object of the present invention is to provide amplification primers for detecting the SNP molecular markers associated with the rapid growth trait of Yellow River carp.

[0008] Still another object of the present invention is to provide a method for breeding Yellow River carp with fast growth traits.

[0009] Still another object of the present invention is to provide a kit.

[0010] Another object of the present invention is to provide the use of the SNP molecular marker, the amplification primer or the kit in breeding Yellow River carp with fast growth traits.

[0011] To this end, the technical solution provided by the present invention is: In the first aspect, the SNP molecular markers related to the rapid growth trait of Yellow River carp, the SNP molecular markers are as shown in 1), 2) or 3) below: 1) Located at position 6206162 of chromosome 12 of Yellow River carp, the polymorphic base is A / G, 2) Located at position 15000329 of chromosome 23 of Yellow River carp, the polymorphic base is G / T, 3) Located at position 490045 of chromosome 32 of Yellow River carp, the polymorphic base is C / T; The growth trait is the body weight of the individual; The SNP molecular marker includes one of SNP chr12_6206162, SNP chr23_15000329 and SNP chr32_490045. Wherein, the SNPchr12_6206162 is located at the 6206162 base of chromosome 12 of the Yellow River carp genome Hunaghe_carp_2.0 version, and the mutation type is A>G; the SNP chr23_15000329 is located at the 15000329 base of chromosome 23 of the Yellow River carp genome Hunaghe_carp_2.0 version, and the mutation type is G>T; the SNPchr32_490045 is located at the 490045 base of chromosome 32 of the Yellow River carp genome Hunaghe_carp_2.0 version, and the mutation type is C>T.

[0012] In the second aspect, the amplification primers for detecting the SNP molecular markers associated with the rapid growth trait of Yellow River carp include primer pairs capable of detecting one or more of the three SNP molecular markers; the amplification primers include: A pair of primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, A pair of primers as shown in SEQ ID NO:3 and SEQ ID NO:4, and / or, A pair of primers as shown in SEQ ID NO:5 and SEQ ID NO:6.

[0013] The sequences of the upstream and downstream primer pairs of SNP chr12_6206162 are: SNP chr12_6206162-F:5'-GTACCTGTTCCACTGTGA-3' (SEQ ID NO1); SNP chr12_6206162-R:5'-ATTCCGTTCAAGTCTATG-3' (SEQ ID NO2).

[0014] The sequences of the upstream and downstream primer pairs of SNP chr23_15000329 are: SNP chr23_15000329-F:5'-TGTCCACCAGTCACCAAC-3' (SEQ ID NO3); SNP chr23_15000329-R:5'-AACCTCCTGACCACAAACT-3' (SEQ ID NO4).

[0015] The sequences of the upstream and downstream primer pairs of SNP chr32_490045 are: SNP chr32_490045-F:5'-AGGGACGATGTAACCACT-3' (SEQ ID NO5); SNP chr32_490045-R:5'-GTAAGTTTGAATCTTGGAAT-3' (SEQ ID NO6).

[0016] A third aspect is a method for breeding Yellow River carp with fast growth traits, comprising the following steps: Step 1: extracting the fin ray DNA of the Yellow River carp to be tested; Step 2: using the genomic DNA in step 1 as a template, performing PCR amplification using a pair of primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4, and a pair of primers as shown in SEQ ID NO: 5 and SEQ ID NO: 6; Step 3: sequence and analyze the amplified product obtained in step 2 to determine the genotype of the SNP molecular marker of the Yellow River carp individual to be tested, and determine whether the Yellow River carp has the potential for rapid growth traits through genotype analysis.

[0017] Preferably, in the method for breeding Yellow River carp with fast growth traits, in step 3, when a pair of primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2 are used for PCR amplification, the polymorphic base located at position 6206162 of chromosome 12 of Yellow River carp is detected, and the Yellow River carp with genotype GG has the potential for fast growth traits. When the molecular marker is SNP chr12_6206162, the growth rate of Yellow River carp with genotype GG is faster, and the growth rate of Yellow River carp with genotypes AG and AA is slower.

[0018] Preferably, in the method for breeding Yellow River carp with fast growth traits, in step 3, when a pair of primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4 are used for PCR amplification, the polymorphic base located at position 15000329 of chromosome 23 of Yellow River carp is detected, and the Yellow River carp with genotype TT has the potential for fast growth traits. When the molecular marker is SNP chr23_15000329, the growth trait of the Yellow River carp with genotype TT is better than that of the Yellow River carp with genotype GT and GG.

[0019] Preferably, in the method for breeding Yellow River carp with fast growth traits, in step 3, when a pair of primers as shown in SEQ ID NO: 5 and SEQ ID NO: 6 are used for PCR amplification, the polymorphic base located at position 490045 of chromosome 32 of Yellow River carp is detected, and Yellow River carp with genotype CC has the potential for fast growth traits. When the molecular marker is SNP chr32_490045, the growth trait of Yellow River carp with CC genotype is better than that of Yellow River carp with CT and TT genotypes.

[0020] A fourth aspect is a kit, which contains amplification primers capable of detecting the SNP molecular markers associated with the growth traits of Yellow River carp.

[0021] A fifth aspect is the use of the SNP molecular marker, the amplification primer or the kit in breeding Yellow River carp with fast growth traits.

[0022] The present invention has at least the following beneficial effects: (1) The present invention analyzes the gene loci that control the growth traits of Yellow River carp through genome-wide association analysis, and screens out three candidate SNP loci that are significantly associated with growth traits, namely chr12_6206162, SNP chr23_15000329 and SNP chr32_490045. The results show that in SNP chr12_6206162, the GG genotype is the preferred genotype; in SNPchr23_15000329, the TT genotype is the preferred genotype; in SNP chr32_490045, the CC genotype is the preferred genotype, and the growth traits of individuals carrying the above genotypes are more prominent. These three SNPs can be used as molecular markers to predict the growth rate of Yellow River carp with high accuracy. The SNP loci of the present invention have application prospects in molecular marker-assisted breeding of Yellow River carp.

[0023] (2) The SNP markers of the present invention can be determined by primers, which has the advantages of simple and fast operation, accurate and reliable results, and low cost.

[0024] (3) The SNP molecular marker of the present invention is not affected by individual age, gender and other factors. The SNP molecular marker can be used for early selection of Yellow River carp with fast growth traits, greatly reducing the breeding workload, significantly shortening the breeding time, accelerating the breeding process, improving the breeding efficiency, and reducing the breeding cost; it has important guiding significance for improving the production performance of Yellow River carp, reducing the breeding cost of Yellow River carp and increasing the breeding income, and is suitable for promotion and application.

[0025] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Manhattan plot (A) and QQ plot (B) in the GWAS analysis of body weight traits of Yellow River carp provided in an embodiment of the present invention.

[0027] Figure 2 The statistical results of the weight of Yellow River carp carrying different genotypes of SNP chr12_6206162 in the embodiment of the present invention are shown in Figure 1. A: Whole genome high-throughput sequencing screening results, B: First generation sequencing verification results.

[0028] Figure 3 The weight statistics of Yellow River carp carrying different genotypes of SNP chr23_15000329 in the embodiment of the present invention are shown in Figure 1. A: Whole genome high-throughput sequencing screening results, B: First generation sequencing verification results.

[0029] Figure 4The weight statistics of Yellow River carp carrying different genotypes of SNP chr32_490045 in the embodiment of the present invention are shown in Figure 1. A: Whole genome high-throughput sequencing screening results, B: First generation sequencing verification results. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments so that those skilled in the art can implement the invention with reference to the description.

[0031] It should be understood that terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0032] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0033] In the description of the present invention, the terms "lateral", "longitudinal", "up", "down", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inside" and "outside" etc. to indicate directions or positional relationships are based on the directions or positional relationships shown in the accompanying drawings and are only for the convenience of describing the present invention and simplifying the description. They do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operated in a specific direction, and therefore should not be understood as a limitation on the present invention.

[0034] Example 1 1. Sample collection Yellow River carp samples were collected from the Zhengzhou Breeding Station of Henan Fisheries Science Academy. The study subjects included 18 full-sib families. After fry reproduction, they were reared in a 500 m2 pond at a density of 3000 per mu. After 36 months of incubation, 96 fish were randomly selected for weight measurement and then euthanized with methane sulfonate (MS-222). Fin ray samples were collected from all fish for genomic DNA extraction.

[0035] 2. Genomic DNA Extraction The genomic DNA of Yellow River carp fin rays was extracted by CTAB method. After extraction, the DNA concentration and purity were monitored on 1% agarose gel. The DNA concentration was measured using Qubit@ 2.0 Fluorometer (Thermo Scientific), and the DNA was diluted to 1 ng / µL using sterile water according to the concentration.

[0036] 3. Genotyping and quality control These reads were trimmed and quality controlled using Trimmomati (v0.36) and further aligned using BWA (BWAmemk - 32). SNPS and short InDels were detected using the HaplotypeCaller function of GATK (v 4.1.2.0). PLINK (v 1.9) was then used to screen for minor allele frequency (MAF) < 0.05, sample detection rate > 90%, SNP detection rate > 95%, Hardy-Weinberg equilibrium p value < 10 -5 SNP sites.

[0037] 4. Genome-wide association analysis of body weight traits The univariate linear mixed model (LMM) of GEMMA (v 0.98.1) was used to conduct genome-wide association analysis of body weight traits in Yellow River carp. Genotype was used as a fixed factor, and additive genetic effects were used as random effects. The threshold of the P value was corrected by the Bonferroni correction method to determine the significance threshold. When the P value of a SNP exceeded the threshold, it was considered to be a SNP significantly associated with the body weight trait of Yellow River carp. The Manhattan plot and QQ plot were drawn using the R language ggplot2 package to visualize the results of the genome-wide association analysis.

[0038] 5. Results Analysis A total of 10,210,86 independent tests were performed, and 990,597 SNP loci were retained for further GWAS analysis. The genome-wide significance threshold and the prompt threshold were 5.05×10 -8 (0.05 / 990597) and 1.01×10 -6 (1 / 990597). The GWAS results of the body weight trait of Yellow River carp are as follows Figure 1 As shown (where Figure 1 A is the Manhattan graph, Figure 1 B is QQ diagram): Three SNPs significantly associated with the body weight traits of Yellow River carp at the genome level were detected on chromosomes 12, 23, and 32. They are SNP chr12:6206162 A>G (P = 4.84e-07), SNP chr23:15000329 G>T (P = 4.53e-07), and SNP chr32:490045 C>T (P = 6.85e-07).

[0039] The weight of individuals carrying SNP chr12_6206162 with different genotypes is as follows Figure 2As shown in A, there are significant differences in average body weight among the three genotypes of the Yellow River carp chr12_6206162 locus. Among them, the average body weight of the Yellow River carp carrying the GG genotype (2981.25±195.45) g is significantly higher than that of the AG genotype (2475.34±309.11) g and the AA genotype (1979.77±269.66) g; there are also significant differences in average body weight between individuals carrying the TG genotype and the GG genotype (P<0.05). The weight of individuals carrying different genotypes of SNP chr23_15000329 is shown in Figure 3 As shown in A, there are significant differences in average body weight among the three genotypes of Yellow River carp chr23_15000329. Among them, the average body weight of Yellow River carp carrying TT genotype (2642.35±245.11) g is significantly higher than that of GT genotype (2423.85±381.49) g and GG genotype (2295.21±339.64) g. Figure 4 As shown in A, there were significant differences in average body weight among the three genotypes of Yellow River carp at the chr32_490045 locus. The average body weight of Yellow River carp carrying CC genotype (2594.96±289.01) g was significantly higher than that of CT genotype (227.81±344.24) g and TT genotype (2195.24±354.73) g.

[0040] Example 2 Verification of SNP molecular markers associated with rapid growth traits of Yellow River carp The verification experiment used different Yellow River carp populations, and 35 experimental fish were randomly selected. The weight trait indicators of each fish were measured and recorded, and the tail fin samples of each fish were collected and preserved for DNA extraction. The above-extracted DNA was used as a template and SEQ ID NO:1 and SEQ ID NO:2 were used as primers for PCR amplification to obtain a gene fragment containing SNP chr12:6206162 A>G (SEQ ID NO:7). As shown in SEQ ID NO:7, the mutation site is located at the 201st position, and its mutation type is T>G.

[0041] The sequences of the upstream and downstream primer pairs of SNP chr12_6206162 are: SNP chr12_6206162-F:5'-GTACCTGTTCCACTGTGA-3' (SEQ ID NO1); SNP chr12_6206162-R:5'-ATTCCGTTCAAGTCTATG-3' (SEQ ID NO2).

[0042] The total volume of PCR amplification was 25 μL, and the specific reaction system was shown in Table 1.

[0043] Table 1 PCR reaction procedure The specific amplification procedure is shown in Table 2: Table 2 PCR amplification reaction program The molecular marker sequence is shown in SEQ ID NO:7, Chr12:6206162 A>G is located at the 151st position of the gene fragment SEQID NO:7, and the mutation type is A / G.

[0044] AATATGAGAAAGTATGTGTGATT GTACCTGTTCCACTGTGA GTGGAGAGCAGATCTCTTCTCCTCTGAGGATCATGGAACGCTGGGTTAGAACCTCAGACAACTGAAAACTGTCCAGACCCAGGAGCTCACTCACATTAGTGACAACTGC A GAAAAACAGAGAAGAGACTTACTAACAAACACATATTAGCAGTGCTGTGTAGATTACTTATGAACTGTTCTCCATTACTGATTATAAATTACATGACAATAATTGTAACAATCTGGATTACACAAATTAGGTCATGTAGTCTGACTACTTTTAGATTACTTTTGACCTAACTCATTCATCA CATAGACTTGAACGGAAT TAT (SEQ ID NO: 7, wherein the bold underline indicates the mutation site, and the underline indicates the upstream and downstream primers).

[0045] 2 μL of the reaction product was subjected to 1% agarose gel electrophoresis, and qualified samples were used for subsequent sequencing to determine the genotype of each sample at SNP chr12:6206162.

[0046] The genotype of each individual was obtained through one generation of Sanger sequencing, and the weight data of individuals with different genotypes were statistically analyzed. Figure 2 B shows the results of experimental verification of SNP chr12:6206162. Figure 2 B shows that there are significant differences in body weight between individuals with different genotypes of Yellow River carp SNPchrchr12:6206162; among them, the body weight of individuals carrying the GG genotype is higher than that of individuals carrying the genotypes AG and AA.

[0047] The verification method of SNP chr23_15000329 G / T is the same as above, and the upstream and downstream primers used are: SNP chr23_15000329-F:5'-TGTCCACCAGTCACCAAC-3' (SEQ ID NO3); SNP chr23_15000329-R:5'-AACCTCCTGACCACAAACT-3' (SEQ ID NO4).

[0048] The gene fragment containing SNP chr23_15000329 was obtained as shown in SEQ ID NO: 8, the mutation site was located at position 126, and the mutation type was T / G.

[0049] GGGGCTCCATCAGACACC TGTCCACCAGTCACCAAC ATAGACTACATGGGACCTCCTATAATAACATTCTCTTTGAAACCCTACAAAGCAATATATCTTCTCTCAAGGTGAGTTCGTACATTTTA G AATATATTTTTGAAAAAAGAATTGGCGTGATACTCTCTACTTGGAGGTACTTGTAGCATAACAAAATATGTTAATAAAAATAATTTTTTGTGTATACACTACTGTTCAAA AGTTTGTGGTCAGGAGGTT TTTTGAAAT (SEQ ID NO: 8, wherein the bold underline indicates the mutation site, and the underline indicates the upstream and downstream primers).

[0050] Figure 3 B shows the results of experimental validation of SNP chr23_15000329. Figure 3 B shows that there are significant differences in body weight between individuals with different genotypes of Yellow River carp SNPchr23_15000329; among them, the body weight of individuals carrying the TT genotype is higher than that of individuals carrying the genotypes GT and GG.

[0051] The verification method of SNP chr32_490045 C / T is the same as above, and the upstream and downstream primers used are: SNP chr32_490045-F:5'-AGGGACGATGTAACCACT-3' (SEQ ID NO5); SNP chr32_490045-R:5'-GTAAGTTTGAATCTTGGAAT-3' (SEQ ID NO6).

[0052] The gene fragment containing SNP chr32_490045 was obtained as shown in SEQ ID NO: 9, the mutation site is located at the 200th position, and the mutation type is C / T.

[0053] GCAAAC AGGGACGATGTAACCACT GAATCAGAGATTTTAAATGAATTCAACTGAATTCAACTAATCAAATTAATATTGAGAAAAGGCACCAACTATCGCTTTTTATATTTAACAACATGAATCTAATAATTATAGAAGCTTATTTCTGCTACAAAAAAAAAAAAAAAAAATCAATAATAATGTATCTCTCACAATT C TCACCCTGAAATTGCAACTTTCTAGAATTGTTACACACTTGTGACTACAACTGTATGAAAAAAGTTGCAATTACCTTTTTTATTTGTTTAATTTCTGCGAGACAAATATACAGA ATTCCAAGATTCAAACTTAC TATTACGAGTTCATA (SEQ ID NO: 9, wherein the bold underline indicates the mutation site, and the underline indicates the upstream and downstream primers).

[0054] Figure 4 B shows the results of experimental validation of SNP chr32_490045. Figure 4 B shows that there are significant differences in body weight between individuals with different genotypes of Yellow River carp SNPchr32_490045; among them, the body weight of individuals carrying the CC genotype is higher than that of individuals carrying the genotypes CT and TT.

[0055] In summary, this example screened out three SNP markers (SNP chr12_6206162, SNP ch23_15000329 and SNP chr32_490045) that were significantly associated with the growth traits of Yellow River carp, and their genotypes could be determined by a pair of primers, respectively. The operation was simple and reliable. These three SNP loci have application prospects in molecular marker-assisted breeding and genomic selection breeding of Yellow River carp.

[0056] Although the present invention has been described in detail above by means of general description, specific implementation methods and tests, it is obvious to those skilled in the art that some modifications or improvements may be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0057] The number of devices and processing scales described here are used to simplify the description of the present invention. Applications, modifications and variations of the present invention will be obvious to those skilled in the art.

[0058] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A SNP molecular marker associated with the rapid growth trait of Yellow River carp, characterized in that: The SNP molecular markers are as shown in 1), 2) or 3) below: 1) Located at position 6206162 of chromosome 12 of Yellow River carp, the polymorphic base is A / G, 2) Located at position 15000329 of chromosome 23 of Yellow River carp, the polymorphic base is G / T, 3) Located at position 490045 of chromosome 32 of Yellow River carp, the polymorphic base is C / T; The growth trait is the body weight of the individual; The amplification primers of SNP molecular markers related to the rapid growth trait of Yellow River carp include primer pairs capable of detecting one or more of three SNP molecular markers; the amplification primers include: A pair of primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, A pair of primers as shown in SEQ ID NO:3 and SEQ ID NO:4, and / or, A pair of primers as shown in SEQ ID NO:5 and SEQ ID NO:

6.

2. A method for breeding Yellow River carp with fast growth traits, characterized in that: The steps include: Step 1: extracting the fin ray DNA of the Yellow River carp to be tested; Step 2: using the genomic DNA in step 1 as a template, performing PCR amplification using a pair of primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4, and a pair of primers as shown in SEQ ID NO: 5 and SEQ ID NO: 6; Step 3: sequence and analyze the amplified product obtained in step 2 to determine the genotype of the SNP molecular marker of the Yellow River carp individual to be tested, and determine whether the Yellow River carp has the potential for rapid growth traits through genotype analysis.

3. The method for breeding Yellow River carp with fast growth traits as claimed in claim 2, characterized in that: In step three, when PCR amplification is performed using a pair of primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, the polymorphic base located at position 6206162 of chromosome 12 of the yellow river carp is detected, and the yellow river carp with a genotype of GG has the potential for rapid growth traits.

4. The method for breeding Yellow River carp with fast growth traits as claimed in claim 3, characterized in that: In step three, when PCR amplification is performed using a pair of primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4, the polymorphic base located at position 15000329 of chromosome 23 of yellow river carp is detected, and the yellow river carp with genotype TT has the potential for rapid growth traits.

5. The method for breeding Yellow River carp with fast growth traits as claimed in claim 4, characterized in that: In step three, when PCR amplification is performed using a pair of primers as shown in SEQ ID NO: 5 and SEQ ID NO: 6, the polymorphic base located at position 490045 of chromosome 32 of the yellow river carp is detected, and the yellow river carp with a genotype of CC has the potential for rapid growth traits.

6. A kit, characterized in that The kit contains amplification primers capable of detecting the SNP molecular markers associated with the growth traits of Yellow River carp as claimed in claim 1.

7. Use of the SNP molecular marker according to claim 1, the amplification primer or the kit according to claim 6 in breeding Yellow River carp with fast growth traits.

Images