Synthetic priming enzyme-polymerases and uses thereof

Abstract

The present invention provides a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 or a variant thereof having at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. The invention also provides antibodies binding to the polypeptides, nucleic acid molecules encoding the polypeptides, methods of producing the polypeptides, methods of amplifying nucleic acids, methods of producing closed linear DNA, and kits comprising the polypeptides.

Description

[0001] CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the rights to European patent application EP22382615 filed on June 29, 2022. Technical Field

[0003] The present invention relates to the field of molecular biology. More specifically, it relates to a primase-polymerase (PrimPol) particularly suitable for priming the synthesis of amplified nucleic acid templates. Background Art

[0004] The introduction of in vitro nucleic acid amplification techniques has revolutionized the fields of biomedical research, disease diagnostics, and forensics. More recently, these techniques have also become essential tools for large-scale production of nucleic acids for therapeutic use, such as gene therapy products.

[0005] Unfortunately, in vitro nucleic acid amplification is a method that is subject to bias, defects, and the co-amplification effects of residual levels of contaminating nucleic acids. The main source of potential amplification problems in current methods arises from the use of primers. Primers are short oligonucleotides that provide the starting point required for DNA synthesis by DNA polymerase. However, primers have a strong tendency to produce primer-derived artifacts and often result in amplification inequalities caused by different sequence-dependent hybridization kinetics.

[0006] Not surprisingly, the development of amplification systems that do not rely on the use of primers has been the object of extensive research in recent years. Several primase-based methods have recently been developed to circumvent the problems derived from the use of oligonucleotide-based primers.

[0007] Primase-polymerases (PrimPols) are a class of enzymes that have been used in amplification methods due to their compatibility with high-processivity DNA polymerases, such as Phi29 polymerase. So far, most efforts have focused on identifying existing bacterial and archaeal PrimPols that could improve current amplification methods. However, the natural PrimPols identified so far have limited efficiency under industrial conditions, such as low pH or high temperature, which severely hinders their use in industrial settings.

[0008] Therefore, there is still a need in the art for improved PrimPol that can be used for efficient amplification of nucleic acids under industrial conditions. Summary of the invention

[0009] The present inventors have developed various synthetic primase-polymerases (PrimPols) that are particularly suitable for use in nucleic acid amplification methods.

[0010] As shown in the examples below, the synthetic PrimPol developed by the inventors surprisingly provides various advantages over natural PrimPol, making it particularly suitable for use in industrial processes. For example, synthetic PrimPol has a higher expression rate than natural PrimPol, and also provides higher nucleic acid amplification yields under certain conditions (e.g., lower pH and higher temperature) while maintaining very high sequence fidelity. Advantageously, the synthetic PrimPol provided herein is compatible with high processivity strand displacement DNA polymerases, which allows their combined use to produce very large amounts of high-quality nucleic acids.

[0011] All these unique features make the synthetic PrimPol of the present invention an important molecular tool for any application involving nucleic acid amplification, especially in industrial settings.

[0012] Therefore, in a first aspect, the present invention provides a polypeptide comprising a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 80% identity, particularly at least 90% identity, to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0013] In a second aspect, the present invention provides an antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0014] In a third aspect, the present invention provides a nucleic acid sequence encoding a polypeptide as defined in the first aspect, in particular, wherein the nucleic acid sequence is optimized for expression in a mammalian expression system or in a bacterial expression system.

[0015] In a fourth aspect, the present invention provides a gene construct comprising the nucleic acid sequence as defined in the third aspect operably linked to an expression promoter.

[0016] In a fifth aspect, the present invention provides an expression vector comprising the gene construct as defined in the fourth aspect.

[0017] In a sixth aspect, the present invention provides a host cell comprising the nucleic acid sequence as defined in the third aspect, the gene construct as defined in the fourth aspect, or the expression vector as defined in the fifth aspect.

[0018] In a seventh aspect, the present invention provides a method for producing a polypeptide as defined in the first aspect, the method comprising the following steps: a) culturing a host cell as defined in the sixth aspect under conditions suitable for producing the polypeptide; b) recovering the polypeptide; and optionally, c) purifying the polypeptide.

[0019] In an eighth aspect, the present invention provides a polypeptide obtainable by the method defined in the seventh aspect.

[0020] In a ninth aspect, the present invention provides a method for amplifying a nucleic acid, the method comprising the step of contacting the nucleic acid with a polypeptide as defined in the first aspect and optionally a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid.

[0021] In a tenth aspect, the present invention provides use of the polypeptide as defined in the first aspect for amplification, detection or sequencing of nucleic acid.

[0022] In an eleventh aspect, the present invention provides use of a polypeptide as defined in the first aspect in combination with a DNA polymerase, in particular a strand-displacing DNA polymerase, for amplification, detection or sequencing of nucleic acids.

[0023] In the twelfth aspect, the present invention provides a method for producing closed linear DNA, the method comprising the following steps: a) providing a DNA template comprising a target DNA sequence; b) amplifying DNA from the DNA template of step (a), wherein the amplification is initiated by a polypeptide as defined in the first aspect; c) producing closed linear DNA using the amplified DNA produced in step (b); and d) optionally purifying the produced closed linear DNA.

[0024] In a thirteenth aspect, the present invention provides use of the polypeptide as defined in the first aspect for producing closed linear DNA.

[0025] In a fourteenth aspect, the present invention provides a kit comprising: a) a polypeptide as defined in the first aspect; b) a DNA polymerase, in particular a strand-displacing DNA polymerase; and c) optionally instructions for use of the kit. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1In connection with Example 2, the expression rates of synthetic PrimPol and TthPrimPol are shown. The y-axis represents the amount of enzyme produced per liter of bacterial culture (mg) determined by absorbance measurement at 280 nm. "Tth" refers to TthPrimPol; "1" refers to PrimPol 1 of SEQ ID NO: 1; "2" refers to PrimPol 2 of SEQ ID NO: 4; "3" refers to PrimPol 3 of SEQ ID NO: 3; "4" refers to PrimPol 4 of SEQ ID NO: 2.

[0027] Figure 2 In connection with Example 3, the priming efficiency of synthetic PrimPol and TthPrimPol on circular ssDNA templates under different conditions is shown. The y-axis represents the total DNA concentration (ng) produced in the priming reaction using the indicated PrimPol. "Tth" refers to TthPrimPol, "1" refers to PrimPol 1 of SEQ ID NO: 1; "2" refers to PrimPol 2 of SEQ ID NO: 4; "3" refers to PrimPol 3 of SEQ ID NO: 3; "4" refers to PrimPol 4 of SEQ ID NO: 2.

[0028] Figure 3 Related to Example 4, a gapped plasmid extension assay based on the psJ4 plasmid is shown. A gapped plasmid with a gap in the 5'-3' strand (Nb) or the 3'-5' strand (Nt) is generated. When the gap is present, EcoRI is unable to completely cleave the plasmid, and when the gap is filled by the polymerase, EcoRI regains the ability to completely cleave the plasmid. The reaction uses 100 nM of the stated priming polymerase and 35 ng of the gapped plasmid, and is carried out at MgCl2. 2+ and dNTPs at 30°C for 30 minutes. The reaction product and the gapped plasmid substrate as a control were then digested with EcoRI at 37°C for 15 minutes and loaded into a 1% agarose gel. The presence of digested linear plasmid and the absence of gapped plasmid indicate that the priming polymerase is able to extend the gapped substrate. The upper arrow indicates the gapped and the lower arrow indicates the linear. "C" refers to the control, "Tth" refers to TthPrimPol, "1" refers to PrimPol 1 of SEQ ID NO: 1, "2" refers to PrimPol 2 of SEQ ID NO: 4, and "4" refers to PrimPol4 of SEQ ID NO: 2.

[0029] Figure 4In connection with Example 5, quantitative amplification of clDNA templates using a combination of specified PrimPol and Phi29 DNA polymerase at low temperature (30°C) is shown. The y-axis represents the amount of amplified DNA (ng / μl). In the left group (-), the reaction was performed in the absence of Phi29, while in the right group (+), the reaction was performed in the presence of Phi29. Within each group, the first column from the left represents TthPrimPol, the second column represents PrimPol 1 of SEQ ID NO: 1, the third column represents a negative control without any PrimPol, and the fourth column represents PrimPol 4 of SEQ ID NO: 2.

[0030] Figure 5 In connection with Example 6, quantitative amplification of clDNA template using a combination of specified PrimPol and Phi29 DNA polymerase at high temperature (50°C) is shown. The y-axis represents the amount of amplified DNA (ng / μl). The conditions tested are as follows: "C1", pH 8.5, 50nM PrimPol, 25ng / μl Phi29, 0.5ng / μl DNA template; "C2", pH 7.5, 600nM PrimPol, 25ng / μl Phi29, 0.5ng / μl DNA template; "C3", pH 7.5, 50nM PrimPol, 8ng / μl Phi29, 0.1ng / μl DNA template; "C4", pH 8, 325nM PrimPol, 16.5ng / μl Phi29, 0.3ng / μl DNA template. Grey bars represent PrimPol 1 of SEQ ID NO: 1; black bars represent PrimPol 2 of SEQ ID NO: 4, and bars with diagonal stripes represent TthPrimPol. P values ​​were calculated by paired t-test.

[0031] Figure 6 In connection with Example 7, quantitative amplification products of reactions performed using the indicated combinations of PrimPol and Phi29 DNA polymerase at different reaction times are shown: 3 and 6 hours. The y-axis represents the amount of amplified DNA (ng / μl). "Tth" refers to TthPrimPol, "1" refers to PrimPol 1 of SEQ ID NO: 1, and "2" refers to PrimPol 3 of SEQ ID NO: 3.

[0032] Figure 7In connection with Example 8, an agarose gel loaded with clDNA is shown, which was generated by RCA amplification initiated with the specified PrimPol, followed by TelN treatment. Arrows indicate bands corresponding to clDNA products. "Tth" refers to TthPrimPol, "1" refers to PrimPol 1 of SEQ ID NO: 1, "4" refers to PrimPol4 of SEQ ID NO: 2, and "C+" refers to the clDNA template used for amplification. DETAILED DESCRIPTION

[0033] Unless otherwise specified, all terms used in this application should be understood as their ordinary meanings known in the art. Other more specific definitions of certain terms used in this application are described below and are intended to be uniformly applied throughout the specification and claims, unless otherwise explicitly stated definitions provide a broader definition.

[0034] As used herein, the indefinite articles "a" and "an" are synonymous with "at least one" or "one or more." Definite articles such as "the" as used herein also include a plural noun unless otherwise stated.

[0035] For the purpose of the present invention, any range given includes the lower and upper endpoints of the range. Unless otherwise specified, the ranges given, such as concentrations, etc., should be considered approximate. The term "about" refers to an error of plus or minus 10%, preferably plus or minus 5%.

[0036] As mentioned above, in the first aspect, the present invention provides a polypeptide comprising a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. Therefore, this aspect is intended to relate to a polypeptide comprising the sequence SEQ ID NO: 1 or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 1; a polypeptide comprising the sequence SEQ ID NO: 2 or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 2; and a polypeptide comprising the sequence SEQ ID NO: 3 or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 3. The present invention also provides a polypeptide comprising a sequence having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0037] The sequences SEQ ID NO: 1 to 4 are disclosed in Table 1 below:

[0038] Table 1

[0039]

[0040]

[0041] Polypeptide sequence variants are well understood by those skilled in the art and may involve amino acid sequence modifications. For example, amino acid sequence modifications generally fall into one or more of three categories: substitution variants, insertion variants, or deletion variants.

[0042] In the present invention, the term "identical" or "identity" refers to the percentage of identical residues in the sequence when two sequences are optimally aligned. If, in the optimal alignment, a position in the first sequence is occupied by the same amino acid residue as the corresponding position in the second sequence, the sequence exhibits identity for that position. The identity percentage determines the number of identical residues within a defined length in a given alignment. Therefore, the level of identity between the two sequences (or "sequence identity percentage") is measured as the ratio of the number of identical positions shared by the sequences to the number of positions compared (i.e., sequence identity percentage = (number of identical positions / total number of positions compared) x 100). A gap (i.e., a position in the alignment, where a residue exists in one sequence but not in the other sequence) is considered to have a position with non-identical residues and is counted as a comparison position.

[0043] For example, a polypeptide having an amino acid sequence that is at least, for example, 95% identical to a reference amino acid sequence of SEQ ID NO: 1, means that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to 5 amino acid changes per 100 amino acids of the reference amino acid sequence of SEQ ID NO: 1. In other words, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or replaced with another amino acid, or a plurality of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These changes to the reference sequence may occur at the amino or carboxyl terminal positions of the reference amino acid sequence, or may occur anywhere between these terminal positions, interspersed individually between residues in the reference sequence, or in one or more consecutive groups within the reference sequence.

[0044] Many mathematical algorithms for quickly obtaining the best comparison and calculating the identity between two or more sequences are known and incorporated into many available software programs. For purposes of the present invention, the sequence identity between two amino acid sequences is preferably determined using an algorithm based on a global comparison, such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol.48:443-453), which is preferably implemented in the Needle program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, TrendsGenet.16:276-277); or using the BLAST global comparison tool (Altschul et al., "Basic Local Alignment Search Tool" (Basic local alignment search tool), 1990, J.Mol.Biol, v.215, pp. 403-410) set by default. When the lengths of the sequences compared are substantially the same, local comparisons can also be used.

[0045] In a specific embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide comprises a primase and a polymerase activity (i.e., the polypeptide is a primase-polymerase or PrimPol). In a more specific embodiment, the polypeptide comprises a DNA primase and a DNA polymerase activity. The skilled person knows how to use their common sense to test whether a polypeptide comprises a primase and a polymerase activity; for example, the polypeptide can be contacted with a nucleic acid under conditions suitable for amplification, and the reaction product can then be measured by absorbance at a wavelength of 260 nm.

[0046] In a specific embodiment of the first aspect, optionally combined with any embodiment provided above or below, the polypeptide comprises at least one improved property compared to TthPrimPol.

[0047] The term "primase-polymerase" as used herein can be used interchangeably with "PrimPol" and refers to a group of enzymes having both primase and polymerase activity. The term "TthPrimPol" is well known to professionals and refers to the primase-polymerase of Thermus thermophilus HB27, which is described in, for example, WO2019101596 (Figure 18, SEQ ID NO: 10). It has Gene ID: NC_005835, protein WP_011173100.1 in the NCBI Entrez database. TthPrimPol is commercially available.

[0048] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the at least one improved property compared to TthPrimPol is selected from higher pH stability, higher thermal stability, higher priming enzyme activity, higher polymerase activity, higher fidelity and higher expression rate. In a specific embodiment, the polypeptide comprises a higher priming enzyme activity at pH 7.5 compared to TthPrimPol. In a more specific embodiment, the polypeptide comprises a higher priming enzyme and / or polymerase activity compared to TthPrimPol, particularly at a pH of about 7.5. In another specific embodiment, the polypeptide comprises a higher priming enzyme and / or polymerase activity compared to TthPrimPol, particularly at a temperature of about 50°C. In an even more specific embodiment, the polypeptide comprises a higher priming enzyme and / or polymerase activity compared to TthPrimPol, particularly at a pH of about 7.5 and a temperature of about 50°C.

[0049] Initiator enzyme and polymerase activity can be measured by conventional methods well known to those skilled in the art, for example, by the methods disclosed in the examples below. In a specific embodiment, the initiator enzyme or polymerase activity is measured by a method selected from absorbance at a wavelength of 260 nm, in situ hybridization, reverse transcriptase polymerase chain reaction, nucleic acid hybridization, electrophoresis, Southern blotting and mass spectrometry. In a more specific embodiment, the initiator enzyme or polymerase activity is measured by absorbance at a wavelength of 260 nm.

[0050] In a more specific embodiment, the priming activity is measured by contacting the polypeptide of the present invention and a strand displacement DNA polymerase, particularly a Phi29 polymerase, with a nucleic acid template under conditions suitable for amplifying the nucleic acid template and measuring the amplification product by absorbance at a wavelength of 260 nm. The higher the priming activity of the polypeptide, the greater the amount of amplification product produced by the DNA polymerase. Conditions suitable for amplifying the nucleic acid template with the polypeptide and a strand displacement DNA polymerase are well known to the skilled person. These conditions can be, for example, the conditions disclosed in Example 1 below.

[0051] In another specific embodiment, the polymerase activity is measured by contacting the polypeptide with a nucleic acid template under conditions suitable for amplifying the nucleic acid template and measuring the amplified product by absorbance at a wavelength of 260 nm. Conditions suitable for amplifying the nucleic acid template with the polypeptide are well known to the skilled person. These conditions can be, for example, the conditions disclosed in the examples below.

[0052] The term "fidelity" refers to the accuracy of the incorporation of the template-directed complementary base relative to the template chain in the synthesized nucleic acid chain. Fidelity can be measured according to the incorporation frequency of incorrect bases in the newly synthesized nucleic acid chain. The incorporation of incorrect bases may cause point mutations, insertions or deletions. Methods for determining fidelity are well known in the art. By measuring natural and synthetic PrimPol using any assay method (such as next-generation sequencing) that measures the accuracy of the incorporation of complementary bases directed by the template and comparing their activities, the improvement in fidelity can be determined. Such methods are known to those skilled in the art. Therefore, in a specific embodiment of the first aspect, fidelity is measured by next-generation sequencing (i.e., analyzing the sequence of the amplified nucleic acid by next-generation sequencing and determining the incorporation frequency of incorrect bases).

[0053] In the specific embodiment of the first aspect optionally in combination with any embodiment provided above or below, the expression rate is measured by a method selected from absorbance at a wavelength of 280 nm, immunoassay, Western blot, ELISA and mass spectrometry. More specifically, the expression rate is measured by the absorbance at a wavelength of 280 nm.

[0054] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the variant substantially retains or improves the initiator and polymerase activity. As used herein, "substantially retains or improves the initiator and polymerase activity" means that the variant thereof has at least 90%, more particularly at least 95%, or even more particularly at least 99% of the initiator and polymerase activity of the reference polypeptide as measured by any suitable method known in the art, particularly the method disclosed above. In another specific embodiment, the variant thereof substantially retains or improves the initiator or polymerase activity.

[0055] In a specific embodiment of the first aspect, optionally combined with any embodiment provided above or below, the sequence of the polypeptide has an RMS value of at least 2, at least 3, at least 4 or at least 5 when aligned with the sequence of TthPrimPol; optionally, wherein the RMS value is calculated using AlphaFold2, in particular as explained in Example 9.

[0056] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the polypeptide comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a sequence thereof with SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: ID NO: 3 having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity, in particular, wherein the variant thereof substantially retains or improves the priming and polymerase activity.

[0057] In a specific embodiment of the first aspect, optionally combined with any embodiment provided above or below, the polypeptide comprises a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 80% identity with SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, in particular, wherein the variant has a length of at least 200 amino acids, at least 250 amino acids, at least 280 amino acids, at least 298 amino acids or about 298 amino acids.

[0058] In a specific embodiment of the first aspect optionally combined with any embodiment provided above or below, the polypeptide comprises the sequence SEQ ID NO: 1 or a sequence thereof of SEQ ID NO: NO:1 has a variant having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity, in particular, wherein the variant substantially retains or improves the primase and / or polymerase activity.

[0059] In a specific embodiment of the first aspect optionally combined with any embodiment provided above or below, the polypeptide comprises the sequence SEQ ID NO: 2 or a sequence thereof of SEQ ID NO: NO:2 has a variant having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity, in particular, wherein the variant substantially retains or improves the priming and / or polymerase activity.

[0060] In a specific embodiment of the first aspect optionally combined with any embodiment provided above or below, the polypeptide comprises the sequence SEQ ID NO: 3 or a sequence thereof of SEQ ID NO: NO:3 has a variant having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity, in particular, wherein the variant substantially retains or improves the priming enzyme and / or polymerase activity.

[0061] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the sequence of the polypeptide is not 100% identical to the sequence of any existing polypeptide. In even more specific embodiments, the sequence of the polypeptide is a synthetic sequence (i.e., a non-naturally occurring sequence). As used herein, the term "existing" refers to a taxonomic group (e.g., a species, genus, or family) that still exists (is alive). The term existing is contrasted with extinction. As used herein, the term "existing polypeptide" refers to a polypeptide from an existing taxonomic group.

[0062] In a specific embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide consists of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. Thus, this embodiment is intended to encompass a polypeptide consisting of the sequence SEQ ID NO: 1, or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 1, a polypeptide consisting of the sequence SEQ ID NO: 2, or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 2, and a polypeptide consisting of the sequence SEQ ID NO: 3, or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 3.

[0063] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the polypeptide consists of the sequence SEQ ID NO: 1 or a variant thereof, which consists of a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity to SEQ ID NO: 1.

[0064] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the polypeptide consists of the sequence SEQ ID NO: 2 or a variant thereof, which consists of a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity to SEQ ID NO: 2.

[0065] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the polypeptide consists of the sequence SEQ ID NO: 3 or a variant thereof, which consists of a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity to SEQ ID NO: 3.

[0066] In one embodiment, the polypeptide comprises a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof, comprising a sequence having at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140 or at least 150 identical consecutive amino acid residues to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0067] In some embodiments, the polypeptide comprises a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, or a variant thereof comprising at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acid changes compared to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0068] In a specific embodiment of the first aspect, optionally in combination with any embodiment provided above or below, the polypeptide is chemically modified. In a more specific embodiment, the chemical modification comprises covalent modification of amino acids. In another embodiment, the covalent modification is selected from methylation, acetylation, phosphorylation, ubiquitination, sumoylation, citrullination, ADP ribosylation and combinations thereof. How to chemically modify polypeptides using conventional methods is common knowledge among those skilled in the art.

[0069] In a specific embodiment of the first aspect, optionally combined with any embodiment provided above or below, the polypeptide further comprises a tag at the N-terminus and / or at the C-terminus, particularly a tag suitable for detection and / or purification.

[0070] The term "tag" as used herein refers to any amino acid sequence, the specific binding molecule of which can be used to detect / purify any polypeptide carrying the tag. The tag is usually located at the amino or carboxyl end of the polypeptide. The presence of such a tag allows the detection of the linker molecule using an antibody against the tag polypeptide. In addition, the provision of the tag enables the linker polypeptide to be easily purified by affinity purification using an anti-tag antibody or another type of affinity reagent that binds to an epitope tag. It should be understood that a person skilled in the art will easily use tags available in the art to identify the tags suitable for detection or purification.

[0071] The skilled person knows how to produce the polypeptide of the present invention by conventional methods well known in the art, such as by chemical synthesis or recombinant expression technology, without exercising any creative skills.

[0072] In a second aspect, the present invention provides an antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Examples of antibodies include, but are not limited to, monoclonal antibodies, polyclonal antibodies, antibody fragments, antibody derivatives, Fab fragments, Fab' fragments, F(ab)2 fragments, Fd fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies, triabodies, tetrabodies, dimers, trimers, and minibodies. In a specific embodiment of the second aspect, the antibody is a monoclonal antibody. The antibody can be produced by any method known in the art for producing antibodies, in particular by chemical synthesis or recombinant expression techniques. Monoclonal antibodies can be prepared using various techniques known in the art, including the use of hybridoma, recombinant and phage display techniques, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma technology, including hybridoma technology known in the art and taught in, for example, WO2009100309.

[0073] As mentioned above, in a third aspect, the present invention provides a nucleic acid encoding a polypeptide as defined in the first aspect. In a specific embodiment of the third aspect, the nucleic acid is DNA or RNA.

[0074] As described above, in the fourth and fifth aspects, the present invention provides a gene construct and an expression vector. Examples of suitable expression promoters and expression vectors include those routinely used in molecular biology and known to professionals. In the sixth aspect, the present invention also provides host cells. Examples of suitable host cells and culture conditions include those routinely used in cell biology and known to professionals.

[0075] As disclosed above, in a seventh aspect, the present invention also provides a method for producing the polypeptide of the present invention. Of course, the specific conditions for cell culture, polypeptide recovery and purification and other such assay conditions may vary depending on various factors including the host cell type, etc. Those skilled in the art will be able to determine the operating and optimal assay conditions for producing the polypeptide by employing routine experimentation.

[0076] In a ninth aspect, the present invention also provides a method for amplifying a nucleic acid, the method comprising the step of contacting the nucleic acid with a polypeptide of the present invention and an optional DNA polymerase, in particular a strand displacement polymerase, under conditions suitable for amplifying the nucleic acid. It should be understood that the skilled person will be able to readily identify conditions suitable for amplifying the nucleic acid using any recognized technique known in the art. Such information is generally available and is part of the skilled person's common knowledge.

[0077] It is noteworthy that the polypeptide of the present invention can be used only for initiating amplification or for the entire amplification process (i.e., initiation and chain extension). When used only for initiation, the polypeptide is used in combination with a DNA polymerase (e.g., Phi29 polymerase). The term "initiation" as used herein refers to the generation of an oligonucleotide primer on a nucleic acid template by a polypeptide of the present invention.

[0078] The term "nucleic acid" as used herein refers to a deoxyribonucleotide or ribonucleotide polymer in single-stranded or double-stranded form, and unless otherwise limited, encompasses natural nucleotides and analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides. The term "nucleotide" includes, but is not limited to, monomers including bases (e.g., pyrimidine, purine, or synthetic analogs thereof) connected to sugars (e.g., ribose, deoxyribose, or synthetic analogs thereof), or bases connected to amino acids, such as in peptide nucleic acids (PNAs). Nucleotide is a monomer in an oligonucleotide or polynucleotide. "Nucleotide sequence" or "nucleic acid sequence" refers to a base sequence in an oligonucleotide or polynucleotide.

[0079] In a specific embodiment of the ninth aspect, optionally combined with any embodiment provided above or below, the amplification method comprises the step of contacting the nucleic acid with a polypeptide of the invention and Phi29 DNA polymerase under conditions suitable for amplifying the nucleic acid.

[0080] The term "strand displacement DNA polymerase" refers to a DNA polymerase that performs a 3' end extension reaction while removing the double-stranded portion of the template DNA. The strand displacement DNA polymerases that can be used in the present invention may not be particularly limited, as long as they have strand displacement activity such as Phi29 DNA polymerase and are compatible with the polypeptide of the present invention. Depending on the type of polymerase so selected, those skilled in the art will know that the reaction conditions for the 3' end extension reaction may be appropriately set. "Phi29 polymerase" or "Phi29 DNA polymerase" used herein refers to a high-continuity strand displacement DNA polymerase from bacteriophage Phi29 (i.e., Φ29). Phi29 polymerases can be commercially available (e.g., from ThermoFisher, EP0091), and are easily available to professional technicians. The term "Phi29 polymerase" is also intended to cover improved variants of Phi29 polymerases, such as the chimeric Phi29 polymerases disclosed in International Application WO2011000997.

[0081] The term "amplification" as used herein refers to one of a variety of ways in which nucleic acids, particularly DNA molecules, can be replicated or propagated. Non-limiting examples of amplification methods include PCR (polymerase chain reaction), LAMP (loop-mediated isothermal amplification), RDC (reactive displacement chimerism), NASBA (nucleic acid sequence-based amplification), or isothermal amplification, such as rolling circle amplification (RCA) or whole genome amplification (WGA).

[0082] Therefore, in the specific embodiment of the ninth aspect optionally combined with any embodiment provided above or below, the amplification is selected from PCR (polymerase chain reaction), LAMP (loop-mediated isothermal amplification), RDC (reaction displacement chimerism), NASBA (nucleic acid sequence-based amplification), rolling circle amplification (RCA), whole genome amplification (WGA), multiple displacement amplification (MDA), strand displacement amplification (SDA) and combinations thereof. In more specific embodiments, the amplification is a combination of rolling circle amplification (RCA) and multiple displacement amplification (MDA).

[0083] In a specific embodiment of the ninth aspect, optionally combined with any embodiment provided above or below, the nucleic acid is DNA, RNA or a mixture thereof.

[0084] In a specific embodiment of the ninth aspect, optionally combined with any embodiment provided above or below, the method comprises contacting the polypeptide of the present invention and the DNA polymerase with the nucleic acid simultaneously or sequentially (i.e. first the polypeptide of the present invention, then the strand-displacing DNA polymerase).

[0085] In a specific embodiment of the ninth aspect optionally in combination with any embodiment provided above or below, the method further comprises contacting the nucleic acid with a buffer, magnesium chloride, and nucleoside triphosphates. In a more specific embodiment, the nucleoside triphosphates are dCTP, dGTP, dTTP, and dATP.

[0086] In a specific embodiment of the ninth aspect, optionally combined with any embodiment provided above or below, the amplification is performed at a constant temperature of 25°C to 60°C, particularly 30°C to 50°C, more particularly about 50°C.

[0087] In a specific embodiment of the ninth aspect, optionally in combination with any embodiment provided above or below, the method further comprises at least one of the following steps: detecting the amplified nucleic acid; quantifying the amplified nucleic acid; sequencing the amplified nucleic acid; and processing the amplified nucleic acid, in particular, wherein the processing comprises digesting the amplified nucleic acid with at least one restriction enzyme. In a more specific embodiment, the method further comprises the step of digesting the amplified nucleic acid with at least one restriction enzyme. In a more specific embodiment, the method further comprises the step of digesting the amplified nucleic acid with at least one restriction enzyme and attaching single-stranded hairpin adapters to both ends of the digested nucleic acid, thereby forming a closed linear DNA. In a more specific embodiment, the method further comprises the step of contacting the amplified nucleic acid with a front end merase, thereby forming a closed linear DNA. In a more specific embodiment, the method further comprises the step of sequencing the amplified nucleic acid and detecting one or more genetic variants in the sequenced amplified nucleic acid. Methods for detecting, quantifying, sequencing or processing nucleic acids are known to those skilled in the art and constitute part of common knowledge.

[0088] In a specific embodiment of the ninth aspect, optionally in combination with any embodiment provided above or below, the sequencing comprises fragmenting the amplified nucleic acid and attaching adapters specific to the sequencing platform to the fragmented nucleic acid. The skilled reader is able to routinely optimize fragmentation conditions and know which adapters to use depending on the sequencing platform to be used.

[0089] In a particular embodiment of the ninth aspect, optionally combined with any embodiment provided above or below, sequencing is performed on selected sequences, an exome, a transcriptome or a whole genome.

[0090] As explained above, in the twelfth aspect, the present invention also provides a method for producing closed linear DNA using the polypeptide of the present invention.

[0091] The term "closed linear DNA" or "clDNA" or "linear closed DNA" or "lcDNA" as used herein refers to a single-stranded covalently closed DNA that forms a "dumbbell" or "dog bone" shaped structure under conditions that allow nucleotide hybridization. Therefore, although the clDNA is formed by a closed single-stranded DNA molecule, the "dumbbell" structure formed by the hybridization of two complementary sequences in the same molecule produces a structure consisting of a double-stranded middle segment with two single-stranded loops on both sides. Those skilled in the art know how to use conventional molecular biology techniques to produce clDNA from open or closed double-stranded DNA (e.g., the amplified DNA produced in step (b)). For example, those skilled in the art know that clDNA can be produced by attaching a single-stranded hairpin adapter (e.g., by the action of a ligase) to the two ends of an open double-stranded DNA. Another method for producing closed linear DNA known to those skilled in the art is the action of an anterior end merase on a double-stranded DNA comprising at least two anterior end merase target sequences.

[0092] In a specific embodiment of the twelfth aspect, optionally combined with any embodiment provided above or below, the nucleic acid is a closed linear DNA.

[0093] In a specific embodiment of the twelfth aspect, optionally in combination with any embodiment provided above or below, the amplification performed in step (b) is rolling circle amplification (RCA).

[0094] The term "rolling circle amplification" or "RCA" refers to a nucleic acid amplification reaction involving the amplification of a covalently closed DNA molecule (e.g., clDNA or double-stranded circular DNA), wherein a polymerase performs primer extension around the closed DNA molecule. The polymerase displaces the hybridized replica and continues to extend the polynucleotide around the template to produce concatemer DNA containing tandem units of the amplified DNA.

[0095] In a specific embodiment of the twelfth aspect, optionally combined with any embodiment provided above or below, the amplifying of step (b) is performed using a strand-displacing DNA polymerase, particularly Phi29 polymerase.

[0096] In a specific embodiment of the twelfth aspect, optionally combined with any embodiment provided above or below, the DNA template is selected from a closed linear DNA template or a circular double-stranded DNA template.

[0097] In a specific embodiment of the twelfth aspect, optionally combined with any embodiment provided above or below, the amplified DNA obtained from step (b) is a concatameric DNA comprising a repetitive sequence of the target DNA sequence, wherein each of the repetitive sequences has restriction sites and / or front end telomerase target sequences on both sides.

[0098] In a specific embodiment of the twelfth aspect, which is optionally combined with any embodiment provided above or below, the concatemer DNA comprises a repeated sequence of a target DNA sequence with at least restriction sites on both sides, and step (c) is then performed as follows: (c.1) contacting the concatemer DNA with at least one restriction enzyme to produce a plurality of open double-stranded DNA fragments, each fragment containing the target DNA sequence, and (c.2) attaching single-stranded DNA adapters to both ends of the open double-stranded DNA fragments.

[0099] In a specific embodiment of the twelfth aspect, optionally combined with any embodiment provided above or below, when the concatemeric DNA comprises a repeat sequence of the target DNA sequence, which is flanked by at least a front-end telomerase target sequence, then step (c) is performed by contacting the concatemeric DNA with a front-end telomerase, particularly TelN.

[0100] As used herein, "front-end telomerase" is any polypeptide capable of cutting and reconnecting a template comprising a front-end telomerase target site to produce a covalently closed linear DNA molecule. Therefore, the front-end telomerase has DNA cutting and connection functions. Enzymes with front-end telomerase-type activity are also described as telomere resolvase (for example, in Borrelia burgdorferi). The typical substrate of the front-end telomerase is circular double-stranded DNA. If the DNA contains a front-end telomerase target site, the enzyme can cut the DNA at this site and connect the ends to produce a linear double-stranded covalently closed DNA molecule. The ability of a given polypeptide to catalyze the production of closed linear DNA from a template comprising a front-end telomerase target site can be determined using any suitable assay described in the art.

[0101] Examples of telomerases suitable for use in the methods of the present invention include telomerases from bacteriophages, such as phiHAP-1 from Halomonas aquamarina, PY54 from Yersinia enterolytica, phiKO2 from Klebsiella oxytoca, and VP882 from Vibrio sp., and N15 (TelN telomerase) from Escherichia coli, or variants of any of them. Telomerases, particularly TelN, can be commercially available or produced by conventional methods.

[0102] In another aspect, the invention provides a polypeptide comprising SEQ ID NO: 4 or a variant thereof having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity to SEQ ID NO: 4. All embodiments and aspects provided above for the polypeptide of the first aspect are also intended to apply to the polypeptide of this other aspect.

[0103] In one embodiment, the polypeptide comprises SEQ ID NO:4 or a variant thereof, comprising an amino acid sequence having at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, or at least 150 consecutive amino acid residues identical to SEQ ID NO:4. In some embodiments, the polypeptide comprises SEQ ID NO:4 or a variant thereof comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to SEQ ID NO:4.

[0104] In particular, the present invention also provides: an antibody that specifically binds to a polypeptide comprising the sequence SEQ ID NO: 4 or consisting of the sequence; a nucleic acid sequence encoding a polypeptide comprising SEQ ID NO: 4 or a variant thereof having at least 80% identity, particularly at least 90% identity, with SEQ ID NO: 4, wherein the nucleic acid sequence is preferably used for expression in a mammalian expression system or in a bacterial expression system; a gene construct comprising the nucleic acid sequence operably linked to an expression promoter; an expression vector comprising the gene construct; a host cell comprising the nucleic acid sequence, the gene construct or the expression vector; a method for producing the polypeptide, the method comprising the following steps: a) culturing the host cell under conditions suitable for producing the polypeptide; b) recovering the polypeptide; and optionally c) purifying the polypeptide; a polypeptide produced according to the method.

[0105] The present invention also provides: a method for amplifying nucleic acid, the method comprising the step of contacting the nucleic acid with a polypeptide comprising SEQ ID NO: 4 or a variant thereof having at least 80% identity, particularly at least 90% identity to SEQ ID NO: 4, and optionally a DNA polymerase, particularly a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid; use of the polypeptide for nucleic acid amplification, detection or sequencing; use of the polypeptide in combination with a strand-displacing DNA polymerase for nucleic acid amplification, detection or sequencing; a method for producing closed linear DNA, the method comprising the following steps: a) providing a DNA template comprising a target DNA sequence; b) amplifying DNA from the DNA template of step (a), wherein the amplification is initiated by the polypeptide; c) using the amplified DNA produced in step (b) to produce closed linear DNA; and d) optionally purifying the produced closed linear DNA; use of the polypeptide for producing closed linear DNA; and a kit comprising: (a) the polypeptide; (b) a strand-displacing DNA polymerase, particularly a Phi29 polymerase; and (c) optional instructions for use of the kit.

[0106] In a specific embodiment of this other aspect, optionally in combination with any embodiment provided above or below, the polypeptide consists of SEQ ID NO:4 or a variant thereof having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identity to SEQ ID NO:4.

[0107] In certain embodiments of this further aspect, optionally combined with any embodiment provided above or below, the variant substantially retains or improves the primase and polymerase activities.

[0108] In specific embodiments of this further aspect, optionally combined with any embodiment provided above or below, the polypeptide comprises priming and polymerase activity and optionally the sequence of the polypeptide is not 100% identical to the sequence of any existing polypeptide.

[0109] Throughout this specification and claims, the word "comprising" and its variations are not intended to exclude other technical features, additives, components or steps. In addition, the word "comprising" covers the situation of "consisting of..." For those skilled in the art, other objects, advantages and features of the present invention will become apparent after reading this specification, or can be learned by practicing the present invention. The following examples and drawings are provided by way of illustration and are not intended to limit the present invention. Reference symbols associated with the drawings and placed in brackets in the claims are only used to attempt to increase the understandability of the claims and should not be interpreted as limiting the scope of the claims. In addition, the present invention covers all possible combinations of specific and preferred embodiments described herein.

[0110] The present invention includes the following embodiments:

[0111] 1. A polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 or a variant thereof having at least 80% identity, in particular at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0112] 2. A polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, or a variant thereof having at least 80% identity, in particular at least 90% identity, to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0113] 3. A polypeptide according to any one of embodiments 1-2, comprising priming and polymerase activities.

[0114] 4. A polypeptide according to any one of embodiments 1-3, comprising at least one improved property compared to TthPrimPol.

[0115] 5. A polypeptide according to embodiment 4, wherein at least one improved property compared to TthPrimPol is selected from higher pH stability, higher thermal stability, higher priming enzyme activity, higher polymerase activity, higher fidelity and higher expression rate.

[0116] 6. The polypeptide according to any one of embodiments 1-5, comprising at least one of the following:

[0117] - a higher primase activity compared to TthPrimPol at a pH of 7.5 to 8.5, in particular at a pH of about 7.5;

[0118] - a higher polymerase activity compared to TthPrimPol at a pH of 7.5 to 8.5, in particular about 7.5;

[0119] - a higher primase activity at a temperature of about 50°C compared to TthPrimPol; or

[0120] - Higher polymerase activity compared to TthPrimPol at a temperature of about 50°C.

[0121] 7. A polypeptide according to any one of embodiments 5-6, wherein the priming enzyme or polymerase activity is measured by absorbance at a wavelength of 260 nm.

[0122] 8. A polypeptide according to any one of embodiments 5-6, wherein the priming enzyme activity is measured by contacting the polypeptide and a strand-displacing DNA polymerase, particularly a Phi29 polymerase, with a nucleic acid template under conditions suitable for amplifying the nucleic acid template, and measuring the amplification product by absorbance at a wavelength of 260 nm.

[0123] 9. A polypeptide according to any one of embodiments 5-6, wherein the polymerase activity is measured by contacting the polypeptide with a nucleic acid template under conditions suitable for amplifying the nucleic acid template, and measuring the amplification product by absorbance at a wavelength of 260 nm.

[0124] 10. The polypeptide of any one of embodiments 5-9, wherein the fidelity is measured by next generation sequencing.

[0125] 11. The polypeptide according to any one of embodiments 5-10, wherein the expression rate is measured by absorbance at a wavelength of 280 nm.

[0126] 12. The polypeptide of any one of embodiments 1-11, wherein the variant substantially retains or improves the priming and polymerase activities.

[0127] 13. A polypeptide according to any one of embodiments 1-12, wherein the sequence of the polypeptide has an RMS value of at least 2, at least 3, at least 4 or at least 5 when aligned with the sequence of TthPrimPol; optionally, wherein the RMS value is calculated using AlphaFold2, in particular as explained in Example 9.

[0128] 14. The polypeptide according to any one of embodiments 1-13, wherein the sequence of the polypeptide is not 100% identical to the sequence of any existing polypeptide.

[0129] 15. The polypeptide according to any one of embodiments 1-14, which consists of a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 80% identity, in particular at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0130] 16. A polypeptide according to any one of embodiments 1-15, wherein the variant has at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identity to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0131] 17. A polypeptide according to any one of embodiments 1-16, wherein the polypeptide is chemically modified, in particular by covalent modification of amino acids selected from methylation, acetylation, phosphorylation, ubiquitination, paraubiquitination, citrullination, ADP-ribosylation and combinations thereof.

[0132] 18. The polypeptide according to any one of embodiments 1-17, further comprising a tag at the N-terminus or at the C-terminus, in particular a tag suitable for detection and / or purification.

[0133] 19. An antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0134] 20. A nucleic acid sequence encoding a polypeptide as defined in any one of embodiments 1 to 18, in particular, wherein the nucleic acid sequence is optimized for expression in a mammalian expression system or in a bacterial expression system.

[0135] 21. A gene construct comprising a nucleic acid sequence as defined in embodiment 20 operably linked to an expression promoter.

[0136] 22. An expression vector comprising the gene construct as defined in embodiment 21.

[0137] 23. A host cell comprising a nucleic acid sequence as defined in embodiment 20, a gene construct as defined in embodiment 21 or an expression vector as defined in embodiment 22.

[0138] 24. A method for producing a polypeptide as defined in any one of embodiments 1-18, the method comprising the steps of:

[0139] a) culturing the host cell as defined in embodiment 23 under conditions suitable for producing the polypeptide;

[0140] b) recovering the polypeptide; and

[0141] c) optionally purifying the polypeptide.

[0142] 25. A polypeptide obtainable by the method defined in embodiment 24.

[0143] 26. A method for amplifying a nucleic acid, said method comprising the step of contacting said nucleic acid with a polypeptide as defined in any one of embodiments 1 to 18 and optionally a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying said nucleic acid.

[0144] 27. A method for amplifying, detecting or sequencing a nucleic acid, the method comprising the step of contacting the nucleic acid with a polypeptide as defined in any one of embodiments 1 to 18 and optionally a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid.

[0145] 28. The method of any one of embodiments 26-27, wherein the nucleic acid is DNA, RNA, or a mixture thereof.

[0146] 29. A method according to any one of embodiments 26-28, wherein the nucleic acid is a closed linear DNA.

[0147] 30. The method according to any one of embodiments 26-29, wherein the polypeptide defined in any one of embodiments 1-18 and the DNA polymerase are contacted with the nucleic acid simultaneously or sequentially.

[0148] 31. A method according to any one of embodiments 26-30, wherein the amplification is selected from PCR (polymerase chain reaction), LAMP (loop-mediated isothermal amplification), RDC (reaction displacement chimera), NASBA (nucleic acid sequence-based amplification), rolling circle amplification (RCA), whole genome amplification (WGA), multiple displacement amplification (MDA), strand displacement amplification (SDA) and combinations thereof, in particular, the amplification is a combination of rolling circle amplification (RCA) and multiple displacement amplification (MDA).

[0149] 32. The method according to any one of embodiments 26-31, further comprising at least one of the following steps:

[0150] - detecting the amplified nucleic acid;

[0151] - quantifying the amplified nucleic acid;

[0152] - sequencing the amplified nucleic acid; and

[0153] - treating said amplified nucleic acid, in particular, wherein said treating comprises digesting said amplified nucleic acid with at least one restriction enzyme.

[0154] 33. A method according to embodiment 32, wherein sequencing includes fragmenting the amplified nucleic acid and attaching adapters specific to the sequencing platform to the fragmented nucleic acid.

[0155] 34. Use of a polypeptide as defined in any one of embodiments 1 to 18 for amplification, detection or sequencing of nucleic acid, in particular, wherein the nucleic acid is a closed linear DNA.

[0156] 35. Use of a polypeptide as defined in any one of embodiments 1 to 18 in combination with a DNA polymerase, in particular a strand-displacing DNA polymerase, for amplification, detection or sequencing of nucleic acids.

[0157] 36. The use according to embodiment 35, wherein the strand-displacing DNA polymerase is Phi29 DNA polymerase.

[0158] 37. A method for producing closed linear DNA, the method comprising the steps of:

[0159] a) providing a DNA template comprising a target DNA sequence;

[0160] b) amplifying DNA from the DNA template of step (a), wherein the amplification is primed with a polypeptide as defined in any one of embodiments 1-18; and

[0161] c) producing closed linear DNA using the amplified DNA produced in step (b); and

[0162] d) optionally, purifying the generated closed linear DNA.

[0163] 38. A method according to embodiment 37, wherein the amplification performed in step (b) is rolling circle amplification.

[0164] 39. A method according to any one of embodiments 37-38, wherein the amplification of step (b) is performed using a strand-displacing DNA polymerase, particularly phi29 polymerase.

[0165] 40. The method according to any one of embodiments 37-39, wherein the DNA template is selected from a closed linear DNA template or a circular double-stranded DNA template.

[0166] 41. A method according to any one of embodiments 37-40, wherein the amplified DNA obtained from step (b) is a concatemeric DNA comprising a repeat sequence of the target DNA sequence, wherein each of the repeat sequences has restriction sites and / or front end telomerase target sequences on both sides.

[0167] 42. A method according to embodiment 41, wherein when the concatemeric DNA comprises a repeated sequence of the target DNA sequence with at least restriction sites on both sides, step (c) is carried out as follows: (c.1) contacting the concatemeric DNA with at least one restriction enzyme to produce a plurality of open double-stranded DNA fragments, each fragment containing the target DNA sequence, and (c.2) attaching single-stranded DNA linkers to both ends of the open double-stranded DNA fragments.

[0168] 43. A method according to embodiment 41, wherein when the concatemeric DNA comprises a repeat sequence of the target DNA sequence flanked by at least a telomerase target sequence, step (c) is performed by contacting the concatemeric DNA with a telomerase, particularly TelN.

[0169] 44. Use of a polypeptide as defined in any one of embodiments 1 to 18 for producing closed linear DNA.

[0170] 45. A kit comprising:

[0171] (a) a polypeptide as defined in any one of embodiments 1 to 18;

[0172] (b) a DNA polymerase, in particular a strand-displacing DNA polymerase; and

[0173] (c) optionally, instructions for use of the kit.

[0174] 46. ​​The kit of embodiment 45, further comprising one or more deoxyribonucleotide triphosphates.

[0175] 47. The kit of any one of embodiments 45-46, wherein the strand-displacing DNA polymerase is Phi29 DNA polymerase.

[0176] Example

[0177] Example 1: Materials and Methods

[0178] Production and purification of synthetic PrimPol of the invention

[0179] Synthetic PrimPol of SEQ ID NO: 1, 2, 3 and 4 were codon optimized for expression in E. coli and synthesized into pET28 expression vector (Merk) and then transformed into E. coli BL21 (DE3) (Life Technologies) strain for protein expression according to standard procedures. Briefly, cells were incubated at 37°C in LB medium (Thermofisher) until the OD reached an Abs600nm of 0.6 and induced with 1 mM IPTG. After induction, cells were incubated overnight at 18°C ​​and collected by centrifugation at 4000 rpm for 15 minutes. The pellet was resuspended in extraction buffer (50 mM Tris-HCl pH 7.5, 5% glycerol, 0.5 mM EDTA and 1 mM dithiothreitol (DTT)) and 1 M NaCl, 0.25% Tween-20 and 30 mM imidazole. 1 vial of protease inhibitor cocktail and 100mg / ml lysozyme was added to the resuspended sediment and incubated at 4°C for 15 minutes. Then, the sediment was ultrasonicated 3 times for 10 minutes with an amplitude of 30%. Ultracentrifugation was performed at 33000G for 1 hour to separate cell debris. The supernatant was filtered and mixed with a HisGraviTrap affinity column (GE Healthcare) pre-cleaned with extraction buffer according to the manufacturer's instructions. The protein was eluted using an extraction buffer containing 500mM imidazole and 1M NaCl. Appropriate components were collected, diluted with extraction buffer without NaCl, and loaded onto a HiTrap heparin HP column (5ml, GE Healthcare). The column was eluted with a linear gradient of extraction buffer containing 0.1 to 1M NaCl. Protein purification was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of 12% acrylamide according to standard procedures. Protein concentration was calculated by measuring absorbance at 280 nm in a Nanodrop 2000C following the manufacturer's instructions.

[0180] Primer enzyme activity assay

[0181] The initiator enzyme activity assay was carried out in a reaction containing 30mM Tris-HCl, 30mMKCl, 7.5mMMgCl2, 2mM DTT, 0.5mM dNTP, 400nM initiator enzyme-polymerase and 100ng single-stranded DNA template (M13mp18) (NewEngland Biolab) in each 12.5uL reaction volume. The reaction was incubated at 30 or 50°C and pH 7 and 8 for the reaction time shown. The reaction was terminated by incubating at 65°C for 15min. The sample was then loaded into a 2% agarose gel for electrophoresis analysis and measured with Nanodrop2000C according to the manufacturer's instructions.

[0182] Polymerase activity assay

[0183] For polymerase activity assay, extension of the gapped plasmid was performed. The psJ4 plasmid was obtained by introducing Nb.Bpu10I and Nt.Bpu10I nickase restriction sites 64 bp upstream and downstream of the transcription start site of the lacZa gene using the pUC19 plasmid (Thermofisher) as a basis. The plasmid was assembled by Gibson assembly in the following manner: A 566 bp DNA strand containing the lacZa gene with the desired mutation was purchased from GeneArt (ThermoFisher). pUC19 was amplified by PCR using primer 1 of the sequence CAGCTCACTCAAAGGCGGTA (SEQ ID NO: 5) and primer 2 of the sequence TCTGCTCTGATGCCGCATAG (SEQ ID NO: 6). The two fragments were assembled by Gibson assembly using the Gibson Assembly HiFi Kit (GeneArt), transformed into the provided competent cells, and plated on LB agar plates containing x-gal, IPTG and carbenicillin. Colonies containing the correct psJ4 plasmid were checked by double-strand digestion with two restriction enzymes, Nb.Bpu10I and Nt.Bpu10I. The gapped plasmid was obtained by digestion with either Nb.Bpu10I or Nt.Bpu10I restriction enzymes and incubated with a 64 bp single-stranded competitor in three heat / cool cycles at 95°C for 1 min, 60°C for 10 min, and 37°C for 20 min. The gapped plasmid was further purified using an Amicon ultrafilter (Millipore) with a cutoff of 100 kDa.

[0184] The gap plasmid extension assay was performed in a reaction containing 30 mM Tris-HCl, 30 mM KCl, 7.5 mM MgCl2, 5 mM (NH4)2SO4, 2 mM DTT, 0.5 mM dNTP, 100 nM primase-polymerase and 35 ng of gap plasmid per 12.5 uL reaction volume. The reaction was incubated at 30°C for 30 minutes and loaded into a 1% agarose gel for electrophoresis analysis.

[0185] Fidelity determination

[0186] For fidelity determination, a modified version of the plasmid pUC18 named pSJ4 was used. pSJ4 contains two endonuclease nicking sites (Nb.Bpu10I and Nt.Bpu10I) at -6 and +58 of the lacza gene. A gapped plasmid was generated and fidelity determination was performed as described in (Guilliam TA et al., "Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins", Nucleic Acids Res, Jan, vol 43(2), pp.1056-68).

[0187] Closed linear DNA template generation

[0188] Closed linear DNA (clDNA) is generated by treating plasmid DNA with TelN, as described in Heinrich J. et al., "Linear closed mini DNA generated by the prokaryotic cleaving-joining enzyme TelN is functional in mammalian cells", J Mol Med, 2002, vol. 80 (10), pp. 648-54. The treated plasmid contains the target gene flanked by TelN recognition sites. The digested lcDNA is purified from an agarose gel and used as a template for an RCA reaction.

[0189] Rolling circle amplification

[0190] Rolling circle amplification (RCA) was performed as follows: Template DNA (1.25ul) was denatured by incubation with 1.25ul 0.1M NaOH for 3 minutes. The denaturation was neutralized by adding 1.25ul reaction buffer (buffer A10X: 500mM TrisHCl, 500mM KCl, 100mM MgCl2, 10mM DTT, 1mg / mL BSA, 5mM dNTP; or buffer B10X: 300mM Tris-HCl, 300mM KCl, 75mM MgCl2, 5mM (NH4)2SO4, 20mM DTT, 5mM dNTP; the buffer was adjusted to the specified pH). The priming enzyme-polymerase and Phi29 DNA polymerase were added at the specified concentrations. Unless otherwise stated, the reaction was incubated at 30°C for 3 hours.

[0191] Next-generation sequencing of RCA

[0192] The concatemer from RCA synthesized by each priming enzyme-polymerase and Phi29 DNA polymerase is analyzed by NGS. The clDNA carrying the luciferase gene is used as a template. The RCA concatemer is fragmented by ultrasonic treatment, and the fragment is sequenced by Illumina according to standard procedures. All reads containing accurate sequences are mapped to the reference template. The reads are counted, and the percentage of the mapped reads is calculated. DNA amplified by PCR using Phusion high-fidelity polymerase (NEB) is used as a control.

[0193] TelN digestion

[0194] TelN digestion of RCA products was performed on 100 ng RCA products as described in Heinrich, supra. Briefly, 1 ul TelN enzyme (NEB), 2 ul ThermoPol reaction buffer (10X) and up to 20 ul nuclease-free water. The mixture was incubated at 30°C for 30 minutes and loaded into a 1% agarose gel for DNA electrophoresis analysis.

[0195] Example 2: Synthetic PrimPol has higher expression and purification yield

[0196] Synthetic PrimPol 1 (SEQ ID NO: 1), PrimPol 2 (SEQ ID NO: 4), PrimPol 3 (SEQ ID NO: 3) and PrimPol 4 (SEQ ID NO: 4) and TthPrimPol in pET-28a plasmid were expressed in E. coli BL21 DE3 cells (Thermofisher) according to standard procedures. Induction at OD6000.6 by IPTG (1 mM) was performed overnight at 18°C.

[0197] In brief, the deposited cells frozen at -20 ℃ are thawed and ultrasonically treated in 50mM Tris-HCl pH 7.5, 5% glycerol, 0.5mM EDTA, 1mM DTT, 2M NaCl, 0.25% Tween-20 and 30mM imidazoles. After centrifugation at 40000g, supernatant is added to HisTrap nickel resin (Ni-NTA) and incubated for 1 hour. Resin is washed three times with the above-mentioned buffer, and eluted in 1mL fraction with the same buffer containing 500mM 4rotelome. Fractions are collected and passed through HiTrap heparin HP column according to the manufacturer's instructions. Sample is eluted with concentrated salt buffer (50mMTris-HCl pH 7.5, 5% glycerol, 0.5mM EDTA, 1mM DTT, 1M NaCl). The sample contains the priming enzyme-polymerase of purification.

[0198] The expression of synthetic primase-polymerase and TthPrimPol was tested as shown in Figure 1 As shown in the figure, the synthetic PrimPol 1-4 of the present invention exhibited higher expression rates than TthPrimPol. This was particularly notable for PrimPol 4 (SEQ ID NO: 2), which had a production rate up to 50% higher than TthPrimPol.

[0199] Example 3: Synthetic PrimPol provides higher priming activity under certain conditions

[0200] In the presence of Mg as a cofactor 2+ An important feature of PrimPol is the presence of primase-polymerase activity. For RCA applications, the presence of Mg as a cofactor 2+ Instead of Mn required by most known initiators 2+ , which is essential for maintaining high fidelity of Phi29 DNA polymerase for subsequent DNA synthesis. 2+ To determine whether the primase-polymerase activity was retained in the presence of 5-nitropropene, their priming activity was determined on M13mp18 ssDNA. Figure 2As shown in Figure 2, all synthetic PrimPols can be used in the presence of M13mp18 ssDNA template, dNTPs and Mg2 + Primers were generated in the presence of dNTPs, whereas no primers were obtained in the absence of dNTPs. The reactions were incubated for 6 hours at 30°C or 50°C and 7.5 or 8.5 pH. The assay was performed using M13mp18ssDNA as substrate and 200 nM of each enzyme. All enzymes showed higher activity at 50°C.

[0201] In the case of pH activity, TthPrimPol showed higher priming activity only at pH 8.5 at 50°C, compared to PrimPol 1 and PrimPol 4 which had higher activity at pH 7.5 at 50°C. PrimPol 2 and PrimPol 3 activities showed similar priming activity at both pHs. The reactions were incubated for 6 h under different conditions and terminated at 65°C.

[0202] In summary, these results show that at lower pH and higher temperature, synthetic PrimPol 1 and PrimPol 4 have higher primase activity than TthPrimPol. Synthetic PrimPol 3 provides similar priming efficiency as TthPrimPol under most conditions.

[0203] Example 4: Synthetic PrimPol provides high sequence fidelity

[0204] To evaluate the polymerase activity of the synthetic primase polymerases, we first tested whether they could complete polymerization of the gapped plasmid as explained in Example 1 above. Figure 3 As shown in , the synthetic PrimPol was able to extend a 64 bp gapped plasmid, which allowed complete cleavage with EcoRI, confirming the DNA polymerization activity of the synthetic PrimPol of the present invention.

[0205] The RCA reaction was also performed as explained in Example 1 above, and the amplified product was then sequenced by NGS. The concatemers produced by all combinations of PrimPol and Phi29 polymerases were fragmented and sequenced by ultrasonic treatment to check the fidelity of amplification using DNA carrying the luciferase gene as a template. The PCR product of the plasmid substrate was used as a control for sequencing errors. All reads obtained after the experiment were mapped using the reference sequence of the substrate, and similar percentages of mapped reads were obtained using all enzyme combinations. The sequencing results are provided in Table 2 below:

[0206] Table 2

[0207]

[0208] These results indicate that PrimPol 1 (SEQ ID NO: 1) and PrimPol 3 (SEQ ID NO: 3) provide even higher amplification fidelity than TthPrimPol.

[0209] Example 5: Synthesized PrimPol has initiation activity at 30°C

[0210] As disclosed in Example 1 (RCA amplification) above, the ability of the synthetic PrimPol to synthesize primers was measured, which Phi29 DNA polymerase can then extend to produce long concatemers at high yields. For a 12.5ul reaction, the reaction contained 250ng PrimPol, 210ng Phi29 DNA polymerase, 0.5mM dNTP, 10mM MgCl2. The reaction was carried out at 30°C for 3 hours and inactivated at 65°C for 10 minutes.

[0211] like Figure 4 As shown in , both PrimPol 1 and PrimPol 4 showed comparable ability to TthPrimPol in synthesizing primers that were later extended by Phi29 DNApol at low temperature (ie 30°C).

[0212] Example 6: Synthesis of PrimPol with improved initiation activity at 50°C

[0213] For the use of PrimPol in an industrial scale setting, a desirable feature of these enzymes is their ability to tolerate and produce high DNA yields under the variations in reaction conditions expected in industrial processes. As disclosed above, the ability of synthetic PrimPol to synthesize primers at elevated temperatures was measured.

[0214] like Figure 5 As shown in , synthetic PrimPol 1 (SEQ ID NO: 1) and PrimPol 4 (SEQ ID NO: 2) were able to produce higher amplification yields than TthPrimPol under various conditions, even when compared to the optimal working conditions of TthPrimPol (i.e., pH 8.5).

[0215] These results clearly demonstrate that the synthetic PrimPols of the present invention provide more efficient initiation than TthPrimPol under a variety of conditions, making them very suitable for use in industrial settings.

[0216] Example 7: Synthetic PrimPol is faster than known PrimPol

[0217] The initiation rates of synthetic PrimPol 1 (SEQ ID NO: 1) and PrimPol 3 (SEQ ID NO: 3) were compared to that of TthPrimPol.

[0218] PrimPol was incubated under the same conditions to test the rolling circle amplification activity in combination with Phi29 polymerase. 0.5ng / ul double-stranded clDNA carrying the luciferase gene was incubated with 200nM PrimPol and 20nM Phi29 DNA polymerase at pH 7.5 and 30°C for 3 and 6 hours. The reaction was terminated at 65°C for 15min. DNA concentration was measured by fluorescence using picoGreen reagent.

[0219] like Figure 6 As shown in , under these conditions, synthetic PrimPol 1 and TthPrimPol produced DNA at similar rates when combined with Phi29. However, PrimPol3 produced amplified DNA at a higher concentration faster (3 hours) than TthPrimPol. Each experiment was performed in duplicate.

[0220] Example 8: Production of clDNA using synthetic PrimPol

[0221] When producing clDNA by RCA amplification, the yield is a very important factor. However, high-quality amplified DNA is a basic requirement for the process. As explained in Example 1, the ability of synthetic PrimPol 1 and PrimPol 4 to produce high-quality clDNA was tested.

[0222] Figure 7 It was shown that synthetic PrimPol 1 (SEQ ID NO: 1) and 4 (SEQ ID NO: 2) are able to prime clDNA for the synthesis of concatemers that can then be treated with TelN to generate clDNA identical to the original template.

[0223] Example 9: Protein structure prediction using Alphafold2

[0224] The AlphaFold2 model was calculated on the Alphfold2 online platform (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb). Five models were estimated using default parameters. The PyMol (The PyMOL Molecular Graphics System, Version 2.0, LLC.) to visualize the best model obtained. Four structures were predicted: TthPrimPol, PrimPol1 (SEQ ID NO: 1), PrimPol 3 (SEQ ID NO: 3) and PrimPol 4 (SEQ ID NO: 2). The three synthetases (PrimPol 1, 3 and 4) were aligned with TthPrimPol and the RMS (root mean square) values ​​were estimated.

[0225] Alignment of TthPrimPol with PrimPol 4 (SEQ ID NO: 2) resulted in an RMS value of 5.6. Any value around 2 indicates significant structural deviation.

[0226] The structure is divided into two subdomains with a significant displacement in the C-terminal domain. The N-terminal domain contains the catalytic residues and the metal binding core and is the catalytic domain. The most significant displacement is in the C-terminal domain, which is involved in the binding and initiation of the 5'NTP in the entire PriCT-1 motif. This binding domain is essential for the enzyme to function as an initiator.

[0227] Structural alignment of TthPrimPol with PrimPol 1 (SEQ ID NO: 1) resulted in an RMS value of 7.6. Finally, structural alignment of TthPrimPol with PrimPol 3 (SEQ ID NO: 3) yielded an RMS value of 5.8.

[0228] Overall, these results suggest that synthetic PrimPol 1, 3, and 4 maintain catalytic activity through a very similar catalytic subdomain at the N-terminus, but have a significantly shifted binding subdomain at the C-terminus compared to TthPrimPol.

[0229] Citation List

[0230] WO2009100309

[0231] WO2011000997

[0232] Altschul et al., "Basic local alignment search tool", 1990, J. Mol. Biol, v. 215, pp. 403-410.

[0233] Guilliam TA et al., "Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins", Nucleic Acids Res, Jan, vol 43(2), pp.1056-68.

[0234] Heinrich J. et al., "Linear closed mini DNA generated by the prokaryotic cleaving-joining enzyme TelN is functional in mammalian cells", J Mol Med, 2002, vol. 80(10), pp. 648-54.

Claims

1. A polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

2. The polypeptide of claim 1, wherein the polypeptide comprises priming and polymerase activities.

3. A polypeptide according to any one of claims 1-2, wherein the polypeptide comprises at least one improved property compared to TthPrimPol, the improved property being selected from higher priming enzyme activity, higher polymerase activity, higher fidelity, higher pH stability, higher thermal stability and higher expression rate.

4. The polypeptide according to any one of claims 1 to 3, which consists of a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof having at least 90% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

5. The polypeptide of any one of claims 1-4, wherein the variant has at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% identity to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and / or substantially maintains or improves the primase and polymerase activities.

6. The polypeptide according to any one of claims 1 to 5, further comprising a tag located at the N-terminus and / or C-terminus of the polypeptide, in particular a tag suitable for detection and / or purification.

7. An antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

8. A nucleic acid sequence encoding a polypeptide as defined in any one of claims 1 to 6, in particular, wherein the nucleic acid sequence is optimized for expression in a mammalian expression system or in a bacterial expression system.

9. A method for producing a polypeptide as defined in any one of claims 1 to 6, comprising the steps of: a) culturing a host cell comprising a nucleic acid sequence as defined in claim 8 under conditions suitable for producing the polypeptide; b) recovering the polypeptide; and c) optionally purifying the polypeptide.

10. A method for amplifying a nucleic acid, the method comprising contacting the nucleic acid with the following substances under conditions suitable for amplifying the nucleic acid: - A polypeptide as defined in any one of claims 1 to 6; and -Optionally a DNA polymerase, in particular a strand-displacing DNA polymerase.

11. The method according to claim 10, further comprising at least one step selected from the following: - detecting the amplified nucleic acid; - quantifying the amplified nucleic acid; - sequencing the amplified nucleic acid; and - treating said amplified nucleic acid, in particular, wherein said treating comprises digesting said amplified nucleic acid with at least one restriction enzyme.

12. Use of the polypeptide according to any one of claims 1 to 6 for amplification, detection or sequencing of nucleic acid.

13. The method according to any one of claims 10-11 or the use according to claim 12, wherein the nucleic acid is a closed linear DNA.

14. A method for producing closed linear DNA, the method comprising the steps of: a) providing a DNA template comprising a target DNA sequence; b) amplifying DNA from the DNA template of step (a), wherein the amplification is initiated by a polypeptide as defined in any one of claims 1 to 6; and c) generating closed linear DNA using the amplified DNA generated in step (b); and d) optionally amplifying said generated closed linear DNA.

15. A kit comprising: a) a polypeptide as defined in any one of claims 1 to 6; b) a DNA polymerase, in particular a strand-displacing DNA polymerase; and c) optionally, instructions for use of the kit.

Images