SERS-ecl dual-mode biosensor for detecting lipopolysaccharide
By combining the SERS-ECL dual-mode biosensor with rolling circle amplification technology and DNA etching, the problem of low accuracy of single-mode sensors is solved, achieving highly sensitive detection of lipopolysaccharides with a wide detection range and high sensitivity.
Patent Information
- Application Number
- CN202411788374.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2044-12-06
AI Technical Summary
Existing single-mode biosensors have low accuracy in detecting lipopolysaccharide (LPS), making it difficult to effectively correct for human or environmental errors. Furthermore, antibody extraction is time-consuming and labor-intensive, and the quality is unstable between batches.
The SERS-ECL dual-mode biosensor was used to prepare Au@Ag NC nanocubes modified with Raman dyes. Combined with rolling circle amplification technology, the signal was amplified by utilizing the specific binding of lipopolysaccharide aptamer and probe N. Signal complementarity was achieved through DNA etching and AgNC generation to construct a highly sensitive detection system.
It achieves highly sensitive detection of lipopolysaccharide with a wide detection range of 1 fg/mL to 1 ng/mL. The detection limits for SERS and ECL are 0.2915 fg/mL and 0.1433 fg/mL, respectively, which improves detection accuracy and sensitivity and is suitable for rapid detection of early infection samples.
Smart Images

Figure CN119534839B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioanalytical detection technology, specifically to the SERS-ECL dual-mode biosensor and its application in the preparation of a detection system for lipopolysaccharide (LPS). Background Technology
[0002] Pathogenic bacterial infections and related foodborne illnesses constitute a significant public health problem worldwide. Detection and identification of these bacterial pathogens are crucial for treatment planning and the establishment of appropriate control measures. Gram-negative bacteria are commonly found in the environment. Over the years, the early and effective identification and differentiation of them from Gram-positive or other types of microorganisms has received increasing attention.
[0003] Lipopolysaccharide (LPS) is a major component of the outer membrane of Gram-negative bacteria and a primary target of the innate immune system. The recognition of LPS by macrophages, granulocytes, and dendritic cells, and the subsequent triggering and activation of intracellular signaling cascades, are key factors in activating early innate host defenses against Gram-negative bacterial invasion. Because LPS represents a unique pathogen-associated molecular pattern on Gram-negative bacteria, it has the potential to serve as a target biomarker for Gram-negative bacteria identification.
[0004] In recent years, numerous LPS detection methods have been developed. However, compared to single-mode output biosensors, dual-mode biosensors are increasingly attracting researchers' attention and favor. This is because the two detection systems have independent signal transduction channels, which can correct for errors caused by human factors or external environments, thus improving the sensor's accuracy. Among the many dual-mode detection methods, SERS is often chosen as one of the dual-mode sensors due to its excellent sensitivity and response speed. In recent years, ECL, as an emerging optical analysis tool, has also attracted research interest in biosensors. Summary of the Invention
[0005] The purpose of this invention is to achieve sensitive detection of lipopolysaccharide (LPS) using two complementary modes, SERS and ECL. This invention designs a detection strategy based on bifunctional nucleic acid chains acting on Au@AgNC, constructing a SERS-ECL dual-mode system for LPS detection. Specifically, this invention adopts the following technical solution:
[0006] The present invention discloses a SERS-ECL dual-mode biosensor for detecting lipopolysaccharides, which is prepared by the following method:
[0007] (1) Preparation of Au@Ag NC nanocubes modified with Raman dyes;
[0008] (2) A circular template was prepared using the template strand and primer strand under the action of T4 ligase, exonuclease I (EXOI) and exonuclease III (EXOIII);
[0009] (3) HP hairpins were modified onto the electrode surface and MCH was added to prevent nonspecific binding;
[0010] (4) Anneal and incubate the lipopolysaccharide aptamer LBA with probe N, then incubate it with lipopolysaccharide to release probe N, and then add Phi29 enzyme, dNTP, and Mg. 2+ The circular template from step (2) is incubated on the electrode to perform rolling circle amplification;
[0011] (5) Add Au@Ag NC nanocubes modified with Raman dye obtained in step (1) to the electrode and etch.
[0012] For the SERS-ECL dual-mode biosensor described above, preferably, in step (1), gold nanoparticles AuNPs are prepared first, and then Au@Ag NC nanocubes are prepared, which are silver-coated gold nanostructures.
[0013] For the SERS-ECL dual-mode biosensor described above, preferably, in step (2), the template strand and primer strand are annealed and combined at 85-95°C and cooled to room temperature before the enzyme is added.
[0014] For the SERS-ECL dual-mode biosensor described above, preferably, step (3) of modifying the electrode surface with hairpin HP involves placing the hairpin HP on the electrode and incubating it. The electrode is first deposited with gold, and then the hairpin is modified. This is the usual practice for hairpin modification. The principle is generally based on the combination of gold and sulfur bonds, which allows the hairpin HP containing thiol groups to be modified onto the gold-deposited electrode.
[0015] For the SERS-ECL dual-mode biosensor described above, preferably, after releasing probe N in step (4), the superfiltration tube is centrifuged to obtain the supernatant.
[0016] As a more preferred technical solution, the SERS-ECL dual-mode biosensor of the present invention can be prepared by the following method:
[0017] (1) Synthesis of Au@Ag NC nanocubes: First, NaBH4 was added to an aqueous solution of HAuCl4 and CTAC to obtain Au seeds; then, Au NPs were obtained by mixing Au seeds with HAuCl4, CTAC (hexadecyltrimethylammonium chloride), and AA (ascorbic acid) solution; Au NPs were obtained by mixing AuNPs with AgNO3 solution and CTAC solution, and then excess AA was added to obtain Au@Ag NC nanocubes; then, Raman dye 4-NTP (4-nitrobenzenethiophenol) was added to obtain Au@Ag NC nanocubes modified with Raman dye;
[0018] (2) Formation of a circular template in the ep tube: Combine (10 μL, 10 μM) template strand with (10 μL, 10 μM) primer strand and 10 mg Mmg. 2+ Anneal at 90°C for 10 min and cool to room temperature, then add 0.2 U of T4 ligase and react overnight at 16°C. Next, add 0.2 U of exonuclease I and 0.2 U of exonuclease III to cleave unreacted DNA strands and reaction byproducts. Finally, inactivate the enzymes at 65°C for 20 min. It is best to store the resulting circular template in a 4°C refrigerator.
[0019] (3) Place the electrode in HAuCl4 electrolyte for electrochemical deposition for 60 seconds and let it dry. Then add (10 μL 3 μM) hairpin HP to the electrode and incubate for 4-6 hours. Then add 1 mM MCH and incubate for 30 minutes to prevent non-specific binding.
[0020] (4) Mix (10 μL, 10 μM) lipopolysaccharide aptamer LBA with (10 μL, 10 μM) probe N in 10 mM Mg 2+ Incubate at 37°C for 3 hours under the influence of [unspecified agent], then incubate with 20 μL of lipopolysaccharide at 37°C for 1 hour. After centrifugation using an ultrafiltration tube, collect the supernatant and add 0.01 U of Phi29 enzyme, 0.02 mM of dNTPs, and 10 mM of Mg [unspecified ingredient]. 2+ (10 μL, 10 nM) Step (2) circular template, perform rolling circle amplification reaction at 37℃ for 1 h in ep tube, after the reaction is completed, place ep tube at 65℃ for 15 min to inactivate enzyme;
[0021] (5) Add 10 μL of Au@Ag NC modified with Raman dye, etch at room temperature in the dark for 4-6 h, and observe that the solution changes from orange to light pink.
[0022] For the SERS-ECL dual-mode biosensor described above, preferably, the synthesis of Au@Ag NC in step (1) can be carried out according to the literature method, which can be divided into three steps: The first step is the preparation of gold nanoparticles encapsulated with CTAC. First, 0.6 mL of ice-cold NaBH4 is added to 10 mL of aqueous solution of HAuCl4 (0.25 mM) and CTAC (100 mM) to obtain 3 nm Au seeds. Then, the Au seeds are aged at 27 °C for 3 h to ensure that NaBH4 is completely dispersed, thereby generating Au seeds covered by CTAC. The second step is the growth of gold seeds. HAuCl4 (6 mL, 0.5 mM), CTAC (6 mL, 200 mM), and AA (4.5 mL, 100 mM) are added to (3 mL, 3 nm) Au seeds and mixed to obtain larger AuNPs. Finally, the product is centrifuged at 14500 rpm for 30 min and washed with water. The third step is the preparation of Au@Ag nanocubes. A certain amount of AgNO3 (10mM) solution and CTAC (40mM) solution are mixed at a volume ratio of 1:1 and added to the grown AuNPs. The temperature is raised to 60℃, and then excess AA is added. The mixture is stirred at 60℃ for 4 hours to obtain Au@AgNC. After centrifugation and washing, the mixture is finally dispersed in 10mL of CTAC solution.
[0023] Additionally, in step (1), the Raman dye 4-NTP was used at 10 -4 M is preferred. At the same time, combine Au@Ag NC with 10 -4 M was stirred overnight at room temperature with 4-NTP to modify the Raman dye. Finally, excess dye was washed off and the product was stored at 4°C for later use.
[0024] Furthermore, this invention also provides the application of the aforementioned SERS-ECL dual-mode biosensor in the detection of lipopolysaccharides. Preferably, SERS detection is performed using a 785nm laser with a laser intensity of 10%, three scans, and a scan time of 10s. On the other hand, ECL detection involves adding 6μL of 100μM AgNO3 to the electrode and incubating in the dark for 30min, followed by adding 6μL of 100μM NaBH4 and reducing in the dark for 2h, and finally performing a scan measurement at 800V in 0.05mM K2S2O8, with a scan range of -1.6V to 0V.
[0025] Preferably, in the SERS-ECL dual-mode biosensor described above, the aptamer that binds to lipopolysaccharide in step (4) is filtered by an ultrafiltration tube with a pore size of 10 kDa.
[0026] The template and primer strands described above were designed independently and are SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing, respectively, with the sequences as follows:
[0027] Template chain:
[0028] 5'-AAAGGGTCTAGGGGGGGGGGGGGGGATATAAAGGGTCGGGGTT-3'
[0029] Primer chain:
[0030] 5'-TAGACCCTTTAACCCCGACC-3'
[0031] The hair clip was designed by HP and is SEQ ID No. 3 in the sequence list, with the following sequence:
[0032] 5'-CAGATGATATAAAGGGTCAGTGTGTGCTGACCCTTTATAT-3'
[0033] References Analytical Biochemistry 424 (2012) 12–20 were used to screen lipopolysaccharide-related aptamers for analysis. These aptamers were synthesized by Shanghai Bioengineering Co., Ltd. The lipopolysaccharide aptamer LBA is SEQ ID No. 4 in the sequence listing, and its sequence is as follows:
[0034] 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT -3'.
[0035] Probe N has a self-designed sequence, which is SEQ ID No. 5 in the sequence listing, and the sequence is as follows:
[0036] 5'- CTGACCCTTTATATCATCTGG -3'
[0037] Alternatively, as another implementation, the SERS-ECL dual-mode biosensor of the present invention can be prepared by the following method:
[0038] (1) Polish the electrode with alumina paste, rinse it thoroughly with ultrapure water, and sonicate it in ethanol and water, then dry it at room temperature;
[0039] (2) Place the electrode in the electrolyte (25mM HAuCl4), perform electrochemical deposition for 60s, and then add 10μL of 3μM hairpin HP to the electrode and incubate for 4h-6h.
[0040] (3) Add 1 mM MCH and incubate for half an hour;
[0041] (4) Place 10 μL of probe N released by different concentrations of lipopolysaccharide on the electrode and incubate for 3 h;
[0042] (5) Add 10 nM circular template, 0.01 U Phi29 DNA polymerase, 0.02 mM dNTPs (deoxyribonucleoside triphosphates), and 10 mM Mg... 2+ A total of 10 μL was dropped onto the electrode surface and incubated for 1 h.
[0043] (6) 10 μL of Au@AgNC modified with Raman dye was dropped onto the electrode surface and etched in the dark for 4 h. Finally, SERS measurements were performed. A 785 nm laser was used with a laser intensity of 10%, 3 scans were performed, and the scan time was 10 s.
[0044] (7) Add 6 μL of 100 μM AgNO3 to the electrode and incubate in the dark for 30 min, then add 6 μL of 100 μM NaBH4 and reduce in the dark for 2 h. Finally, perform a scanning measurement in 0.05 mM K2S2O8 at 800 V, with a scanning range of -1.6 V to 0 V.
[0045] In this invention, due to the use of rolling circle amplification of nucleic acid, a strong signal output can be achieved with a small amount of lipopolysaccharide, which is beneficial for the rapid detection of samples in the early stage of infection.
[0046] The principle of this invention is analyzed as follows:
[0047] 1. Detection of lipopolysaccharides using lipopolysaccharide aptamers.
[0048] Antigen-antibody specific binding is the most widely used method, but extracting antibodies from animals is time-consuming and labor-intensive, and the quality between batches is difficult to guarantee. Compared with antibodies, aptamers offer attractive options for ultra-trace capacitive sensing capture molecules due to their small size, relative molecular stability under various analytical conditions, high affinity and specificity for the target, and ability to maintain activity under field-deployable conditions. Utilizing the released probe N to initiate rolling circle amplification not only amplifies the reaction, but the amplified cytosine can also serve as an etchant for Au@AgNC to reduce the SERS signal and as a template for AgNC generation to increase the ECL signal, thus realizing a biosensor with complementary modes.
[0049] 2. Basis for the formation of circular templates
[0050] To achieve the synthesis of the circular template, 18 paired bases were designed in the padlock strand (template strand) and primer strand. Under the action of T4 ligase, the phosphate group at the 5' end of the padlock strand and the hydroxyl group at the 3' end form a phosphodiester bond. Exonuclease III and exonuclease I were then introduced. Exonuclease III acts on the paired portion of the primer and padlock strands, progressively removing bases along the 3'-5' direction until the primer strand is completely cleaved. Exonuclease I degrades unreacted DNA single strands along the 3'-5' direction. For the starting rolling circle sequence on the hairpin probe, the design aimed to avoid the loop opening directly in the absence of target material, while also ensuring that the sequence on the loop met the requirements for etching and supporting silver clusters, preventing background interference while improving assembly efficiency.
[0051] 3. Au@AgNC etching basis
[0052] DNA, with its extensive surface interactions and excellent programmability, has been widely used to guide the growth and assembly of nanoparticles. DNA can be used as an etchant to precisely modulate the morphology and optical properties of plasmonic nanoparticles. Specifically, polycytosine-rich DNA, acting as an anchor, can be used to etch silver nanoparticles (AgNPs) in a highly controllable manner and as a template for the synthesis of silver nanoclusters. According to previous reports, the affinity of AgNPs for nucleobases ranges from cytosine (C) to guanine (G) to adenine (A) to thymine (T). When C-rich DNA is used as an etchant, the silver shell in Au@AgNC can be etched into silver nanoparticles, resulting in a gradual reduction in the size of the silver nanoparticles.
[0053] 4. Basis for AgNC in-situ reduction
[0054] Using DNA as a template for forming metal nanoclusters is quite common. This patent utilizes the ability of cytosine to interact with Ag. + Combine to form C-Ag + -C structure, under the action of reducing agent sodium borohydride, C-Ag + -C is reduced in situ to AgNC. This is achieved via G-rich sequences on the padlock strand, involving the phi29 enzyme, dNTPs, and Mg. 2+ Under catalytic action, according to the base pairing principle, C-rich sequences are formed on the rolling circle amplification strand. It is well known that cytosine and Ag... + It can specifically bind to form C-Ag + The -C structure is reduced in situ by sodium borohydride to form silver nanoclusters (AgNC). In the ECL reaction system, AgNC reacts directly with the co-reactant potassium persulfate (K₂S₂O₈) to produce AgNCs. −• and SO4 −• Then AgNCs −• SO4 −•Oxidation to generate AgNCs * And AgNCs * It is the excited state of AgNC. When the excited state transitions to the ground state, it releases light intensity, which is captured by the ECL instrument to generate an ECL signal. The entire ECL process is described as follows:
[0055] AgNCs + e - → AgNCs −• (1)
[0056] S2O8 2- + e - → SO4 2- + SO4 −• (2)
[0057] AgNCs −• + SO4 −• → AgNCs * + SO4 2- (3)
[0058] AgNCs * → AgNCs +hν (4)
[0059] This invention converts LPS signals into nucleic acid signals and simultaneously utilizes RCA to generate C-rich long chains of Ag that bind to the tip of Au@AgNC with high activity. + Detaching from the cube leads to passivation of the cube's endpoints, reduced electron transfer between the core and shell, fewer hot spots, and a decrease in the SERS signal; while the combined C-Ag... + The -C structure is then reduced in situ with NaBH4 to generate AgNC, which undergoes electron transfer under the action of a co-reactant, resulting in an increase in the ECL signal. Compared with single-mode sensors, the SERS-ECL dual-mode sensor enables self-calibration of the biosensor, improving detection accuracy. Furthermore, accurate LBA identification and rolling circle amplification enhance the detection sensitivity of LPS. This biosensing platform has a wide detection range from 1 fg / mL to 1 ng / mL, with detection limits of 0.2915 fg / mL for SERS and 0.1433 fg / mL for ECL.
[0060] This invention first expands the contact area of the biosensing platform by using electrochemically deposited thin layers of gold as a substrate, while reducing the use of gold nanoparticles. Second, it selects DNA as both an etchant and a template, leveraging the non-toxic and harmless nature of biomaterials to avoid the environmentally unfriendly characteristics of organic or inorganic reagents. Finally, through the etching effect of cytosine on Au@AgNC and the growth of AgNC using cytosine as a template, a SERS-ECL dual-mode biosensor with excellent stability and high sensitivity was successfully constructed. Attached Figure Description
[0061] Figure 1 A schematic diagram illustrating the principle of anisotropic morphological evolution of Au@Ag nanocubes mediated by DNA nanomachines for SERS-ECL biosensing in LPS detection.
[0062] Figure 2 To assess the feasibility of using polyacrylamide gel electrophoresis for nucleic acid analysis;
[0063] Figure 3 TEM images of Au@AgNC etched at different times, along with their UV and in-situ reduced AgNC images;
[0064] Figure 4 To optimize the etching time of Au@AgNC;
[0065] Figure 5 The graph shows the relationship between the concentration of lipopolysaccharide (LPS) and the intensity of SERS and ECL, as well as the linear relationship.
[0066] Figure 6 To evaluate the stability and specificity of this SERS-ECL dual-mode biosensor. Detailed Implementation
[0067] The following embodiments are further illustrations of the present invention and serve as explanations of the technical content of the present invention. However, the essence of the present invention is not limited to the embodiments described below. Those skilled in the art can and should know that any simple changes or substitutions based on the spirit of the present invention should fall within the protection scope claimed by the present invention.
[0068] Example 1
[0069] Circular template design and assembly.
[0070] First, (10 μL, 10 μM) of phosphate-modified template chain, (10 μL, 10 μM) of primer chain, and 10 mM Mg were prepared. 2+ The sample was placed in a 0.6 mL EP tube and annealed at 90 °C for 10 min. After slowly cooling to room temperature, 0.2 U of T4 ligase was added, and the reaction was incubated overnight at 16 °C. Under the action of T4 ligase, the phosphate group at the 5' end of the template strand and the hydroxyl group at the 3' end formed a phosphodiester bond, resulting in cyclization. The EP tube was then placed at 65 °C for 15 min to inactivate the T4 ligase. Finally, 0.2 U of EXOI and 0.2 U of EXOIII were added to the EP tube, and the mixture was incubated at 37 °C for 3 h to remove unreacted template or primer strands. The temperature was then increased to 65 °C and incubated for 20 min to inactivate EXOI and EXOIII.
[0071] Design and synthesis of RCA reactions.
[0072] A short binding probe N was designed based on the LPS aptamer sequence designed in the literature. This binding strand must not only bind tightly to the LPS aptamer chain and be completely released in the presence of LPS, but also be able to trigger the next-stage hairpin reaction. (10 μL, 10 μM) of the lipopolysaccharide aptamer LBA and (10 μL, 10 μM) of probe N were reacted in 10 mM Mg... 2+ Under the influence of the agent, the mixture was incubated at 37°C for 3 hours, and then the conjugate of LBA-N (20 μL, different concentrations) with LPS (1 μM, 40 μL) was incubated at 37°C for 1 hour to release the probe N.
[0073] First, the GCE electrode was polished with alumina paste. Then, the GCE was thoroughly rinsed with ultrapure water and sonicated in ethanol and water, followed by drying and cleaning at room temperature. The GCE electrode was electrochemically deposited in electrolyte (25 mM HAuCl4) for 60 seconds and allowed to dry. Then, (10 μL) of hairpin HP was added to the electrode and incubated for 6 hours. The solution on the electrode was removed, and 1 mM MCH was added for incubation for half an hour to prevent non-specific binding. After removing the solution from the electrode, probe N released from lipopolysaccharide at different concentrations was added, and incubation was carried out at 37°C for 3 hours. After removing the solution from the electrode, (10 μL, 10 nM) of circular template, 0.01 U of Phi29 enzyme, 0.02 mM of dNTP, and 10 mM Mg were added to the electrode. 2+ Rolling ring amplification was performed at 37°C for 1 hour. Finally, 10 μL of Au@AgNC modified with Raman dye 4-NTP was added to the electrode, and the electrode was etched in the dark at room temperature for 4 hours. The Raman signal was measured at 10% laser intensity, with 3 scans and a scan time of 10 seconds, for SERS detection.
[0074] ECL detection involves adding (7 μL, 100 μM) AgNO3 to the etched electrode and storing it in the dark at 4°C for 30 minutes to form C-Ag. + -C structure. Next, (7 μL, 100 μM) NaBH4 solution was added, and AgNC was formed under dark conditions. Finally, the electrode was placed in 0.05 M K2S2O8 in (0.1 M, pH=7) PBS electrolyte, and ECL measurements were performed on the electrode under an 800 V photomultiplier tube within a scan range of -1.6 V to 0 V.
[0075] like Figure 2 The image shows the analysis of DNA structure using polyacrylamide gel electrophoresis (PAGE).
[0076] Figure 2Middle: 10% PAGE analysis of RCA. Channel 1, aptamer strand LBA; Channel 2, release strand N; Channel 3, hairpin HP; Channel 4, template strand; Channel 5, primer strand; Channel 6, template strand + primer strand + T4; Channel 7, template strand + primer strand + T4 + EXOIII + EXOI (circular template); Channel 8, LBA + N; Channel 9, N + HP; Channel 10, HP + circular template; Channel 11, N + HP + circular template; Channel 12, RCA.
[0077] like Figure 2 The appearance of a band in well 7 with a slower migration rate than wells 1 and 2 indicates that the hairpin HP was opened by probe N. The migration rate of the band in well 5 was lower than that in wells 3 and 4, indicating that the template and primer strands bound under the action of T4 ligase. The migration rate of the band in well 6 was faster than that in well 5, indicating that exonuclease III and exonuclease I successfully cleaved the primer strand. The appearance of a new band in well 8 confirms the successful binding of N, HP, and the circular template. Well 9 shows that no new band will be generated without the presence of the LPS-releasing strand. The formation of a large molecular weight DNA strand above well 10 indicates that the reaction proceeds normally.
[0078] like Figure 3 The images shown are TEM images of Au@AgNC etched at different times. The TEM images show that C-rich DNA can significantly etch Au@AgNC. The formation of the silver layer of DNA-guided Au@AgNC depends on cytosine and Ag. + Specific interactions between them. An Ag on the Au@AgNC surface + It can bind to multiple cytosines in C-rich DNA to form C-Ag + - C mismatch induces DNA bending. Due to the decrease in structural degrees of freedom, the bent DNA generates stress, forcing the bound Ag to... + Released from Au@AgNC, thus initiating DNA-directed etching. Therefore, etching of Au@AgNC begins at the corners and then at the edges. Where (A) 0h, (B) 4h, (8)h, (D) 12h, (E) AgNC, (F) are UV values corresponding to different etching times.
[0079] like Figure 4 The figure shows the optimized etching time for Au@AgNC. To investigate the moment with the highest etching efficiency, probe N released from the same concentration of lipopolysaccharide was added to the electrode to trigger rolling circle amplification. The SERS signal was measured every 2 hours. Based on the slope of each point and the detection time, we selected 4 hours as the SERS signal detection time.
[0080] like Figure 5The graphs show the relationship between LPS concentration and SERS and ECL intensities, as well as their linear relationships. Adding LPS at concentrations ranging from 1 fg / mL to 1 ng / mL significantly reduces SERS intensity and enhances ECL intensity, resulting in a linear relationship between SERS and ECL intensities and the logarithm of LPS concentration. (A) ECL spectrum versus LPS concentration spectrum, (B) Linear relationship corresponding to ECL, (C) SERS spectrum versus LPS concentration spectrum, (D) Linear relationship corresponding to SERS.
[0081] like Figure 6 The stability and specificity of the SERS-ECL dual-mode biosensor were evaluated. SERS intensities at 15 randomly selected points were measured, and the relative standard deviation (RSD) of the sensing platform was 1.9%. Stability was measured by scanning the same electrode for 20 cycles, with an RSD of 1.58%. Specificity was evaluated by comparing 1 ng / mL LPS with 10 ng / mL ascorbic acid, leucine, alanine, and glucose. The results showed that even in the presence of interfering substances, the SERS-ECL dual-mode nucleic acid sensor remained sensitive for LPS detection.
[0082] It should be noted that the above-described technical content of this invention is merely an explanation and clarification to enable those skilled in the art to understand the technical essence of this invention, and therefore is not intended to limit the scope of protection of this invention. The scope of protection of this invention should be determined by the claims. Those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made based on the essential spirit of this invention should be within the scope of protection of this invention.
Claims
1. A SERS-ECL dual-mode biosensor for detecting lipopolysaccharides, prepared by the following method: (1) Preparation of Au@Ag NC nanocubes modified with Raman dyes; the Au@Ag NC nanocubes were synthesized by the following method: first, NaBH4 was added to an aqueous solution of HAuCl4 and CTAC to obtain Au seeds; then, HAuCl4, CTAC, and AA solutions were mixed with the Au seeds to obtain AuNPs; AgNO3 solution and CTAC solution were mixed with the AuNPs, and then excess AA was added to mix and obtain Au@AgNC nanocubes; then, Raman dye 4-NTP was added to obtain Au@Ag NC nanocubes modified with Raman dyes. (2) A circular template was prepared using the template strand and primer strand under the action of T4 ligase, exonuclease I and exonuclease III; (3) HP hairpins were modified onto the electrode surface and MCH was added to prevent nonspecific binding; (4) First, anneal the lipopolysaccharide aptamer LBA and probe N, then incubate them together with lipopolysaccharide to release probe N, then place them on the electrode for incubation, and then add Phi29 enzyme, dNTP, and Mg. 2+ And step (2) the circular template is incubated on the electrode; (5) Add Au@Ag NC nanocubes modified with Raman dye obtained in step (1) to the electrode and etch.
2. The SERS-ECL dual-mode biosensor as described in claim 1, characterized in that, Step (1) First, prepare gold nanoparticles AuNPs, and then prepare Au@AgNC nanocubes.
3. The SERS-ECL dual-mode biosensor as described in claim 1, characterized in that, Step (2) Anneal the template strand and primer strand at 85-95℃.
4. The SERS-ECL dual-mode biosensor as described in claim 1, characterized in that, Step (3) involves applying the hair clip HP to the electrode surface by placing the hair clip HP on the electrode for incubation.
5. The SERS-ECL dual-mode biosensor as described in claim 1, characterized in that, Step (4) After releasing probe N, centrifuge the ultrafiltration tube to obtain the supernatant.
6. The SERS-ECL dual-mode biosensor as described in claim 1, characterized in that, It was prepared using the following method: (1) Synthesis of Au@Ag NC nanocubes: First, NaBH4 was added to an aqueous solution of HAuCl4 and CTAC to obtain Au seeds; then, Au NPs were obtained by mixing Au seeds with HAuCl4, CTAC and AA solutions; Au NPs were obtained by mixing AgNO3 solution and CTAC solution with AgNO3 solution and CTAC solution, and then excess AA was added to obtain Au@AgNC nanocubes; then Raman dye 4-NTP was added to obtain Au@Ag NC nanocubes modified with Raman dye. (2) Formation of a circular template in the ep tube: 10 μL of 10 μM template strand with 10 μL of 10 μM primer strand and 10 mM Mg 2+ After annealing at 90℃ for 10 min and cooling to room temperature, add 0.2 U of T4 ligase and react overnight at 16℃. Then add 0.2 U of exonuclease I and 0.2 U of exonuclease III to cleave unreacted DNA strands and reaction byproducts. Finally, inactivate the enzymes at 65℃ for 20 min. (3) Place the electrode in 25mM HAuCl4 electrolyte for electrochemical deposition for 60s and let it dry. Then add 10μL and 3μM hairpin HP to the electrode and incubate for 4h-6h. Then add 1mM MCH and incubate for 30min to prevent non-specific binding. (4) Mix 10 μL of 10 μM lipopolysaccharide aptamer LBA with 10 μL of 10 μM probe N in 10 mM Mg 2+ Incubate at 37°C for 3 hours under the influence of [unclear], then incubate with 20 μL of lipopolysaccharide at 37°C for 1 hour. After centrifugation using an ultrafiltration tube, collect the supernatant and add 0.01 U of Phi29 enzyme, 0.02 mM of dNTPs, and 10 mM of Mg [unclear]. 2+ With 10 μL and 10 nM of the circular template from step (2), perform a rolling circle amplification reaction at 37°C for 1 h in the ep tube. After the reaction, place the ep tube at 65°C for 15 min to inactivate the enzyme. (5) Add 10 μL of Raman dye-modified Au@Ag NC and etch at room temperature in the dark for 4-6 h.
7. The application of the SERS-ECL dual-mode biosensor according to any one of claims 1-6 in the preparation and detection of lipopolysaccharide products.
8. The application as described in claim 7, characterized in that, SERS detection was performed using a 785nm laser with a laser intensity of 10%, three scans, and a scan time of 10 seconds.
9. The application as described in claim 7, characterized in that, ECL detection was performed by adding 6 μL of 100 μM AgNO3 to the electrode and incubating in the dark for 30 min, followed by adding 6 μL of 100 μM NaBH4 and reducing in the dark for 2 h, and finally scanning and measuring at 800 V in 0.05 mM K2S2O8, with a scanning range of -1.6 V to 0 V.
Citation Information
Patent Citations
Surface-enhanced Raman scattering nano-label as well as preparation method and application thereof
CN117309840A
SERS (Surface Enhanced Raman Scattering) biosensor based on rolling circle amplification and application of SERS biosensor in lipopolysaccharide detection
CN118169103A