Prebiotic balance repairing essence and preparation method thereof

Abstract

The invention belongs to the technical field of cosmetics, and discloses prebiotic balance repairing essence and a preparation method thereof. The prebiotic balance repairing essence is prepared from the following components in parts by mass: 1 to 11 parts of prebiotics, 1 to 3 parts of anoectochilus roxburghii extract, 1 to 4 parts of nicotinamide, 1 to 2 parts of tranexamic acid, 0.1 to 1 part of humectant, 0.5 to 2 parts of preservative, 0.1 to 0.5 part of collagen and 0.1 to 0.5 part of fibronectin. The prebiotic balance repairing essence can inhibit expression of inflammatory factors, and has a remarkable effect of inhibiting skin inflammation; field planting of effective microbial communities of the skin can be recovered, harmful microbial communities are inhibited, and the micro-ecology of the skin is balanced and reconstructed; the skin cuticle thickness can be obviously increased, and the effect of repairing the skin barrier is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of cosmetics, and in particular to a prebiotic balancing and repairing essence and a preparation method thereof. Background Art

[0002] The skin barrier is composed of the sebum membrane, keratin (including keratinocytes and intercellular lipids) and the dermis. It is the key to resisting harmful external stimuli and regulating the balance of moisture and oil in the skin. Environmental pollution and seasonal changes have made common skin problems such as dry skin caused by lack of water in the stratum corneum and the resulting itchy and flaking skin more and more serious. When the skin barrier is damaged, a variety of skin problems will occur, such as oily outside and dry inside, enlarged pores, poor absorption of skin care products, accelerated skin aging, etc. These problems not only affect the beauty of the skin, but may also cause skin inflammation and further aggravate skin damage. Therefore, repairing the skin barrier is the first step to maintain and restore skin health.

[0003] Chinese invention patent document CN111671708A discloses a probiotic complex cosmetic for balancing and repairing skin, comprising active substances and cosmetic base substances, wherein the active substances include bifid yeast fermentation product filtrate, hyaluronic acid composition, resveratrol, chicory stem extract, bletilla striata extract, and the balance is lactic acid bacteria / mung bean seed extract fermentation product filtrate. It can repair the skin, maintain the balance of water and oil, and has a good moisturizing effect, keeping the skin hydrated for a long time.

[0004] Chinese invention patent document CN117562839A discloses a skin soothing composition, whose active ingredients include panthenol, madecassoside, gentian extract, and ectoine, which can inhibit the release of inflammatory factors, regulate the expression of genes involved in damage repair, accelerate wound healing, promote epithelial formation and skin regeneration, and improve skin tolerance.

[0005] Chinese invention patent document CN116747160A discloses a spray for maintaining the microecological balance of the skin, and its raw materials include edible disinfectant, weak acid, salt-tolerant bacteria extractant, hyaluronic acid, functional components, emulsifier, and water. After being applied to the surface of the skin, it forms an environment suitable for the growth of beneficial bacteria, inhibits the growth of harmful bacteria, and forms a healthy microecological balance of the skin; it also repairs the skin barrier, relieves dry skin, and has an excellent soothing effect on sensitive skin.

[0006] However, due to the different raw materials and contents of various substances, the effects of the products on the skin are also different. Therefore, finding a better formula combination that can comprehensively balance and repair, so as to better use it for skin care and maintenance, is a research hotspot that needs to be broken through in this field. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a prebiotic balance repair essence and a preparation method thereof.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides a prebiotic balancing and repairing essence, comprising the following components in parts by weight: 1-11 parts of prebiotics, 1-3 parts of golden thread lotus extract, 1-4 parts of niacinamide, 1-2 parts of tranexamic acid, 0.1-1 parts of moisturizer, 0.5-2 parts of preservative, 0.1-0.5 parts of collagen, and 0.1-0.5 parts of fibronectin.

[0010] The present invention prepares the above-mentioned various raw materials according to the above-mentioned specific mass parts to obtain an essence with excellent balancing and repairing effect. The components in the prebiotic balancing and repairing essence have reasonable compatibility, and the components influence and interact with each other, and act from multiple angles of anti-inflammatory, repair, and balancing flora. Among them, niacinamide and tranexamic acid are used as basic components, and specific prebiotics and plant extracts are added for synergistic enhancement, especially lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract and golden thread lotus extract synergistically, so that the prebiotic balancing and repairing essence of the present invention can inhibit the expression of inflammatory factors and has a significant effect of inhibiting skin inflammation; it can restore the colonization of beneficial flora in the skin, inhibit harmful flora, balance and rebuild the skin microecology; it can significantly increase the thickness of the skin stratum corneum and has the effect of repairing the skin barrier.

[0011] As a preferred embodiment of the prebiotic balancing and repairing essence of the present invention, the prebiotics include lactobacillus fermentation lysate and Sonora Desert Bacillus fermentation broth extract.

[0012] As a preferred embodiment of the prebiotic balancing and repairing essence described in the present invention, the moisturizer includes at least one of hydrolyzed sodium hyaluronate, 1,3-butylene glycol, ethylene glycol, propylene glycol, sorbitol, mannitol, polyethylene glycol, polypropylene glycol, and polyvinyl alcohol.

[0013] As a preferred embodiment of the prebiotic balancing and repairing essence of the present invention, the preservative includes at least one of p-hydroxyacetophenone, 1,2-hexanediol, and methyl ester.

[0014] As a preferred embodiment of the prebiotic balancing and repairing essence described in the present invention, it includes the following components in parts by mass: 3-8 parts of lactobacillus fermentation lysate, 1-3 parts of Sonora Desert Bacillus fermentation broth extract, 1-3 parts of golden thread lotus extract, 1-4 parts of niacinamide, 1-2 parts of tranexamic acid, 0.1-1 parts of hydrolyzed sodium hyaluronate, 0.5-1 parts of p-hydroxyacetophenone, 0.5-1 parts of 1,2-hexanediol, 0.1-0.5 parts of collagen, and 0.1-0.5 parts of fibronectin.

[0015] As a further preferred embodiment of the prebiotic balancing and repairing essence described in the present invention, it includes the following components in parts by mass: 5 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread lotus extract, 2 parts of niacinamide, 1 part of tranexamic acid, 0.1-1 part of hydrolyzed sodium hyaluronate, 0.5-1 part of p-hydroxyacetophenone, 0.5-1 part of 1,2-hexanediol, 0.1-0.5 part of collagen, and 0.1-0.5 part of fibronectin.

[0016] In a second aspect, the present invention provides a skin care product, comprising the prebiotic balancing and repairing essence.

[0017] In a third aspect, the present invention provides a method for preparing the prebiotic balance repair essence, comprising the following steps:

[0018] (1) adding the nicotinamide, tranexamic acid, moisturizer and preservative into water and stirring evenly;

[0019] (2) Add the prebiotics, collagen, fibronectin and roxburghii extract and stir evenly to obtain the product.

[0020] As a preferred embodiment of the method for preparing the prebiotic balancing and repairing essence of the present invention, in step (1): the stirring temperature is 70° C.-85° C., and the stirring speed is 500 rpm-1500 rpm.

[0021] As a preferred embodiment of the method for preparing the prebiotic balancing and repairing essence of the present invention, in step (2): the stirring temperature is 40° C.-50° C., and the stirring speed is 500 rpm-1500 rpm.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The components of the prebiotic balancing and repairing essence of the present invention are reasonably formulated, and the components influence and interact with each other, and act from multiple angles of anti-inflammation, repair, and balance of flora. Among them, niacinamide and tranexamic acid are used as basic components, and specific prebiotics and plant extracts are added for synergistic enhancement, especially lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract and golden thread lotus extract act synergistically, so that the prebiotic balancing and repairing essence of the present invention can inhibit the expression of inflammatory factors and has a significant effect of inhibiting skin inflammation; it can restore the colonization of beneficial flora of the skin, inhibit harmful flora, balance and rebuild the skin microecology; it can significantly increase the thickness of the skin stratum corneum and has the effect of repairing the skin barrier. DETAILED DESCRIPTION

[0024] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0025] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0026] In the present invention, when it comes to numerical ranges, unless otherwise specified, the above numerical ranges are deemed to be continuous and include the minimum and maximum values ​​of the range, as well as each value between such minimum and maximum values. Further, when a range refers to an integer, each integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be merged. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0027] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0028] The invention aims to solve the problem that cosmetics in the prior art have poor effects on regulating and repairing the imbalance of skin microecology.

[0029] An embodiment of the present invention provides a prebiotic balancing and repairing essence, comprising the following components in parts by weight: 3-8 parts of lactobacillus fermentation lysate, 1-3 parts of Sonora Desert Bacillus fermentation broth extract, 1-3 parts of golden thread lotus extract, 1-4 parts of niacinamide, 1-2 parts of tranexamic acid, 0.1-1 parts of hydrolyzed sodium hyaluronate, 0.5-1 parts of p-hydroxyacetophenone, 0.5-1 parts of 1,2-hexanediol, 0.1-0.5 parts of collagen, and 0.1-0.5 parts of fibronectin.

[0030] The embodiment of the present invention provides a method for preparing a prebiotic balancing and repairing essence, comprising the following steps:

[0031] (1) adding the nicotinamide, tranexamic acid, moisturizer and preservative into water and stirring evenly;

[0032] (2) Add the prebiotics (Lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract), collagen, fibronectin, and Anoectochilus roxburghii extract, and stir evenly to obtain the product.

[0033] In step (1): the stirring temperature is 70°C-85°C, and the stirring speed is 500rpm-1500rpm.

[0034] In one embodiment, the stirring temperature is 80° C. and the stirring speed is 1000 rpm.

[0035] In step (2): the stirring temperature is 40°C-50°C, and the stirring speed is 500rpm-1500rpm.

[0036] In one embodiment, the stirring temperature is 45° C. and the stirring speed is 1000 rpm.

[0037] The mechanism of the prebiotic balance repair essence of the present invention to achieve the regulation and repair effect on the imbalance of skin microecology is as follows:

[0038] The present invention prepares the above-mentioned various raw materials according to the above-mentioned specific mass parts to obtain an essence with excellent balancing and repairing effect. The components in the prebiotic balancing and repairing essence have reasonable compatibility, and the components influence and interact with each other, and act from multiple angles of anti-inflammatory, repair, and balancing flora. Among them, niacinamide and tranexamic acid are used as basic components, and specific prebiotics and plant extracts are added for synergistic enhancement, especially lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract and golden thread lotus extract synergistically, so that the prebiotic balancing and repairing essence of the present invention can inhibit the expression of inflammatory factors and has a significant effect of inhibiting skin inflammation; it can restore the colonization of beneficial flora in the skin, inhibit harmful flora, balance and rebuild the skin microecology; it can significantly increase the thickness of the skin stratum corneum and has the effect of repairing the skin barrier.

[0039] Prebiotics include lactobacillus fermentation lysate, the INCI name is LACTOBACILLUS FERMENTLYSATE; Sonora Desert Bacillus fermentation broth extract, refer to the Chinese invention patent document CN202111552495.5 Sonora Desert Bacillus fermentation broth extract and its application. Lactobacillus fermentation lysate contains rich active ingredients, such as peptidoglycan, teichoic acid, protein, phospholipids, sterols, fatty acids, various enzymes, peptides and amino acids, nucleotides, exopolysaccharides, etc., which provide rich nutrition for the skin and form a protective barrier for the skin; Sonora Desert Bacillus fermentation broth extract contains rich SOD, vitamins, amino acids, minerals and other ingredients, which have strong antioxidant function and skin tissue cell repair effect; Lactobacillus fermentation lysate and Sonora Desert Bacillus fermentation broth extract act synergistically as prebiotics, which can promote the proliferation of specific beneficial microorganisms; by repairing skin cells, enhancing immunity, and promoting metabolism, the skin microecological environment can be improved.

[0040] Anoectochilus roxburghii extract, INCI name is Anoectochilus roxburghii extract; derived from the Anoectochilus roxburghii plant, it is a natural plant ingredient that has soothing and repairing effects, improves sensitive skin, and has antioxidant, anti-inflammatory and antibacterial effects. It can reduce skin inflammation, relieve redness, swelling and itching, and prevent and treat skin infections.

[0041] Niacinamide, INCI name is NIACINAMIDE; it can promote the binding of water molecules in the skin, prevent skin dryness, and keep the skin moist and soft; it can enhance the skin's protective ability by regulating the growth and differentiation of keratinocytes; it can stimulate the metabolism of epidermal cells and promote the renewal of the stratum corneum.

[0042] Tranexamic acid, INCI name is TRANEXAMIC ACID; it can stimulate fibroblast proliferation and collagen synthesis; it can reduce skin symptoms such as redness and swelling; it can promote the renewal and differentiation of epidermal cells and help maintain the skin barrier function.

[0043] Hydrolyzed sodium hyaluronate, INCI name SODIUM HYALURONATE;

[0044] Para-hydroxyacetophenone, INCI name is HYDROXYACETOPHENONE;

[0045] 1,2-Hexanediol, INCI name 1,2-HEXANEDIOL;

[0046] Collagen, the INCI name is COLLAGEN;

[0047] Fibronectin, INCI name is FIBRONECTIN;

[0048] Aloe vera extract, INCI name is ALOE YOHJYU MATSU EKISU.

[0049] Example 1: A prebiotic balance repair essence

[0050] The prebiotic balance repair essence comprises the following components in parts by weight:

[0051] 5 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread lotus extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 85.3 parts of water.

[0052] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0053] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0054] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0055] Example 2: A prebiotic balance repair essence

[0056] The prebiotic balance repair essence comprises the following components in parts by weight:

[0057] 8 parts of lactobacillus fermentation lysate, 1 part of Sonora Desert Bacillus fermentation broth extract, 1 part of golden thread lotus extract, 4 parts of niacinamide, 2 parts of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 81.3 parts of water.

[0058] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0059] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0060] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0061] Example 3: A prebiotic balance repair essence

[0062] The prebiotic balance repair essence comprises the following components in parts by weight:

[0063] 3 parts of lactobacillus fermentation lysate, 3 parts of Sonora Desert Bacillus fermentation broth extract, 3 parts of golden thread lotus extract, 1 part of niacinamide, 3 parts of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 86.3 parts of water.

[0064] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0065] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0066] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0067] Comparative Example 1: A prebiotic balance repair essence

[0068] The prebiotic balance repair essence comprises the following components in parts by weight:

[0069] 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 90.3 parts of water.

[0070] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0071] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0072] (2) Add Sonora Desert Bacillus fermentation broth extract and Anoectochilus roxburghii extract, stir evenly, and obtain the product.

[0073] Comparative Example 2: A prebiotic balance repair essence

[0074] The prebiotic balance repair essence comprises the following components in parts by weight:

[0075] 5 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread lotus extract, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 87.3 parts of water.

[0076] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0077] (1) Add tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0078] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0079] Comparative Example 3: A prebiotic balance repair essence

[0080] The prebiotic balance repair essence comprises the following components in parts by weight:

[0081] 5 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 87.3 parts of water.

[0082] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0083] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0084] (2) Add lactobacillus fermentation lysate and Sonora Desert Bacillus fermentation broth extract, stir evenly, and obtain the product.

[0085] Comparative Example 4: A prebiotic balance repair essence

[0086] The prebiotic balance repair essence comprises the following components in parts by weight:

[0087] 5 parts of lactobacillus fermentation lysate, 2 parts of golden thread lotus extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 87.3 parts of water.

[0088] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0089] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0090] (2) Add lactobacillus fermentation lysate and roxburghii extract, stir evenly, and obtain the mixture.

[0091] Comparative Example 5: A prebiotic balancing and repairing essence

[0092] The prebiotic balance repair essence comprises the following components in parts by weight:

[0093] 5 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread extract, 2 parts of niacinamide, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 86.3 parts of water.

[0094] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0095] (1) Add niacinamide, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0096] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0097] Comparative Example 6: A prebiotic balance repair essence

[0098] The prebiotic balance repair essence comprises the following components in parts by weight:

[0099] 10 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread lotus extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 80.3 parts of water.

[0100] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0101] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0102] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0103] Comparative Example 7: A prebiotic balance repair essence

[0104] The prebiotic balance repair essence comprises the following components in parts by weight:

[0105] 1 part lactobacillus fermentation lysate, 2 parts Sonora Desert Bacillus fermentation broth extract, 2 parts golden thread extract, 2 parts niacinamide, 1 part tranexamic acid, 1 part sodium hyaluronate, 0.5 parts p-hydroxyacetophenone, 0.5 parts 1,2-hexanediol, 0.5 parts collagen, 0.2 parts fibronectin, 89.3 parts water.

[0106] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0107] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0108] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0109] Comparative Example 8: A prebiotic balance repair essence

[0110] The prebiotic balance repair essence comprises the following components in parts by weight:

[0111] 5 parts of lactobacillus fermentation lysate, 5 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 82.3 parts of water.

[0112] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0113] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0114] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0115] Comparative Example 9: A prebiotic balance repair essence

[0116] The prebiotic balance repair essence comprises the following components in parts by weight:

[0117] 5 parts of lactobacillus fermentation lysate, 0.5 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread extract, 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 86.8 parts of water.

[0118] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0119] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0120] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and roxburghii roxburghii extract, and stir evenly to obtain the product.

[0121] Comparative Example 10: A prebiotic balance repair essence

[0122] The prebiotic balance repair essence comprises the following components in parts by weight:

[0123] 5 parts of lactobacillus ferment lysate, 2 parts of Sonora Desert Bacillus ferment broth extract, 2 parts of aloe vera extract (INCI name ALOE YOHJYU MATSU EKISU), 2 parts of niacinamide, 1 part of tranexamic acid, 1 part of sodium hyaluronate, 0.5 parts of p-hydroxyacetophenone, 0.5 parts of 1,2-hexanediol, 0.5 parts of collagen, 0.2 parts of fibronectin, 85.3 parts of water.

[0124] The preparation method of the prebiotic balance repair essence comprises the following steps:

[0125] (1) Add niacinamide, tranexamic acid, sodium hyaluronate, p-hydroxyacetophenone, 1,2-hexanediol, collagen, and fibronectin into water and stir evenly;

[0126] (2) Add lactobacillus fermentation lysate, Sonora Desert Bacillus fermentation broth extract, and aloe vera extract, and stir evenly to obtain the product.

[0127] Test example:

[0128] (1) Skin inflammation mouse model:

[0129] 7-week-old female BALB / c mice, weighing 20g-25g, were acclimatized to the environment for 1 week before the experiment. All animal experiments were conducted under specific pathogen-free conditions. This experimental protocol uses a rosacea mouse model induced by LL37. The hair on the back of the BALB / c mice was shaved 24 hours before the injection of LL37, and then 40μL of LL37 peptide (320μm) was injected intradermally into the shaved skin twice a day for 2 days. The animals were randomly divided into 6 groups: a blank control group (PBS group), an LPS group (LL37 group), dexamethasone (positive control) and a test drug (ie, Examples 1-3 and Comparative Examples 1-10). Mice in the blank control group were given PBS solution instead of LL37. The positive control drug dexamethasone (1mg / kg) or the test drug (50mg / kg) was applied every day before and during the injection of LL37 for a total of 4 days, as well as the corresponding controls. Twelve hours after the last injection, the animals were sacrificed under anesthesia, and their lesional skin tissues were immediately dissected and biopsied for RNA extraction, hematoxylin staining, and skin microbiota analysis.

[0130] (2) Extraction of total RNA

[0131] 1. Cut the mouse skin tissue samples and rinse them with saline for 3 times; 2. Place each sample in a 1.5mL polypropylene centrifuge tube, add 600μL RLT to each tube and insert it on ice, grind it thoroughly with the grinder until no tissue is visible to the naked eye. Transfer the liquid in the centrifuge tube to a new centrifuge tube, add an equal volume (300μL-600μL) of 70% ethanol, and mix thoroughly by pipetting; 3. After the tissue is ground, use the TriZol method to extract RNA.

[0132] (3) Reverse transcription and Q-PCR

[0133] 1) Take the total RNA extracted above for reverse transcription, the reaction system is:

[0134] Table 2 Reaction system

[0135] Reagent name Addition amount RNA 1 μg 5×All Mix 4μL gDNA Remover 1μL RNase-free Water Up to 20 μL

[0136] The reaction conditions were: 42°C, 15 min; 85°C, 5 s; 4°C, ∞.

[0137] 2) Perform Q-PCR, the reaction system is:

[0138] Table 3 Reaction system

[0139] Reagent name Addition amount Sterile enzyme-free water 7.8μL F-Primer 0.6μL R-Primer 0.6μL cDNA 1μL 2×Syber Green 10μL

[0140] The reaction conditions were: 95°C, 2 min; (95°C, 15 s; 60°C, 1 min) × 45 cycles.

[0141] Using GAPDH gene as internal reference, the relative expression of inflammatory cytokines such as TNF-α, IL-6 and IL-1β in skin tissues of each group was detected. The primer sequence information is as follows:

[0142] GAPDH: forward primer 5'CCGCATCTTCTTTTGCGTCG3';

[0143] reverse primer 5'ATGGTGTCTGAGCGATGTGG3'.

[0144] IL-6: forward primer 5'CCTTCGGTCCAGTTGCCTTC3';

[0145] reverse primer 5'AAGAGGTGAGTGGCTGTCTG3'.

[0146] TNF-β:forward primer 5'ATGAGCACTGAAAGCATGATCCGG3';

[0147] reverse primer 5'GCAATGATCCCAAAGTAGACCTGCCC3'.

[0148] IL-1β:forward primer 5'GTAAGCTATGGCCCACTCCAT3';

[0149] reverse primer 5'TGACTTATAAGCACCCATGTC3'.

[0150] The results are shown in Table 4:

[0151] Table 4 Verification of relative expression of cytokine mRNA

[0152] Group TNF-α IL-6 IL-1β Blank control group 2.5 3.1 5.5 LL37 Group 9.6 9.9 16.3 Dexamethasone group 2.8 3.9 5.9 Example 1 3.2 4.3 4.4 Example 2 4.1 4.0 4.6 Example 3 3.3 4.3 4.9 Comparative Example 1 8.4 8.6 12.2 Comparative Example 2 9.1 5.8 9.9 Comparative Example 3 8.7 8.5 12.1 Comparative Example 4 9.6 9.2 13.2 Comparative Example 5 5.2 5.5 10.2 Comparative Example 6 5.6 6.2 10.6 Comparative Example 7 5.1 5.9 10.1 Comparative Example 8 4.9 5.7 9.9 Comparative Example 9 5.1 6.0 9.3 Comparative Example 10 5.5 5.2 8.5

[0153] The results showed that after using the test drugs (ie, Examples 1-3 and Comparative Examples 1-10), inflammatory cytokines in skin tissue, such as TNF-α, IL-6, and IL-1β, were significantly downregulated relative to the inflammatory model group (ie, LPS group).

[0154] (4) Skin tissue microbiome analysis

[0155] 1) Cut skin tissue for microbiome analysis;

[0156] 2) Take the total RNA extracted above, and use the strain forward primer and rear primer to amplify the bacterial 16S rRNA gene. The nucleotide sequence of the 16S rRNA universal primer pair is: the upstream primer is: 27F: AGAGTTTGATCMTGGCTCAG; the downstream primer is: 1492R: GGTTACCTTGTTACGACTT. The amplification system is shown in Table 2. Reaction conditions: ABI 2720PCR instrument was used for amplification and sequencing. Amplification program: 96℃5min; 96℃30s, 58℃30s, 72℃90s, 5 cycles; 72℃7min; 4℃ storage.

[0157] Table 5 Amplification system

[0158] 2*Phanta Max Master Mix (Novozymes amplification kit) 12.5μL 27F (Suzhou Hongxun Biosynthesis) 0.5μL 1492R (Suzhou Hongxun Biosynthesis) 0.5μL Genomic DNA 1.5μL <![CDATA[ddH2O]]> Add to 25μL

[0159] The full-length PCR product was sequenced and compared with the reference sequence in the NCBI database to identify the species information of the isolate;

[0160] 3) Quantitatively compare the microbial composition of different groups.

[0161] The microbial growth ratio is calculated as:

[0162] Microbial growth ratio = (C 实验组 -C 空白组 ) / C 空白组 ; Where C is the microbial concentration.

[0163] The results are shown in Table 6:

[0164] Table 6 Comparison results

[0165]

[0166] The results showed that after LL37 treatment, the number of beneficial bacteria in skin tissue (Lactobacillus acidophilus, Staphylococcus capitis, Staphylococcus epidermidis) decreased, while the number of harmful bacteria (Staphylococcus aureus, Propionibacterium acnes, Malassezia) increased. After using the test drugs (Examples 1-3 and Comparative Examples 1-10), the beneficial bacteria in skin tissue recovered and the harmful bacteria were significantly inhibited.

[0167] (5) H&E staining of skin tissue sections

[0168] Cut the mouse skin tissue sample, fix the tissue block with 10% formalin at room temperature for 48 hours, then take it out, dehydrate it in 70%, 80%, 90%, 95%, 100%, and 100% ethanol for 1 hour each. Take out the tissue block and put it into wax transparent agent 1 and 2 for 2 hours each. Immerse the transparent tissue block in paraffin solution for embedding. Cut the wax block into 5μm slices with a paraffin tissue slicer, adsorb it on a slide, and dry it in a 60℃ dryer for 1 hour. Soak the slices in 100%, 100%, 95%, 90%, 80%, and 70% alcohol for 5 minutes each to hydrate, and rinse with tap water for 5 minutes. Stain with hematoxylin for 1min-3min, and rinse with tap water for 5min-10min. Stain with eosin for 1min-3min, and rinse with tap water for 5-10min. The slices were sequentially immersed in 70%, 80%, 90%, 95%, 100%, and 100% ethanol for 10 minutes each for dehydration, immersed in wax transparent agent 1 and 2 for 10 minutes each for transparency, sealed with neutral resin, and covered with glass slides. After drying for 24 hours, the slices were observed under a microscope, and the thickness of the stratum corneum of the skin was measured under a microscope.

[0169] The results are shown in Table 7:

[0170] Table 7 Skin stratum corneum thickness test results

[0171] Group Skin stratum corneum thickness (μm) Blank control group 30 LL37 Group 24 Example 1 52 Example 2 52 Example 3 54 Comparative Example 1 37 Comparative Example 2 31 Comparative Example 3 35 Comparative Example 4 37 Comparative Example 5 33 Comparative Example 6 33 Comparative Example 7 32 Comparative Example 8 36 Comparative Example 9 37 Comparative Example 10 41

[0172] The results showed that compared with the control group, after using the test drugs (Examples 1-3 and Comparative Examples 1-10), the thickness of the stratum corneum of the skin was significantly thickened.

[0173] The prebiotic balancing and repairing essence of the present invention can inhibit the expression of inflammatory factors and has a significant effect of inhibiting skin inflammation; it can restore the colonization of beneficial bacteria in the skin (Lactobacillus acidophilus, Staphylococcus capitis, Staphylococcus epidermidis), inhibit harmful bacteria (Staphylococcus aureus, Propionibacterium acnes, Malassezia), balance and rebuild the skin microecology; it can significantly increase the thickness of the skin stratum corneum and has the effect of repairing the skin barrier.

[0174] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A prebiotic balance repair essence, characterized in that: The invention comprises the following components in parts by weight: 1-11 parts of prebiotics, 1-3 parts of golden thread lotus extract, 1-4 parts of nicotinamide, 1-2 parts of tranexamic acid, 0.1-1 parts of moisturizer, 0.5-2 parts of preservative, 0.1-0.5 parts of collagen and 0.1-0.5 parts of fibronectin.

2. The prebiotic balance repair essence according to claim 1, characterized in that: The prebiotics include lactobacillus fermentation lysate and Sonora Desert Bacillus fermentation broth extract.

3. The prebiotic balance repair essence according to claim 1, characterized in that: The moisturizing agent includes at least one of hydrolyzed sodium hyaluronate, 1,3-butylene glycol, ethylene glycol, propylene glycol, sorbitol, mannitol, polyethylene glycol, polypropylene glycol, and polyvinyl alcohol.

4. The prebiotic balance repair essence according to claim 1, characterized in that: The preservative includes at least one of p-hydroxyacetophenone, 1,2-hexanediol and methyl ester.

5. The prebiotic balance repair essence according to any one of claims 1 to 4, characterized in that: The invention comprises the following components in parts by weight: 3-8 parts of lactobacillus fermentation lysate, 1-3 parts of Sonora Desert Bacillus fermentation broth extract, 1-3 parts of golden thread lotus extract, 1-4 parts of niacinamide, 1-2 parts of tranexamic acid, 0.1-1 parts of hydrolyzed sodium hyaluronate, 0.5-1 parts of p-hydroxyacetophenone, 0.5-1 parts of 1,2-hexanediol, 0.1-0.5 parts of collagen and 0.1-0.5 parts of fibronectin.

6. The prebiotic balance repair essence according to claim 5, characterized in that: The invention comprises the following components in parts by weight: 5 parts of lactobacillus fermentation lysate, 2 parts of Sonora Desert Bacillus fermentation broth extract, 2 parts of golden thread lotus extract, 2 parts of nicotinamide, 1 part of tranexamic acid, 0.1-1 part of hydrolyzed sodium hyaluronate, 0.5-1 part of p-hydroxyacetophenone, 0.5-1 part of 1,2-hexanediol, 0.1-0.5 part of collagen and 0.1-0.5 part of fibronectin.

7. A skin care product, characterized in that: The invention comprises the prebiotic balancing and repairing essence according to any one of claims 1 to 6.

8. A method for preparing the prebiotic balance repair essence according to any one of claims 1 to 6, characterized in that: The following steps are involved: (1) adding the nicotinamide, tranexamic acid, moisturizer and preservative into water and stirring evenly; (2) Add the prebiotics, collagen, fibronectin and roxburghii extract and stir evenly to obtain the product.

9. The method for preparing the prebiotic balance repair essence according to claim 8, characterized in that: In step (1): the stirring temperature is 70°C-85°C, and the stirring speed is 500rpm-1500rpm.

10. The method for preparing the prebiotic balance repair essence according to claim 8, characterized in that: In step (2): the stirring temperature is 40°C-50°C, and the stirring speed is 500rpm-1500rpm.

Images