KASP molecular marker for detecting radish bolting time character and detection method

Abstract

The invention relates to a KASP molecular marker for detecting a radish bolting time character and a detection method. The invention provides a composition for KASP, which comprises a first forward primer, a second forward primer, a third forward primer and a fourth forward primer, and the sequence of the first forward primer is shown as SEQ ID NO: 1; the sequence of the second forward primer is as shown in SEQ ID NO: 2; the sequence of the reverse primer is as shown in SEQ ID NO: 3. The invention also relates to a kit and an auxiliary breeding method.

Description

Technical Field

[0001] The present application relates to the field of assisted crop breeding, and in particular to molecular markers associated with radish bolting time. Background Art

[0002] Radish is a crop of the genus Raphanus in the family Cruciferae. It has a long history of cultivation in my country and is widely planted throughout the world. Bolting and flowering is the phenomenon in which cruciferous plants sprout stems from rosette leaves and produce buds and flowers. It is a critical period for the transition from vegetative growth to reproductive growth. Early bolting (early bolting) refers to the phenomenon of bolting and flowering before the fleshy roots of radish are mature. After bolting, radish will switch from vegetative growth to reproductive growth, and the nutrients accumulated in the fleshy roots will be transferred to the aboveground parts, resulting in a loose texture of the fleshy roots, which seriously affects yield, nutrition and commercial quality.

[0003] Premature bolting has become a problem in radish production. To solve this problem, predecessors have done a lot of research on optimizing cultivation measures and using cultivation resources for genetic improvement, but the most effective means is still to explore bolting-resistant resources, develop bolting-resistant molecular markers, and select bolting-resistant varieties through molecular-assisted breeding technology.

[0004] At present, reports on the development of molecular markers for radish bolting resistance traits are mainly limited to the study of cultivation resources. Some scholars adopted the BSA and GRA strategies to obtain 8 markers related to late bolting genes. Different studies designed two pairs of specific primers based on the FLC gene for the identification of bolting characteristics of radish germplasm materials. In addition, different scholars used AFLP molecular marker technology combined with the BSA method to obtain two AFLP markers linked to radish bolting resistance genes, and converted one of them into a SCAR marker with a genetic distance of 7.5cM. The current research results are still far from the application of molecular marker-assisted breeding for radish bolting resistance, such as the inability to achieve close linkage with the bolting time trait, so the developed molecular markers cannot be quickly and effectively applied to breeding practice.

[0005] Therefore, in the field of crop assisted breeding, there is a strong demand for developing molecular markers related to radish bolting time traits that can be used for assisted breeding. Summary of the invention

[0006] In order to overcome the problem of premature bolting during radish growth, the inventors discovered a major QTL site related to bolting time located on chromosome 2 of radish through QTL-seq technology and genetic map positioning, and further developed molecular markers closely linked to the site, thereby completing the present invention.

[0007] Accordingly, the present application provides a composition for competitive allele-specific PCR (kompetitive allele-specific PCR, KASP), comprising:

[0008] A first forward primer, the sequence of which is shown in SEQ ID NO: 1;

[0009] a second forward primer, the sequence of which is shown in SEQ ID NO: 2; and

[0010] A reverse primer, the sequence of which is shown in SEQ ID NO:3.

[0011] In a specific embodiment, the composition of the present invention is used to determine the bolting time trait of radish.

[0012] In addition, the present application provides a kit for determining the characteristics of radish bolting time, comprising:

[0013] A first forward primer, the sequence of which is shown in SEQ ID NO: 1;

[0014] a second forward primer, the sequence of which is shown in SEQ ID NO: 2; and

[0015] A reverse primer, the sequence of which is shown in SEQ ID NO:3.

[0016] In a specific embodiment, the kit of the present application is based on KASP technology.

[0017] In some embodiments, the kit of the present application may further include one or more selected from the group consisting of: a KASP genotyping cocktail, a quencher, a negative control, and a positive control.

[0018] In an exemplary embodiment, the negative control and the positive control are fragments from radish chromosome 2, wherein the fragment comprises base 11188528 of radish chromosome 2, and the length of the fragment is 20-100 bases, for example, 30, 40, 50, 60, 70, 80, or 90 bases.

[0019] In addition, the present application provides a method for detecting the radish bolting time trait, comprising:

[0020] A KASP reaction is performed using a DNA sample of a radish to be tested, wherein the KASP reaction system comprises a first forward primer, a second forward primer and a reverse primer as defined in the composition of the present application;

[0021] Reading the reaction results; and

[0022] The radish bolting time characteristics are determined according to the reaction results.

[0023] Alternatively, the method for detecting the radish bolting time trait comprises:

[0024] Using the DNA of the radish to be tested as a sample, a KASP reaction is performed using the kit of the present application;

[0025] Reading the reaction results; and

[0026] The radish bolting time characteristics are determined according to the reaction results.

[0027] In some embodiments, reading the reaction results is achieved by reading fluorescence data.

[0028] In a specific embodiment, the judging step includes determining the type of SNP at the 11188528th base of chromosome 2 of radish through the reaction results; in the case of TT type, the detected radish is determined as a late bolting plant or an intermediate plant; in the case of AA type, the detected radish is determined as an early bolting plant; in the case of heterozygous type, the detected radish is determined as a late bolting plant or an intermediate plant.

[0029] In addition, the present application provides an assisted breeding method for late-bolting radish, which comprises using the composition or kit of the present application to perform KASP-based detection on radish samples.

[0030] In a specific embodiment, the method of the present application includes detecting the 11188528th base of radish chromosome 2, and selecting plants that are TT type and / or heterozygous at this position.

[0031] In the present application, the heterozygous type refers to the AT type or the TA type.

[0032] In addition, the present application provides a method for identifying the bolting time trait of radish, comprising using the composition or kit of the present invention to perform KASP-based detection on a radish sample.

[0033] In a specific embodiment, the method for identifying the bolting time trait of radish includes detecting the SNP type of the 11188528th base of chromosome 2 of radish, and determining the type of the SNP.

[0034] On the one hand, by extracting DNA from radish materials with unknown bolting time, and combining the KASP primer set of the present invention to perform a KASP molecular marker typing test, the bolting time of the radish can be predicted by the typing results of the markers, which can significantly improve the breeding efficiency and save the breeding cost. On the other hand, the typing results of the KASP molecular marker typing test performed by the KASP primer set of the present invention are closely linked to the trait, thereby improving the accuracy of predicting the bolting time of the radish. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A diagram showing the F2 generation planted in the field;

[0036] Figure 2 The QTL-seq mapping of radish bolting resistance is shown;

[0037] Figure 3 A diagram showing the location of QTLs mapped by genetic linkage analysis;

[0038] Figure 4 The results of predicting 91 F2 strains using the SNP at the 11188528th base of chromosome 2 based on KASP technology are shown. DETAILED DESCRIPTION

[0039] Example 1: Preparation of experimental materials

[0040] The F1 obtained by hybridization of the bolting-tolerant radish inbred line and the early bolting red-skinned cultivated radish inbred line was used as the research object, and the F2 segregating population of 236 plants was planted in the field ( Figure 1 ).

[0041] The F2 generation has segregated traits, with bolting times varying from early to late. Investigations have shown that this trait is a quantitative trait controlled by multiple genes, mainly a single gene. In the F2 generation, 40 extremely late bolting plants were selected as a late bolting pool, and 40 extremely early bolting plants were selected as an early bolting pool. DNA from extreme plants and parents was extracted using the modified CTAB method.

[0042] Example 2: Detection of QTL loci related to radish bolting time

[0043] The two parents and two pools were sequenced using Illumina HiSeqTM PE150, with the sequencing depth of the parents being 10× and the sequencing depth of the mixed pool being 30×.

[0044] The SNP-index was calculated using the extreme trait pool sequencing QTL-seq method. 1000 permutation tests were performed, and a 95% confidence level was selected as the screening threshold. A major QTL locus related to bolting time was detected on chromosome 2 of radish. The QTL-seq results are shown in Figure 2 The results of genetic linkage analysis are shown in Figure 3 The physical location of this site is in the 11.04-12.01Mb interval of chromosome 2.

[0045] Example 3: Linkage analysis of QTL loci related to radish bolting time and selection of SNP loci

[0046] A total of 12 pairs of primers for KASP markers were designed and screened in the above interval, and 260 randomly selected plants were amplified and the segregation of each marker was counted. JoinMap4.0 software was used for linkage analysis, and QTL prediction was performed in combination with the phenotype of F2 plants. It was detected that the QTL controlling the bolting time trait was located between R02_11.7 and R02_12.5, and the marker closest to the highest LOD value was R02_11.7 ( Figure 3 ). The corresponding physical positions of markers R02_11.7 and R02_12.5 are 11.7-12.5Mb on chromosome 2. Two genes homologous to bolting and flowering were identified near marker R02_11.7, namely CO and FY.

[0047] Example 4: Design of KASP primers and verification of their effectiveness in detecting radish bolting time traits

[0048] In the promoter region of the CO gene (chromosome 2, No. 11188528; corresponding genome version XYB36-2, NCBI accession number: GCA_002197605.1), 50 bp of base sequences upstream and downstream of the SNP site were extracted, and KASP marker primers were designed according to the primer design principles.

[0049] Its sequence information is:

[0050] Forward primer 1, F-1: TCATCGCAAGTACGGAGGAGTGTA (SEQ ID NO: 1)

[0051] Forward primer 2, F-2: TCATCGCAAGTACGGAGGAGTGTT (SEQ ID NO: 2) Reverse primer, R: CAGTTCAGACACAAACCTATTCCTTGG (SEQ ID NO: 3)

[0052] The IntelliQube platform of LGC was used to conduct SNP genotyping test based on KSAP technology on parents and different individual plants of F2 generation. The test was conducted with reference to the KASP test steps in the instruction manual.

[0053] 1. Dispense the DNA samples onto a 96-well PCR plate. Modulate the DNA samples to a uniform and appropriate concentration (5-10 ng / μl) and add them to a 96-well PCR plate. Add 2 negative controls (NTC) to each PCR plate.

[0054] 2. Prepare KASP genotyping mixture. Refer to 384-well array tape, where wet DNA:

[0055] 0.8μl, 2x KASP Master mix+Assay: 0.8μl, total reaction volume: 1.6μl.

[0056] 3. Add the KASP genotyping mixture to the array tape containing the DNA template. Use the IntelliQube SNP gene detection platform to compile a program, and place the 384 array tape, DNA sample plate, and KASP genotyping mixture into the machine in sequence. Operate the machine to execute the program, and automatically perform the process of dispensing the DNA sample dilution solution and the KASP genotyping mixture into the 384-well array tape and sealing the membrane.

[0057] 4. Perform PCR cycling reaction. PCR reaction can be performed in IntelliQube machine in SNPgenotyping inline mode (for single membrane) or in Hydrocycler in SNPgenotyping outline mode (for multiple membranes) for water bath PCR. The program settings are as follows: 1. Pre-denaturation: temperature 94℃, 15min, 1 cycle; 2. Denaturation: temperature 94℃, 20sec; Annealing / extension:

[0058] Temperature 61-55°C, 60sec (-0.6°C / cycle); step 2 10 cycles; 3. Denaturation: temperature 94°C, 20sec; annealing / extension: temperature 55°C, 60sec, step 3 26 cycles.

[0059] 5. Fluorescence data reading and analysis. After the PCR reaction is completed, the fluorescence data is read and analyzed using the IntelliQube machine. Fluorescence FAM excitation (nm) 485, emission (nm) 520; HEX excitation 535, emission 556, ROX excitation 575, emission 610.

[0060] 6. Add cycles. If the fluorescence signal of the data is low and the clusters are scattered, you can add cycles and then read the fluorescence. The conditions for adding cycles are as follows: denaturation: temperature 94°C, 20 seconds; annealing / extension: temperature 57°C, 60 seconds, and the number of cycles is 3.

[0061] Using this molecular marker to predict, 91 F2 strains were divided into three genotypes, of which 19 strains ( Figure 4 Medium blue) are AA type, all of which are early bolting plants, and their genotypes are consistent with the early bolting parents; 25 plants ( Figure 4 Medium orange) are TT type, all of which are late bolting or intermediate plants, and their genotypes are consistent with the late bolting parent; 47 plants ( Figure 4The genotype (medium purple) is TA / AT heterozygous, showing late bolting or intermediate type. Analysis showed that the three types of genotypes, TT type and TA / AT heterozygous individuals, were late bolting or intermediate type plants, and AA type was early bolting plants.

[0062] The prediction using this molecular marker showed that the bolting time of individuals with different genotypes was in line with expectations. The results are shown in Figure 4 (Gray / black is a blank control.) Therefore, it is proved that the SNP marker at the 11188528th base of chromosome 2 is closely linked to the radish bolting time trait and can be used to detect the difference in radish bolting time.

Claims

1. A composition for KASP, comprising: A first forward primer, the sequence of which is shown in SEQ ID NO: 1; A second forward primer, the sequence of which is shown in SEQ ID NO: 2; and A reverse primer, the sequence of which is shown in SEQ ID NO:

3.

2. The composition according to claim 1, wherein The composition is used for judging the bolting time trait of radish.

3. A kit for determining the timing of radish bolting, comprising: A first forward primer, the sequence of which is shown in SEQ ID NO: 1; A second forward primer, the sequence of which is shown in SEQ ID NO: 2; and A reverse primer, the sequence of which is shown in SEQ ID NO:

3.

4. The kit according to claim 3, wherein The kit is based on KASP technology.

5. The kit according to claim 3 or 4, wherein The kit further comprises one or more selected from the group consisting of: a KASP genotyping cocktail, a quencher, a negative control, and a positive control, and The negative control and the positive control are fragments from radish chromosome 2, the fragments contain the 11188528th base of radish chromosome 2, and the length of the fragments is 20-100 bases.

6. A method for detecting the timing of radish bolting, comprising: Using a DNA sample of the radish to be tested to perform a KASP reaction, wherein the KASP reaction system comprises a first forward primer, a second forward primer and a reverse primer as defined in claim 1; Reading the reaction results; and The radish bolting time characteristics are determined according to the reaction results.

7. A method for detecting the timing of radish bolting, comprising: Using the DNA of the radish to be tested as a sample, and using the kit according to any one of claims 3 to 5 to perform a KASP reaction; Read the reaction results; as well as The radish bolting time characteristics are determined according to the reaction results.

8. The method according to claim 6 or 7, wherein The judging step includes determining the type of SNP at the 11188528th base of chromosome 2 of radish through the reaction results; in the case of TT type, determining the tested radish as a late-bolting plant or an intermediate plant; in the case of AA type, determining the tested radish as an early-bolting plant; in the case of heterozygous type, determining the tested radish as a late-bolting plant or an intermediate plant.

9. An assisted breeding method for late-bolting radish, the method comprising using the composition of claim 1 or 2 or the kit of any one of claims 3 to 5 to perform KASP-based detection on radish samples.

10. The assisted breeding method according to claim 8, further comprising detecting the 11188528th base of radish chromosome 2, and selecting plants that are TT type and / or heterozygous at this position.

Images