Application of OSBPL3 in treatment of colorectal cancer

Abstract

The invention belongs to the technical field of biological medicines, and particularly discloses application of an OSBPL3 inhibitor in preparation of a medicine for treating and / or preventing colorectal cancer. By constructing an OSBPL3 knock-down mouse CRC model, it is clear that down-regulation of OSBPL3 can inhibit the progress of CRC of mice, through comparative analysis of a disease group and an intervention group, a tumor immune biological process containing intestinal microbiota-metabolite-differential genes is found, and it is clarified that down-regulation of OSBPL3 in vitro can promote proliferation of peste des petits ruminants and rhomonas rugosa. A CRC model of a flora transplantation mouse is constructed, and it is verified that when key microorganisms (peste des petits ruminants and rhodomonas) are applied to intestinal flora transplantation, the tumor immune surveillance function can be enhanced, and occurrence and development of CRC are inhibited.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of OSBPL3 in treating colorectal cancer. Background Art

[0002] Globally, the incidence of colorectal cancer (CRC) has risen to the third place among malignant tumors and has become the second leading cause of cancer-related deaths. The pathogenesis of CRC is multifaceted, involving intestinal microbiota dysbiosis, intestinal inflammatory changes, genetic factors, gene mutations, and environmental chemical factors. A high-fat, low-fiber diet is significantly associated with an increased risk of CRC. The early symptoms of CRC are usually not obvious and can be easily overlooked. Common symptoms include abdominal pain, bloating, changes in bowel habits (such as constipation or diarrhea), blood in the stool, anemia, etc. These symptoms may worsen in the late stage, and patients may experience systemic symptoms such as weight loss, fatigue, and loss of appetite. The current diagnosis of CRC mainly relies on electronic colonoscopy combined with histopathological examination, which can directly observe changes in the colorectal mucosa and perform biopsies to determine whether there is canceration; in addition, it can also be assisted by tumor marker detection such as blood or stool, imaging examinations, and even multi-omics combined analysis. At present, the main treatment for CRC is surgical resection, supplemented by comprehensive treatments such as radiotherapy, chemotherapy, molecular targeted therapy, or immunotherapy. However, even in patients who undergo surgical resection, the rate of local or distant recurrence within five years remains high.

[0003] In recent years, the relationship between intestinal microbiota and CRC has attracted significant attention. The human intestine is a complex ecosystem of trillions of microorganisms including bacteria, viruses, fungi and archaea, collectively referred to as the intestinal microbiota. These microorganisms play a vital role in maintaining intestinal homeostasis, regulating immune responses and affecting various physiological processes. Studies have found that the imbalance of intestinal microorganisms is closely related to the occurrence and development of tumors. Intestinal microorganisms can affect the occurrence of tumors through various pathways, including regulating immune responses, affecting intestinal mucosal barriers, and producing metabolites. For example, certain intestinal microorganisms can inhibit the growth and spread of tumors by activating immune cells and enhancing anti-tumor immune responses. In addition, intestinal microorganisms can also regulate the growth and apoptosis of tumor cells by producing metabolites, such as short-chain fatty acids. Therefore, studying the relationship between intestinal microorganisms and tumors is of great significance for discovering new tumor therapeutic targets and developing new strategies for tumor treatment. Therefore, studying the tumor biological targets and regulatory mechanisms of CRC, especially clarifying the relationship between CRC and intestinal microorganisms, is of practical significance in contemporary oncology research.

[0004] Oxysterol Binding Protein-Like 3 (OSBPL3), also known as ORP-3, ORP3, and OSBP3, is a member of the OSBP family. It consists of 23 exons and is predicted to encode a protein of 887 amino acids. The inventor's previous studies found that overexpression of OSBPL3 is closely related to the prognosis of CRC. The researchers conducted a long-term follow-up of a group of CRC patients and analyzed the expression level of OSBPL3 in their tumor tissues. The results showed that high expression of OSBPL3 was associated with a significant decrease in the survival rate of patients; further analysis found that high expression of OSBPL3 was closely related to clinical pathological characteristics such as tumor stage, lymph node metastasis, and distant metastasis, suggesting that the expression level of OSBPL3 can be used as an important indicator for the prognosis of CRC patients. However, the current research on the expression and function of OSBPL3 in CRC is still in its infancy, especially its potential role in the occurrence and development of CRC by regulating intestinal microorganisms has not been explored in depth. Summary of the invention

[0005] The first aspect of the present invention aims to provide a use of an OSBPL3 inhibitor.

[0006] The second aspect of the present invention aims to provide a shRNA.

[0007] The third aspect of the present invention aims to provide biological materials related to the shRNA of the second aspect of the present invention.

[0008] The fourth aspect of the present invention aims to provide the use of the shRNA of the second aspect of the present invention and / or the biomaterial of the third aspect of the present invention.

[0009] The fifth aspect of the present invention aims to provide a product.

[0010] The sixth aspect of the present invention aims to provide the use of Eubacterium ruminantum and / or Roseomonas in the preparation of drugs for treating and / or preventing colorectal cancer.

[0011] The seventh aspect of the present invention aims to provide a medicine.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] The first aspect of the present invention provides the use of an OSBPL3 inhibitor in at least one of (1) to (5):

[0014] (1) Preparation of drugs for treating and / or preventing colorectal cancer;

[0015] (2) inhibiting the proliferation, migration and / or invasion of CRC cells;

[0016] (3) preparing products for inhibiting proliferation, migration and / or invasion of CRC cells;

[0017] (4) promoting the proliferation of Eubacterium ruminantum and / or Roseomonas;

[0018] (5) Prepare products that promote the proliferation of Eubacterium ruminantum and / or Roseomonas.

[0019] In some embodiments of the present invention, the OSBPL3 inhibitor is at least one of a substance that inhibits OSBPL3 activity, a substance that degrades OSBPL3, or a substance that reduces the expression level of OSBPL3; further, at least one of a substance that reduces the expression level of OSBPL3.

[0020] In some embodiments of the present invention, the substance that reduces the expression level of OSBPL3 is at least one of (6) to (8):

[0021] (6) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting OSBPL3;

[0022] (7) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting OSBPL3 described in (6);

[0023] (8) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (7).

[0024] In some embodiments of the present invention, the OSBPL3 inhibitor is at least one of (9) to (11):

[0025] (9) shRNA targeting OSBPL3;

[0026] (10) a nucleic acid molecule encoding the shRNA targeting OSBPL3 described in (9);

[0027] (11) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (10).

[0028] In some embodiments of the present invention, the nucleotide sequence of the shRNA is as shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; further, the nucleotide sequence is as shown in SEQ ID NO: 2.

[0029] According to a second aspect of the present invention, a shRNA is provided, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.

[0030] In some embodiments of the present invention, the nucleotide sequence of the shRNA is shown in SEQ ID NO:2.

[0031] The third aspect of the present invention provides a biological material related to the shRNA of the second aspect of the present invention, wherein the biological material comprises any one of 1) to 12):

[0032] 1) A nucleic acid molecule encoding the shRNA of the second aspect of the present invention;

[0033] 2) an expression cassette comprising the nucleic acid molecule described in 1);

[0034] 3) a vector comprising the nucleic acid molecule described in 1);

[0035] 4) a vector comprising the expression cassette described in 2);

[0036] 5) A transgenic cell line comprising the nucleic acid molecule described in 1);

[0037] 6) A transgenic cell line comprising the expression cassette described in 2);

[0038] 7) A transgenic cell line comprising the vector described in 3);

[0039] 8) A transgenic cell line comprising the vector described in 4);

[0040] 9) A recombinant microorganism containing the nucleic acid molecule described in 1);

[0041] 10) a recombinant microorganism containing the expression cassette described in 2);

[0042] 11) A recombinant microorganism containing the vector described in 3);

[0043] 12) A recombinant microorganism containing the vector described in 4).

[0044] In some embodiments of the invention, the transgenic cell line does not contain reproductive material.

[0045] In some embodiments of the present invention, the vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a bacteriophage, a cosmid, a F cosmid, or an artificial chromosome.

[0046] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, and the viral vector may be an optional virus.

[0047] The fourth aspect of the present invention provides the use of the shRNA of the second aspect of the present invention and / or the biomaterial of the third aspect of the present invention in any one of a1) to a5):

[0048] a1) preparing drugs for treating and / or preventing colorectal cancer;

[0049] a2) inhibiting the proliferation, migration and / or invasion of CRC cells;

[0050] a3) preparing a product for inhibiting proliferation, migration and / or invasion of CRC cells;

[0051] a4) promoting the proliferation of Eubacterium ruminantium and / or Roseomonas;

[0052] a5) Preparing a product that promotes the proliferation of Eubacterium ruminantium and / or Roseomonas.

[0053] In some embodiments of the present invention, the product includes a drug, a reagent and / or a kit.

[0054] The fifth aspect of the present invention provides a product, which is the shRNA of the second aspect of the present invention and / or the biomaterial of the third aspect of the present invention.

[0055] In some embodiments of the present invention, the product has at least one of the following functions:

[0056] (1) Inhibit the proliferation, migration and / or invasion of CRC cells;

[0057] (2) Promote the proliferation of Eubacterium ruminantium and / or Roseomonas.

[0058] In some embodiments of the present invention, the product further comprises a pharmaceutically acceptable carrier, including but not limited to: a diluent, a buffer, a suspension, an emulsion, a granule, an encapsulation, an excipient, a filler, an adhesive, a spray, a transdermal absorbent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent or an adsorption carrier.

[0059] A sixth aspect of the present invention provides the use of Eubacterium ruminantum and / or Roseomonas in the preparation of a medicament for treating and / or preventing colorectal cancer.

[0060] The seventh aspect of the present invention provides a medicine comprising Eubacterium ruminantum and / or Roseomonas.

[0061] In some embodiments of the present invention, the Eubacterium ruminantum and / or Roseomonas include a bacterial suspension or a culture supernatant of Eubacterium ruminantum and / or Roseomonas.

[0062] In some embodiments of the present invention, the drug contains 0.1 to 10×10 9 CFU / mL of Eubacterium ruminantium and / or Roseomonas .

[0063] In some embodiments of the present invention, the dosage form of the drug is selected from tablets (such as ordinary tablets, double-layer tablets, multi-layer tablets, sustained-release tablets, single-chamber controlled-release tablets, double-chamber controlled-release tablets, microporous controlled-release tablets, sublingual tablets, orally rapidly disintegrating tablets, dispersible tablets, enteric-coated tablets), pills, powders, suspensions, gels, emulsions, creams, granules, nanoparticles, capsules (such as ordinary capsules, sustained-release capsules, controlled-release capsules, capsules containing micropellets or small tablets, pH-dependent capsules containing micropellets or small tablets, gastrointestinal composite capsules), suppositories, injections, sprays and injections.

[0064] In some embodiments of the present invention, the drug further comprises a pharmaceutically acceptable excipient.

[0065] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of fillers, disintegrants, diluents, dispersants, excipients, stabilizers, lubricants, binders, wetting agents, flavoring agents, suspending agents, solvents, sustained-release agents, emulsifiers, absorption enhancers, surfactants, preservatives, pigments, flavors and solvents.

[0066] In some embodiments of the present invention, the filler is selected from starch, sucrose, lactose, mannitol, sorbitol, xylitol, microcrystalline cellulose or glucose; the binder is selected from cellulose derivatives, alginate, starch, water, dextrin, gelatin or polyvinyl pyrrolidone; the disintegrant is selected from microcrystalline cellulose, sodium carboxymethyl starch, cross-linked polyvinyl pyrrolidone, low-substituted hydroxypropyl cellulose or cross-linked sodium carboxymethyl cellulose; the lubricant is selected from stearic acid, polyethylene glycol, calcium carbonate, sodium bicarbonate, micro-powder silica gel, talc or magnesium stearate; the suspending agent is selected from micro-powder silica gel, beeswax, cellulose, solid polyethylene glycol : The wetting agent is selected from glycerol, Tween-80, hydrogenated castor oil or lecithin; the solvent is selected from ethanol, liquid polyethylene glycol, isopropanol, Tween-80, glycerol, propylene glycol or vegetable oil, and the vegetable oil is selected from soybean oil, castor oil, peanut oil, blending oil, etc.; the surfactant is selected from sodium dodecylbenzene sulfonate, stearic acid, polyoxyethylene-polyoxypropylene copolymer, fatty acid sorbitan or polysorbate (Tween), etc.; the flavoring agent is selected from aspartame, sucralose, flavor, stevioside, acesulfame potassium, citric acid or saccharin sodium; the preservative is selected from at least one of methyl paraben or propyl paraben.

[0067] The beneficial effects of the present invention are:

[0068] The present invention has established an OSBPL3 knockdown mouse CRC model to clarify that downregulation of OSBPL3 can inhibit the progression of mouse CRC, and through comparative analysis between the disease group and the intervention group, discovered a tumor immune biological process involving intestinal microbiota-metabolites-differential genes, and clarified that in vitro downregulation of OSBPL3 can promote the proliferation of Eubacterium ruminantum and Roseomonas. A microbiota transplantation mouse CRC model was constructed to verify that the application of key microorganisms (Eubacterium ruminantum and Roseomonas) for intestinal flora transplantation can enhance tumor immune surveillance function and inhibit the occurrence and development of CRC. This provides further insights into the potential mechanism by which OSBPL3 regulates intestinal microbial homeostasis and thus intervenes in the occurrence and development of CRC, and provides a new theoretical basis for the subsequent diagnosis and treatment of CRC based on intestinal microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 Flow chart for the construction and processing of orthotopic transplantation animal models.

[0070] Figure 2 Flow chart for the construction and processing of subcutaneous tumor-bearing animal models.

[0071] Figure 3 The figures are the culture, transfection and screening of CT26 cells; A is the screening of OSBPL3 knockdown vector, B and C are the verification of OSBPL3 knockdown at RNA and protein levels by RT-qPCR and WB, respectively; in the figure, ns means p>0.05, ** means p<0.01, *** means p<0.001.

[0072] Figure 4 The proliferation ability of CRC cells with knockdown of OSBPL3; A is the evaluation of cell proliferation in different CRC cell groups using CCK-8 assay, B is the evaluation of the proliferation ability of CRC cells using EdU assay and presents representative immunofluorescence images, C is the measurement of OSBPL3 RNA expression in different CRC cell groups using RT-qPCR, and D is the measurement of OSBPL3 protein expression in different CRC cell groups using WB. Three independent experiments were performed on each cell line. In the figure, ns means p>0.05, * means p<0.05, ** means p<0.01, and *** means p<0.001.

[0073] Figure 5Apoptosis, migration and invasion of CRC cells with knockdown of OSBPL3; A is the apoptosis of CRC cells in different groups detected by flow cytometry, B is the cell scratch test that reveals the migration ability of CRC cells, and C is the Transwell assay that quantifies the number of invasive cells. Three independent experiments were performed on each cell line. In the figure, ns means p>0.05, * means p<0.05, ** means p<0.01, and *** means p<0.001.

[0074] Figure 6 For the collection and measurement of animal biological samples; A is the colorectal cross-section of each group of mice, showing the number and volume of tumors in the intestine, B is the time-weight trend of each group of mice, and C is the number of tumors in the colorectal area of ​​each group of mice; in the figure, ** represents p < 0.01, and *** represents p < 0.001.

[0075] Figure 7 GO and KEGG enrichment analysis of DEGs in OSBPL3 high and low expression groups; A is the GO enrichment result, and B is the KEGG enrichment result.

[0076] Figure 8 Figure 2 shows the diversity of the intestinal microbiota composition of the three groups of mice; A to E are α diversity: A and B show the number of species, C and D show species diversity, E shows species uniformity, and F to H are PCA, PCoA and NMDS analyses, respectively, which are used to further determine the β diversity of the intestinal microbiota among the three groups.

[0077] Fig. 9 is the composition of intestinal microorganisms among the three groups; A is the proportion of the three groups of intestinal microorganisms at the phylum level, and B is the proportion of the three groups of intestinal microorganisms at the genus level.

[0078] Fig.10 Correlation analysis between differential metabolites and differential intestinal microorganisms.

[0079] Fig.11 To construct a tumor immune biological process-shared DEGs-differential metabolites-differential intestinal microbial relationship network.

[0080] Fig.12 To extract the biological process network with the highest correlation with tumor immunity.

[0081] Fig.13The use of Eubacterium ruminantum and Roseomonas for microbiota transplantation can enhance tumor immune surveillance and inhibit CRC tumor progression; A is the screening of key microorganisms, B is the experimental process of bacterial culture in tumor supernatant, C is the number of colonies of Eubacterium ruminantum and Roseomonas after 12 hours and 24 hours of culture, D is the time-weight trend of each group of mice, and E is the display of subcutaneous tumor-bearing conditions of each group of mice, showing the volume of the tumor. F is the statistical analysis of the tumor volume of each group of mice, and G is the percentage of CD8+T cells in the CT26 subcutaneous tumor treated as above by flow cytometry analysis; in the figure, * represents p < 0.05, ** represents p < 0.01, and *** represents p < 0.001. DETAILED DESCRIPTION

[0082] The present invention is further described in detail below through specific examples.

[0083] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0084] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0085] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0086] The present invention uses SPF-grade BALB / C mice for animal modeling. The experimental animals were purchased from the Experimental Animal Center of Guangdong Medical University. The purchase, use and ethical review of animal experiments were approved by the Experimental Animal Ethics Committee of Guangdong Medical University (approval number: GDY2302536).

[0087] Experimental methods

[0088] 1. Construction of CT26 cell line stably transfected with sh-OSBPL3

[0089] Lentiviral plasmids containing shRNA sequences targeting OSBPL3 gene were designed and constructed. The sequences of shRNA are as follows: sh-OSBPL3-1: GGTCCAGAGCTATTGGCAAAG (SEQ ID NO: 1), sh-OSBPL3-2: GCTATTGGCAAAGATGCTAAA (SEQ ID NO: 2), sh-OSBPL3-3: GGCAAAGATGCTAAAGGAACG (SEQ ID NO: 3). Specifically, three shRNAs-OSBPL3 (sh-OSBPL3-1, sh-OSBPL-3-2 and sh-OSBPLL3-3) and non-specific sh-NormalControl (sh-NC) sequences were cloned into pLVsh-EGFP(2A)Puro-vector to construct pLVsh-OSBPL3-EGFP(2A)Puro-SH and pLVsh-NC-EGFP(2A)Puro-SH plasmids. RT-qPCR was used to screen the best interference vector in sh-OSBPL3 lentivirus and verify the infection efficiency of sh-OSBPL3 lentivirus. The interference efficiency of sh-OSBPL3 lentivirus was verified by western blot analysis. Subsequently, CRC cells were cultured with lentiviral particles to achieve stable expression of shRNA.

[0090] 24 hours before lentiviral infection, adherent cells were plated at 3×10 5 10 cells / well were plated in a 6-well plate. The number of cells during lentiviral transfection was 6×10 5 / well; when the cell adhesion and fusion degree reaches 70%, replace the original culture medium with 2mL fresh culture medium containing 1μg / mL polybrene, and add 2mL virus suspension. Continue to culture at 37℃ for 8 hours, and replace the culture medium containing virus with fresh culture medium. If the lentivirus contains fluorescent protein, fluorescent expression can generally be seen 48 hours after transfection, and it is more obvious after 72 hours. The CRC cell infection efficiency can be observed under a fluorescent microscope 48 to 72 hours after virus infection. If the effect is not good, repeat the infection. After successful infection, add 1μg / mL puromycin for screening. After 2 weeks, the drug concentration is halved. After continuous screening for 1 month, a stable transfected cell line is obtained to identify the expression of OSBPL3.

[0091] 2.CCK-8 cell viability assay

[0092] Collect CRC cells and count them, and adjust the cell suspension to 1×10 3Each well (100 μL) was inoculated in a 96-well plate, and 100 μL PBS buffer was added to the outermost well. The cells were placed in a 5% CO2, 37°C incubator and cultured for different time points (0, 12, 24, 48 hours). Five replicate wells were set up in each group, and 10 μL CCK-8 solution was directly added to each well, and incubated in a 5% CO2, 37°C incubator for 2 hours. The 96-well plate was taken out, and the OD value of each well at a wavelength of 450nm was detected by an ELISA instrument to draw a proliferation curve.

[0093] 3. EdU cell proliferation assay

[0094] Collect CRC cells and count them, and adjust the cell suspension to 2 × 10 5 1 / well were evenly inoculated in a 12-well plate with a pre-mounted slide and cultured for 48 hours. 2×EdU solution was added to an equal volume of culture medium and incubated in a 5% CO2, 37°C incubator for 2 hours. The culture medium was removed, 0.5mL of 4% paraformaldehyde was added, and the cells were fixed at room temperature for 20 minutes. The fixative was removed, 0.5mL of 0.3% Triton X-100 permeabilization agent was added after washing 3 times with PBS buffer, and the cells were incubated at room temperature for 20 minutes. The permeabilization agent was removed, 200μL of Click reaction solution was added after washing 3 times with PBS buffer, and the cells were incubated at room temperature in the dark for 30 minutes. The Click reaction solution was removed, PBS buffer was washed 3 times, and anti-fluorescence attenuation mounting medium containing DAPI was added, and the cells were incubated at room temperature for 10 minutes, and photographed and saved.

[0095] 4. Flow cytometry cell apoptosis detection

[0096] Collect CRC cells and count them, and adjust the cell suspension to 2 × 10 5Cells / well were evenly inoculated in a 6-well culture plate. When the cells were well attached to the wall, they were grouped according to the experimental design and treated accordingly. The cells were incubated for 24 hours. The culture medium containing a small amount of suspended cells was collected in a centrifuge tube. The cells in the 6-well plate were washed 3 times with PBS buffer, and 1 mL of 0.25% trypsin without EDTA was added to digest the cells. When the cells became round and some cells were suspended, the culture medium collected in step 2 was immediately added to terminate the digestion. The cells were gently blown with a pipette to form a suspension and collected in a centrifuge tube. Centrifuged at 1500r / min for 5 minutes and the supernatant was discarded. After adding 2 mL of 4°C pre-cooled PBS, the cells were gently blown with a pipette for washing. The cells were collected by centrifugation at 1500r / min for 5 minutes and washed 3 times in total. 100μL of 1×Binding buffer working solution was added to the cell pellet and the cells were resuspended. 5μL of Annexin V-FITC was added and mixed, and then 5μL of Propidium Iodide was added and mixed. Incubate at room temperature in the dark for 15 minutes. After staining and incubation, add 400 μL of 1× Binding Buffer working solution to each tube and mix well, and immediately test on the instrument.

[0097] 5. Scratch test

[0098] Collect cells and count them, and adjust the cell suspension to 2 × 10 5 Cells / well were evenly inoculated in a 6-well culture plate, and 2 mL of RPMI-1640 medium containing 10% FBS was added. Culture was carried out under 5% CO2 and 37°C. When the cell density reached 100%, the medium was removed and replaced with RPMI-1640 medium without FBS to continue culture. Use a 200 μL pipette tip to make three scratches on the bottom of the 6-well plate. Wash the scratched cells three times with PBS buffer, replace with fresh RPMI-1640 medium without PBS, and continue culture under 5% CO2 and 37°C. Observe and take pictures of the same position at 0 hours and 24 hours after the scratch. Use Image J to open the picture, use the scratch edge as the boundary on both sides, randomly draw 5 horizontal lines, calculate the mean distance between cells on both sides of the scratch edge, and perform statistical analysis.

[0099] 6. Transwell invasion assay

[0100] Matrigel was melted in a 4°C refrigerator, and the EP tubes and gun tips used in the experiment were pre-cooled in a -20°C refrigerator. The entire experimental operation was performed on an ice box. Dilute Matrigel with RPMI-1640 medium without FBS, stir evenly and gently add it to the Transwell chamber, and then incubate in a 5% CO2, 37°C incubator for 2 hours. After incubation, remove the liquid in the upper chamber of the Transwell chamber, add 100 μL of RPMI-1640 medium without FBS to each well, and place it in a 5% CO2, 37°C incubator for 30 minutes. Take logarithmic phase CRC cells for digestion and resuspend them in RPMI-1640 medium without FBS, and adjust the cell density of the cell suspension to 5×105 / mL. Carefully place the Transwell chamber in a 24-well plate, add 200 μL of cell suspension to the upper chamber, add 500 μL of RPMI-1640 medium containing 10% FBS to the lower chamber, and culture in a 5% CO2, 37°C incubator for 24 hours. Wash with PBS three times, and carefully wipe the cells and Matrigel in the upper chamber with a sterile cotton swab, then add 4% paraformaldehyde for fixation. Add 0.1% crystal violet for staining for 30 minutes, wash with PBS three times, and then place the Transwell chamber under a microscope, take 5 different fields of view, count the number of invasive cells in each field of view, and set up 3 duplicate wells for each group.

[0101] 7. Construction of orthotopic transplantation animal model and collection of biological samples

[0102] Eighteen BALB / C mice were randomly divided into three groups by coded lottery: control group (control), CRC group (CRC) and sh-OSBPL3 group (sh-OSBPL3).

[0103] The study used submucosal injection of the rectum to model the model and tail vein injection of the tail vein to intervene ( Figure 1 ). In a sterile environment, the mice were fixed in a supine position with hands, the anus was fully exposed and disinfected, and a 1 ml syringe was used to insert the needle into the rectal mucosa 2 mm above the dorsal anal margin. The injection was performed at 3, 6, and 9 points in the lithotomy position. The needle insertion site was clamped with ophthalmic forceps. After the needle was removed, it was clamped immediately, and a sterile cotton swab was used to press until no bleeding occurred. During the intervention, the mice were placed in the same position, and a sterile cotton swab was used to press until no bleeding occurred after the tail vein injection.

[0104] The mice in the control group were injected with 100 μL saline, and 2 weeks later, 100 μL saline was intravenously injected; the mice in the CRC group were injected with 100 μL CT26 cells (5×10 6 / mL, stable cell line screened by sh-NC lentivirus), and 100 μL sh-NC lentivirus (1×10 8TU / mL); mice in the sh-OSBPL3 group were injected with 100 μL CT26 cells (5×10 6 After 2 weeks, 100 μL of sh-OSBPL3 lentivirus (1×10 8 TU / mL).

[0105] The body weight of each group of mice was calculated on intervention days 0, 3, 6, 9, 12, 15 and 17. On intervention day 18, the three groups of mice were killed by cervical dislocation after anesthesia, and the complete colorectal tissues were collected for colorectal tumor counting. At the same time, the feces, blood and colorectal tissues of the three groups of mice were collected for subsequent 16S rRNA, metabolome and transcriptome sequencing analysis.

[0106] 16S rRNA gene sequencing and data preprocessing: The mouse fecal sample was allowed to stand at room temperature for 10 minutes, 1.2 mL of inhibitEX Buffer was added to a 2 mL centrifuge tube and 150 mg of fecal sample was added, and the sample was shaken until the sample was completely mixed. After incubation at 50°C for 5 minutes, the sample was shaken again, and then centrifuged at 1500 r / min for 2 minutes. 500 μL of the supernatant was taken into an EP tube and centrifuged at 1500 r / min for 2 minutes. 400 μL of fecal suspension was placed in a new EP tube, and 30 μL of proteinase K and 400 μL of buffer AL were added, and the sample was shaken. Incubated at 70°C for 10 minutes. 400 μL of anhydrous ethanol was added and shaken. After being placed in the adsorption column, the sample was centrifuged at 1500 r / min for 2 minutes, and 50 μL of buffer AW1 and AW2 were added in sequence, and the sample was centrifuged several times. Transfer the adsorption column to a new EP tube, add 200 μL bufferATE, incubate at room temperature for 5 minutes, centrifuge at 3500 r / min for 2 minutes, and obtain the sequencing sample. The sample was submitted to Guangzhou Lucheng Biotechnology Co., Ltd. for quality inspection and sequencing according to the inspection requirements (the corresponding primers were designed according to the conserved region of the 16S rDNA / ITS2 sequence, and the extracted total DNA was used as a template. One-step PCR was performed using Phusion enzyme, and the amplified product was amplified for 35 cycles. The amplified product of the target region was PCR-introduced into the sequencing universal connector and sample-specific barcode sequence. The product was purified and recovered using a kit (AxyPrep PCR Cleanup Kit). Then, the purified PCR product was quantified and mixed using the Quant-iT PicoGreen dsDNA Assay Kit on the Promega QuantiFluor system. Finally, double-end sequencing was performed on the Illumina HiSeq PE250 sequencing platform according to standard procedures). After completing the sequencing on the machine, the original off-machine data, namely RawData, was obtained. The double-end data were spliced ​​together using the overlap method, and then quality control and chimera filtering were performed to generate high-quality CleanData. The DADA2 algorithm was used, which uses steps such as "deduplication" (100% similarity clustering) to obtain representative sequences with single-base accuracy. Subsequently, the concept of Amplicon Sequence Variants (ASVs) was applied to construct the Operational Classification Unit (OTU) table to generate the final ASV feature table and feature sequence. SILVA (Release 138, https: / / www.arb-silva.de / documentation / release-138 / ) and NT-16S databases were further used for species classification and subsequent analysis, with annotation threshold: CI>0.7.The analysis included diversity analysis, species taxonomic annotation, and differential analysis.

[0107] Metabolomics sequencing and data preprocessing: The collected blood samples were thawed on ice, and metabolites were extracted using precooled 50% methanol. After shaking and incubating at room temperature for 10 minutes, the extraction solution was stored at 4°C. Subsequently, the extraction solution was placed in a centrifuge tube and centrifuged at 4°C and 3500r / min for 5 minutes to separate the supernatant. 200μL of the supernatant was placed in an EP tube, divided into multiple tubes, and stored at -80°C. The samples were submitted to Guangzhou Lucheng Biotechnology Co., Ltd. for quality inspection and sequencing according to the requirements of the inspection (each extraction solution was supplemented with the prepared QC sample before analysis. Chromatographic separation was performed using a UPLC system with specific columns and gradient elution conditions. LC-MS analysis was performed using a high-resolution tandem mass spectrometer Triple TOF 5600plus, operating in positive or negative ion mode. Mass spectrometry data was collected using the information-dependent acquisition (IDA) mode with appropriate parameters. The stability of the mass spectrometer was evaluated by collecting quality control samples throughout the acquisition process). The raw mass spectrometry data were converted into a readable format mzXML using the MSConvert program based on Proteowizard software. Then, quality control was performed using XCMS software. Next, the extracted substances were annotated using CAMERA. Finally, metabolites were identified using metaX software by matching the primary mass spectrometry information with a database and the secondary mass spectrometry information with an internal standard product database.

[0108] Transcriptome sequencing and data preprocessing: Sample extraction was the same as 16S rRNA gene sequencing. The samples were sent to Guangzhou Lucheng Biotechnology Co., Ltd. for quality inspection and sequencing (using Invitrogen SuperScript TM II reverse transcriptase (No.1896649) was used to synthesize the first-strand cDNA. Subsequently, E. coli DNA polymerase I (NEB, item number m0209) and RNase H (NEB, item number m0297) were used to synthesize the second-strand cDNA. After the cDNA ends were repaired using dUTP solution, an A-tail was added. After magnetic bead screening and purification, the second-strand cDNA was selectively digested using UDG enzyme (NEB, item No. m0280). A 300 bp ± 50 bp cDNA library was then constructed by PCR amplification. Finally, the cDNA was amplified using the Illumina Novaseq TMThe cDNA library was sequenced with double-end PE150 on the 6000 platform). The raw data was preprocessed, and the low-quality data was cleaned to obtain high-quality CleanData. The mRNA sequencing numerical alignment used the alignment tool Hisat2 with default parameters to align the sequencing data of CleanData with the reference genome (GRCm39). Through alignment analysis, the alignment rates of the sequencing samples were all above 90%, indicating that they had a high alignment rate and were not affected by exogenous RNA interference, meeting the requirements of subsequent data analysis. In order to observe the expression level of each sample, FeatureCount was used to extract the gene expression value.

[0109] 8. Bioinformatics analysis of sequencing data and multi-omics joint analysis to construct biological process networks

[0110] Bioinformatics analysis of 16S rRNA gene sequencing: QIME and R software were used to analyze the diversity of intestinal microorganisms among the control group, CRC group, and sh-OSBPL3 group. The richness and evenness of α diversity were mainly reflected by Chao1, Observed species, Shannon, Simpson, and Pielou-e indices; β diversity was mainly evaluated by PCA, PCoA, and NMDS. In addition, the proportion of intestinal microorganisms among the three groups was examined at the phylum and genus levels. The LEfSe method was used to compare the intestinal microbial composition among the three groups, and LDA score >3 and P <0.05 were used as the threshold score for identifying different intestinal microorganisms. In order to predict and compare the intestinal microbial functions among different groups, PICRUSt2 and STAMP software were used to analyze the differential microorganisms between the groups (control group and CRC group, CRC group and sh-OSBPL3 group).

[0111] Bioinformatics analysis of metabolome sequencing: First, the metabolic data were annotated through the HMDB database to identify metabolites. Then, metabolite enrichment analysis was performed based on the KEGG database. PLS-DA and PCA were performed to analyze the metabolites between groups (control group and CRC group, CRC group and sh-OSBPL3 group) to determine whether there were significant differences in the metabolites of different groups.

[0112] Bioinformatics analysis of transcriptome sequencing: The DESeq2 software package was used to identify the differentially expressed gene sets DEGs1 (CRC group vs. control group) and DEGs2 (sh-OSBPL3 group vs. CRC group) in the transcriptome sequencing data (p<0.05, |log2FC|>1). Further, DEGs1 and DEGs2 were intersected to obtain shared DEGs. Finally, the clusterProfiler software package was used to perform enrichment analysis based on the GO database and the KEGG database (adj.P. value <0.05) to explore the signal pathways enriched in DEGs1, DEGs2, and shared DEGs.

[0113] Combined analysis of 16S rRNA gene sequencing and metabolomics sequencing: The study applied the DMOA mode of MetOrigin for analysis. First, the metabolites between groups (control group and CRC group, CRC group and sh-OSBPL3 group) were tracked, and the co-metabolites were obtained by the crossover between host and microbiome metabolites, respectively. Then, enrichment analysis was performed on different metabolites from different sources (host, microbiome, and co-metabolites) (P<0.05). In addition, Pearson analysis was used to analyze the correlation between different metabolites and different intestinal microorganisms. Finally, in the CRC group and the sh-OSBPL3 group, the intestinal microbe-metabolite-pathway network diagram of the top 5 important pathways in co-metabolism was drawn.

[0114] Combined analysis of transcriptome sequencing and metabolomics sequencing: The correlation (cor>0.4) between shared DEGs and different metabolites from the host was analyzed between the groups (control group and CRC group, CRC group and sh-OSBPL3 group), and a shared DEGs-differential metabolite network was constructed. In addition, the intersections between the significantly enriched pathways in the shared DEGs and the significantly enriched pathways in the host metabolism were obtained, and the crossed pathways were displayed.

[0115] Combined analysis of transcriptome sequencing, metabolomics sequencing, and 16S rRNA gene sequencing: Correlation analysis was performed between differential metabolites of cross-pathways and differential intestinal microorganisms (cor>0.4). In addition, based on the above relationship pairs with correlation greater than 0.4, shared DEGs-differential metabolites-differential microbiota were screened for network construction. Finally, the shared DEG-rich tumor immune biological processes were included in the biological process-shared DEGs-differential metabolites-differential microbial network. In the network, the tumor immune biological processes with the largest number of connected shared DEGs were extracted and displayed, and the key microorganisms in the biological process network were located using p<0.05,|log2FC|>1 as the screening criteria.

[0116] 9. Construction of subcutaneous tumor-bearing animal model and collection of biological samples

[0117] Twelve BALB / C mice were randomly divided into four groups by coded lottery: CRC group (CRC), Eubacterium ruminantium group (Er), Roseomonas group (Rs) and combined bacterial group (Er+Rs). Mice were injected subcutaneously to form tumors, and key intestinal microorganisms and bacterial flora mixtures (Er:Rs colony count was 1:1) were used for intestinal flora transplantation by enema ( Figure 2 ).

[0118] Preparation of microbial enema solution: The intestinal microorganisms used in the experiment were isolated, cultured and prepared as a microbial mixture from the feces of sh-OSBPL3 group mice by the Digestive Disease Center Laboratory of Jiangmen Central Hospital.

[0119] Subcutaneous tumor model establishment: The subjects were placed in a supine position under sterile conditions, with their hands fixed, and the right axilla fully exposed and disinfected. A 1 ml syringe was used to insert the needle into the right axilla, and 100 μL CT26 cells (5×10 6 / mL), clamp the needle insertion site with ophthalmic forceps, clamp it immediately after the needle is removed, and use a sterile cotton swab to press until there is no bleeding.

[0120] Enema intervention was performed on the second day of modeling: mice were placed in the same posture as above, and an 8# pediatric urinary catheter was inserted into the mouse colon 4 cm away from the anal verge to inject enema solution. After the injection, the mice were kept vertically inverted for 1 minute. Mice in the CRC group were given 0.5 mL of normal saline enema once a day; the ruminant Eubacterium group (Er), Roseomonas group (Rs) and combined bacterial group (Er+Rs) were given 0.5 mL of intestinal microbial flora solution for enema, and the enema solution flora concentration was 1×10 9 CFU / mL, once a day. The four groups of mice were intervened for 18 consecutive days. The body weight of each group of mice was calculated on the 0th, 3rd, 6th, 9th, 12th, 15th and 17th days of intervention. The four groups of mice were killed by cervical dislocation after anesthesia on the 18th day of intervention, and the subcutaneous tumors were collected, weighed, measured and detected by flow cytometry.

[0121] SPSS22.0 statistical software and R software were used to process and analyze the experimental and sequencing data. The numerical data were expressed as mean ± standard deviation (mean ± SD). One-way ANOVA was used for comparison among multiple groups. Kruskal-Wallis rank sum test and Wilcoxon rank sum test were used to compare the differences between multiple groups and between two groups, respectively. p < 0.05 was considered statistically significant.

[0122] Experimental Results

[0123] 1. In vitro experiments suggest that OSBPL3 promotes tumor proliferation, invasion, migration and reduces tumor apoptosis

[0124] The gene silencing efficiency was evaluated by RT-qPCR to identify the most effective knockdown vector. The results showed that compared with the sh-NC group, the expression of OSBPL3 gene in the sh-OSBPL3-1, sh-OSBPL-3-2 and sh-OSBPLL3-3 groups was significantly reduced, among which the expression in the sh-OSBPL 3-2 group decreased most significantly ( Figure 3 Therefore, the sh-OSBPL3-2 vector was selected for subsequent experiments. The infection efficiency of the sh-OSBPL3 lentivirus was further confirmed at the molecular and protein levels. The expression level of the OSBPL3 gene in the sh-OSBPL3 group was significantly lower than that in the sh-NC group ( Figure 3 Similarly, the expression level of OSBPL3 protein in the sh-OSBPL3 group was significantly decreased compared with that in the sh-NC group ( Figure 3 Middle C). These findings confirm the successful establishment of a stable OSBPL3 knockdown cell line that can be used for further analysis.

[0125] To investigate whether knocking down OSBPL3 affects cell proliferation, CRC cells were first cultured and observed in the control group and sh-OSBPL3 group by CCK-8 cell viability assay. The results showed that the cell proliferation rate in the sh-OSBPL3 group was slower than that in the control group ( Figure 4 In addition, EdU cell proliferation assay also showed the same trend ( Figure 4 RT-qPCR results showed that OSBPL3 mRNA expression was higher in the control group and sh-NC group compared with the sh-OSBPL3 group ( Figure 4 Similarly, WB also showed that the expression level of OSBPL3 was higher in the control group and sh-NC group compared with the sh-OSBPL3 group ( Figure 4 In addition, flow cytometry was performed to observe the effect of knockdown of OSBPL3 on the apoptosis level of HT29 cells and SW480 cells. The results showed that knockdown of OSBPL3 led to increased apoptosis levels in both cell lines ( Figure 5 The effects of OSBPL3 knockdown on the migration and invasion abilities of CRC cell lines were evaluated by cell scratch assay and Transwell invasion assay. Notably, compared with the control group, OSBPL3 knockdown significantly weakened the migration and invasion abilities of CRC cell lines ( Figure 5 On this basis, we further verified whether the overexpression of OSBPL3 in CRC cells produced the opposite effect to that of knocking down OSBPL3. The results showed that the overexpression of OSBPL3 significantly enhanced the migration and invasion ability of CRC cells.

[0126] 2. Knockdown of OSBPL3 significantly inhibited the growth of CRC tumors in mice

[0127] BALB / C mice were used to construct an animal experimental model, and biological samples were collected for subsequent experiments. The experimental results showed that there was no significant difference in body weight among the three groups ( Figure 6 (B). Compared with the control group, the tumor growth of the sh-OSBPL3 group and the CRC group was significantly increased. It is worth noting that the number of colorectal tumors in the sh-OSBPL3 group was significantly lower than that in the CRC group, which further indicates that knocking down the OSBPL3 gene can inhibit the progression of CRC in mice ( Figure 6 A and C).

[0128] 3. OSBPL3 is significantly enriched in microbial and immune-related biological processes

[0129] First, the limma package was used to perform differential analysis of genes between the high and low expression groups of OSBPL3 in CRC to obtain differentially expressed genes. A total of 128 DEGs were obtained under the screening conditions of p<0.05,|logFC|>0.5. Then, functional enrichment analysis of DEGs was performed based on the GO / KEGG database. The results showed that the enriched pathways of OSBPL3 in CRC were related to biological processes related to microorganisms and immune responses, suggesting that OSBPL3 may affect the progression of CRC by regulating microorganisms and immune responses.

[0130] GO enrichment can be seen ( Figure 7 Middle A): In terms of biological processes, DEGs in the high and low expression groups of OSBPL3 were significantly enriched in organ or tissue-specific immune response, mucosal immune response, defense response to bacteria, antimicrobial peptide-mediated antimicrobial immune response, etc.; In terms of molecular function, DEGs in the high and low expression groups of OSBPL3 were significantly enriched in oxidoreductase activity, acting on bisphenols and related substances as donors, peptidase inhibitor activity, endopeptidase inhibitor activity, peptidase regulatory activity, mannosyltransferase activity, growth factor activity, serine type endopeptidase inhibitor activity, endopeptidase regulatory activity, cytokine activity, signal receptor activator activity, receptor ligand activity, etc.; In terms of cell composition, DEGs in the high and low expression groups of OSBPL3 were significantly enriched in luminal secretory granules, actin, collagen, extracellular matrix, cystic cavity, cytoplasmic cystic cavity, zymogen granules, Golgi cavity, zymogen granule membrane, etc.

[0131] KEGG enrichment can be seen ( Figure 7 Middle B), DEGs in OSBPL3 high and low expression groups were significantly enriched in IL-17 signaling pathway, alanine, aspartate and glutamate metabolism, saliva secretion, arginine biosynthesis and other pathways.

[0132] 4. Analysis of the diversity of intestinal microbial composition among the three groups

[0133] In order to further compare the differences in microbial richness among the three groups, five commonly used indices were used to evaluate the alpha diversity of species. The results of alpha diversity analysis showed that there were significant differences in the indicators among the three groups (p<0.05). In addition, the intestinal microbiota of the CRC group and the sh-OSBPL3 group showed that the number of species shown by the Chao1 and observed_species indices, the species diversity shown by the Shannon index and the Simpson index, and the species uniformity shown by the pielou-e index were all lower than those of the control group. At the same time, all indicators of the CRC group were higher than those of the sh-OSBPL3 group ( Figure 8 Then, PCA, PCoA, and NMDS analyses were used to further determine the β diversity of the gut microbiota among the three groups. In PCA, there was a certain spatial mapping intersection between the two groups (control group and CRC group, CRC group and sh-OSBPL3 group); in PCoA and NMDS analyses, the spatial mapping intersection between the three groups was more significant. The results showed that the composition of the gut microbiota among the three groups was significantly similar ( Figure 8 (middle F~H).

[0134] 5. Differences in intestinal microbial composition and functional prediction among the three groups

[0135] Fig. 9A and B show the comparison of intestinal microbiota at the phylum and genus levels among the three groups, respectively. Among them, Bacteroidota and Muribaculacea_nseclassed had relatively high abundance in the three groups; compared with the cotrol group, the abundance of CRC and sh-OSBPL3 groups was lower, and the content of sh-OSBPLL3 group was the lowest. Then, the differences in the composition of intestinal microbiota between the two groups (control group and CRC group, CRC group and sh-OSBPL3 group) were compared respectively. The difference analysis between the control group and the CRC group showed that at the phylum level, the abundance of p_Actinobacteriota in the control group was significantly higher than that in the CRC group. At the genus level, the abundance of an unclassified strain in Muribaculaceae in the control group was significantly higher than that in the CRC group, while the abundance of g__Ligilactobacillus, g__Mycoplasma, Akkermansia, Alloprevotella, and g__Ileibacterium was the opposite; in addition, the analysis of the difference between the CRC and sh-OSBPL3 groups showed that at the genus level, the abundance of g_Lachnospira and g_Clostridium in the CRC group was significantly higher than that in the sh-OSBPLL3 group. In order to predict and compare the functions of intestinal microorganisms between different groups, functional analysis was performed. Compared with the CRC group, the intestinal microorganisms in the control group had more functional genes for β-lactam resistance, bacterial motility proteins, and flagellar assembly; while the intestinal microorganisms in the sh-OSBPL3 group had fewer functional genes for photosynthesis-antenna proteins than the CRC group.

[0136] 6. Downregulation of OSBPL3 inhibits the occurrence and development of CRC through the intestinal microbiome-related tumor immune biological process network

[0137] First, correlation analysis was performed between the differential metabolites of the cross-pathways and the differential intestinal microorganisms. A strong positive correlation (cor = 0.89) was observed between the Eubacterium convexum group and aspartic acid, and a strong negative correlation (cor = -0.89) was observed between succinic acid ( Fig.10 ). Then, we constructed a relationship network of tumor immunity biological process-shared DEGs-differential metabolites-differential intestinal microorganisms by ranking analysis of weights. 22 shared DEGs were involved in 19 immune-related biological processes through 27 metabolites and 6 different intestinal microorganisms, such as negative regulation of immune system processes, production of molecular mediators involved in inflammatory response, and regulation of cell-cell adhesion. ( Fig.11). Finally, a tumor immune biological process network was extracted from the immune-related regulatory processes based on the connection correlation weights. The biological process network contained only 4 shared DEGs, namely Adcyap1, Ido1, Gal, and Lilrb4b; 9 metabolites, namely Aspartate, 2-Ketobutyricacid, Gamma-Linolenic acid, 2,3-Diphosphoglyceric acid, 17-alpha,20-alpha-Dihydroxypregn-4-en-3-one, 12-Oxo-5Z,8Z,10E,14Z-eicosatetraenoic acid, Retinylester, cis-5,8,11,14-eicosatetraenoic acid, and PC 34:3; PC (16:1 / 18:2) and 5 different intestinal microorganisms, including Clostridium, Eubacterium ruminum, Roseomonas, an unclassified bacterium in Lachnospiraceae (Lachnospiraceae.unclassified), and Eubacterium convexum. The biological process had a total of 39 relationship pairs. The results showed that knockdown of OSBPL3 may inhibit the development of CRC by regulating this biological process ( Fig.12 ).

[0138] 7. Downregulation of OSBPL3 can increase the number of key microorganisms, enhance tumor immune surveillance, and inhibit the occurrence and development of CRC

[0139] The number of five microorganisms in the focused tumor immune biological process in the CRC group and the sh-OSBPL3 group was analyzed. With p<0.05,|log2FC|>1 as the screening conditions, it was found that Eubacterium ruminantium and Roseomonas were significantly increased in the sh-OSBPL3 group compared with the CRC group, with log2FC of 1.0447673 and 1.2640940, and FDR of 0.8041893 and 0.875439, respectively. Fig.13 In order to further verify that the biological process obtained by multi-omics analysis can be regulated by regulating Eubacterium ruminantium and Roseomonas to inhibit the occurrence and development of CRC, the two bacterial communities of Eubacterium ruminantium and Roseomonas were cultured and a bacterial community mixture was prepared (conventional culture method can be used) for subsequent experimental studies.

[0140] CT26 cells of sh-OSBPL3 and the parent strain of CT26 cells were cultured separately, and the supernatant was added to the bacterial culture medium to culture Eubacterium ruminantium and Roseomonas spp. Fig.13(B). The supernatant of CT26 cells with sh-OSBPL3 was added to culture Eubacterium ruminantium and Roseomonas for 12 hours and 24 hours, and the colony counts were found to be significantly increased compared with the bacterial culture with the supernatant of the CT26 cell parent strain. The colony count of Eubacterium ruminantium in the sh-OSBPL3 group at 12 hours was 296.2±32.5CFU / mL, slightly higher than the 245.4±50.3CFU / mL in the CRC group; the colony count of Roseomonas was 368.0±30.5CFU / mL, significantly higher than the 240.8±36.2CFU / mL in the CRC group. The colony counts of Eubacterium ruminum and Roseomonas in the sh-OSBPL3 group were 820.6±40.1 CFU / mL and 867.6±51.0 CFU / mL, respectively, after 24 hours, which were significantly higher than those of 357.0±63.6 CFU / mL and 467.6±31.3 CFU / mL in the CRC group. The results suggest that the use of the supernatant of CT26 cells with knockdown of OSPBL3 for bacterial culture significantly promoted the colony formation of Eubacterium ruminum and Roseomonas, and was time-dependent ( Fig.13 Middle C).

[0141] BALB / C mice were used to construct an animal experimental model. The single bacterial group (Er, Rs) and the combined bacterial group (Er+Rs) were treated with Eubacterium ruminantium, Roseomonas and bacterial mixture by enema, respectively. The tumor control group (0.9% NaCl) was treated with an equal volume of saline by enema, and biological samples were collected for subsequent experiments. The results showed that there was no significant difference in the weight of mice among the four groups ( Fig.13 Compared with the CRC group, the tumors of the single bacterial group and the combined bacterial group were significantly inhibited, and the tumors were significantly smaller than those of the CRC group. Among them, the combined bacterial group had the highest degree of inhibition and the smallest tumor ( Fig.13 (E and F) Flow cytometry was used to detect the CD8 + Compared with the CRC group, the proportion of CD8 T cells in the single bacterial group and the combined bacterial group + The proportion of T cells increased in all groups, among which CD8 + The highest proportion of T cells ( Fig.13 Middle G).

[0142] In conclusion, increasing the number of Eubacterium ruminantium and Roseomonas can enhance tumor immune surveillance, thereby inhibiting the occurrence and development of CRC. This new discovery provides further insights into the potential mechanism by which OSBPL3 regulates intestinal microbial homeostasis and thus intervenes in the occurrence and development of CRC, and provides a new theoretical basis for the subsequent diagnosis and treatment of CRC based on intestinal microorganisms.

[0143] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of an OSBPL3 inhibitor in at least one of (1) to (5): (1) Preparation of drugs for treating and / or preventing colorectal cancer; (2) inhibiting the proliferation, migration and / or invasion of CRC cells; (3) preparing products for inhibiting proliferation, migration and / or invasion of CRC cells; (4) promoting the proliferation of Eubacterium ruminantum and / or Roseomonas; (5) Prepare products that promote the proliferation of Eubacterium ruminantum and / or Roseomonas.

2. The use according to claim 1, characterized in that: The OSBPL3 inhibitor is at least one of a substance that inhibits OSBPL3 activity, a substance that degrades OSBPL3, or a substance that reduces the expression level of OSBPL3.

3. The use according to claim 2, characterized in that: The substance that reduces the expression level of OSBPL3 is at least one of (6) to (8): (6) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting OSBPL3; (7) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting OSBPL3 described in (6); (8) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (7).

4. The use according to claim 3, characterized in that: The OSBPL3 inhibitor is at least one of (9) to (11): (9) shRNA targeting OSBPL3; (10) a nucleic acid molecule encoding the shRNA targeting OSBPL3 described in (9); (11) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (10); Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3.

5. A shRNA, the nucleotide sequence of which is shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

6. The biological material related to the shRNA according to claim 5, wherein the biological material comprises any one of 1) to 12): 1) A nucleic acid molecule encoding the shRNA according to claim 5; 2) an expression cassette comprising the nucleic acid molecule described in 1); 3) a vector comprising the nucleic acid molecule described in 1); 4) a vector comprising the expression cassette described in 2); 5) A transgenic cell line comprising the nucleic acid molecule described in 1); 6) A transgenic cell line comprising the expression cassette described in 2); 7) A transgenic cell line comprising the vector described in 3); 8) A transgenic cell line comprising the vector described in 4); 9) A recombinant microorganism containing the nucleic acid molecule described in 1); 10) a recombinant microorganism containing the expression cassette described in 2); 11) A recombinant microorganism containing the vector described in 3); 12) A recombinant microorganism containing the vector described in 4).

7. Use of the shRNA according to claim 5 and / or the biomaterial according to claim 6 in any one of a1) to a5): a1) preparing drugs for treating and / or preventing colorectal cancer; a2) inhibiting the proliferation, migration and / or invasion of CRC cells; a3) preparing a product for inhibiting proliferation, migration and / or invasion of CRC cells; a4) promoting the proliferation of Eubacterium ruminantium and / or Roseomonas; a5) Preparing a product that promotes the proliferation of Eubacterium ruminantium and / or Roseomonas.

8. A product comprising the shRNA of claim 5 and / or the biomaterial of claim 6.

9. Use of Eubacterium ruminantum and / or Roseomonas in the preparation of medicines for treating and / or preventing colorectal cancer.

10. A medicament comprising Eubacterium ruminantum and / or Roseomonas .

Images