Plant temperature stress resistance gene rad and application thereof

Abstract

The application discloses a plant temperature stress resistance gene RAD and application thereof, and belongs to the field of molecular biology, and particularly relates to a plant temperature stress resistance gene and application thereof in improving temperature applicability and crop yield. The application provides a nucleotide sequence of the temperature stress resistance gene RAD and a coded protein sequence, the gene can significantly enhance the temperature stress resistance of plants and improve the growth conditions of plants, and provides certain theoretical basis and new gene resources for breeding of plant temperature stress resistance varieties.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to a plant temperature stress resistance gene and its application in improving temperature adaptability and crop yield. BACKGROUND

[0002] Temperature is one of the biggest variables in the plant growth environment. Due to large outdoor temperature fluctuations and difficulty in prediction, it leads to the possibility of plants being threatened by low or high temperature when growing in natural environment. When plants encounter unpredictable low or high temperature, or plants are planted in an environment beyond their temperature tolerance range, plant growth can be greatly affected, and even cause plant death. For example, litchi is a plant with separate male and female flowers on the same plant, and its flower and fruit development is greatly affected by temperature. High temperature can cause the phenomenon of "shoot" of flower buds, affecting the formation of flower buds and thus affecting yield; low temperature is also not conducive to fruit development, thereby reducing yield and seriously affecting the economic benefit of litchi. Many temperature-intolerant plants in production often face problems such as low yield and unstable yield, and it is of great economic value and broad application prospect to improve the temperature resistance of plants. SUMMARY

[0003] The present application provides a new temperature stress resistance gene RAD to specifically regulate the resistance of plants to temperature stress and the growth of root systems.

[0004] In order to achieve the above purpose, the following technical solutions are adopted in the present application:

[0005] A plant temperature stress resistance gene RAD, comprising EcaRAD cds or LcRAD cds, the nucleotide sequence of the temperature stress resistance gene EcaRAD cds is shown in EQ ID No. 1; the nucleotide sequence of the temperature stress resistance gene LcRAD cds is shown in EQ ID No. 2.

[0006] Further, the temperature stress resistance gene RAD, the EcaRAD protein sequence encoded by the EcaRAD cds is shown in EQ ID No. 3, and the LcRAD protein sequence encoded by the LcRAD cds is shown in EQ ID No. 4.

[0007] Further, the plant temperature stress resistance gene RAD is applied to improve plant yield or improve plant temperature adaptability.

[0008] Further, the application comprises the following steps: constructing a vector, transforming the vector into Agrobacterium, and transforming the Agrobacterium into plants; the vector is a pEarlyGate201 vector, including an EcaRAD-pEarlyGate201 vector or an LcRAD-pEarlyGate201 vector.

[0009] Compared with the prior art, the application has the beneficial effects that the temperature stress-resistant gene and the encoded protein can significantly improve the high-temperature and low-temperature tolerance of plants, the tolerance of the living environment of plants, and the plantable geographical range of temperature-sensitive plants. The application also improves the yield of plants, and the transgenic plants grow more robustly, have larger leaf areas, and improve the land utilization rate per unit of land. The effect of the application has been verified in Arabidopsis and tobacco, and the application can be applied to plants such as lychee, tobacco, and rice, and has important theoretical significance and broad application value. BRIEF DESCRIPTION OF DRAWINGS

[0010] The accompanying drawings, which are incorporated into and form a part of the specification, illustrate an embodiment consistent with the present application and, together with the description, serve to explain the principles of the application.

[0011] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed to be used in the embodiments or prior art description will be briefly introduced. Obviously, for those skilled in the art, other drawings can also be obtained based on these drawings without creative labor.

[0012] In the drawings:

[0013] Figure 1 It is a schematic atlas of the EcaRAD-pEarlyGate201 vector;

[0014] Figure 2 It is a schematic atlas of the LcRAD-pEarlyGate201 vector;

[0015] Figure 3 It is an agarose gel electrophoresis diagram for identifying overexpression of EcaRAD and LcRAD in Arabidopsis and tobacco DNA PCR;

[0016] Figure 4 It is an expression identification of overexpression of EcaRAD in Arabidopsis, wherein WT represents wild-type Arabidopsis, E represents overexpression of EcaRAD in Arabidopsis, L represents overexpression of LcRAD in Arabidopsis, and the numbers represent groups;

[0017] Figure 5 It is an expression identification of overexpression of LcRAD in Arabidopsis;

[0018] Figure 6To identify the expression level of EcaRAD in Nicotiana benthamiana overexpression;

[0019] Figure 7 To identify the expression level of LcRAD in Nicotiana benthamiana overexpression;

[0020] Figure 8 To count the number of fruits of transgenic Arabidopsis thaliana;

[0021] Figure 9 To compare the growth state of transgenic Arabidopsis thaliana and wild type Arabidopsis thaliana under different temperature treatments, wherein the left is a low temperature environment (22℃ / 20℃ day / night), the right is a high temperature environment (28℃ / 26℃ day / night), the upper row is wild type Arabidopsis thaliana, and the lower row is transgenic Arabidopsis thaliana;

[0022] Figure 10 To compare the growth state of transgenic Arabidopsis thaliana and wild type Arabidopsis thaliana under different temperature treatments;

[0023] Figure 11 To compare the growth state of wild type Arabidopsis thaliana and overexpression Arabidopsis thaliana seedlings;

[0024] Figure 12 To compare the growth state of wild type Arabidopsis thaliana and overexpression Arabidopsis thaliana root hairs, wherein WT represents wild type Arabidopsis thaliana, E represents overexpression EcaRAD Arabidopsis thaliana, L represents overexpression LcRAD Arabidopsis thaliana, and the number represents the group. DETAILED DESCRIPTION

[0025] The following examples are intended to illustrate the present application but not to limit the scope of the present application. Modifications or replacements of the methods, steps or conditions of the present application without departing from the spirit and essence of the present application shall fall within the protection scope of the present application. If not specifically indicated, the experimental materials, reagents, instruments and the like used in the examples of the present application can be commercially available; if not specifically indicated, all the technical means in the examples of the present application are conventional means well known to those skilled in the art.

[0026] In some embodiments, the medium formula used is as follows:

[0027] MS medium: MS powder 4.74 g / L; sucrose 30 g / L; Ph = 5.8-5.9.

[0028] Tobacco co-culture medium: MS powder 4.74 g / L; sucrose 30 g / L; 6-BA 2 mg / L; NAA 1 mg / L; AS 100 uM; Ph = 5.8-5.9; Agar 8 g / L.

[0029] Tobacco differentiation medium: MS powder 4.74 g / L; sucrose 30 g / L; 6-BA 2 mg / L; NAA 1 mg / L; Ph = 5.8-5.9; Agar 8 g / L; Cef 400 mg / L; plant resistance screening antibiotic herbicide (basta) 5-10 mg / L.

[0030] Tobacco rooting medium: 1 / 2MS powder 2.47 g / L; sucrose 25 g / L; NAA 0.1-0.3 mg / L; IBA 0.1-0.3 mg / L; Cef 400 mg / L; plant resistance screening antibiotic herbicide (basta) 5-10 mg / L.

[0031] The purpose gene used in the application is EcaRAD cds or LcRAD cds, the nucleotide sequence of EcaRAD cds is shown in EQ ID No. 1, and the nucleotide sequence of LcRAD cds is shown in EQ ID No. 2.

[0032] Example 1: Construction of a vector

[0033] (1) Gene cloning

[0034] The Takara company's Primestar high-fidelity enzyme was used for amplification with litchi and umbrella wood flower bud cDNA as amplification templates, respectively.

[0035] The reaction system used is: PrimestarMAX Premix 25ul; Primer 11ul; Primer 21ul; Template 1ul; Sterilized water 22ul; Total volume 50ul.

[0036] The amplification conditions are: 98℃ 2min; 98℃ 10s; 55℃ 15s; 72℃ 1min40s; Step2-step431 cycle; 72℃ 5min; 16℃ constant temperature preservation.

[0037] The primers used for gene amplification are:

[0038] LcRAD-F (3102): tttggagaggacacgctcgagATGCCGGTGCAGGTGAAA

[0039] LcRAD-R (3102): agcaggactctagggactagtTTACACGTTTACTTTTGCTGGAAGG

[0040] EcaRAD-CE8-F: 5'-tttggagaggacacgctcgagATGCCGGTGGCGACGAGA-3'

[0041] EcaRAD-CE8-R: 5'-agcaggactctagggactagtTTAAGCGTAATCTGGAACATCGTATG-3'

[0042] PCR product recovery: PCR product 50ul; 3M NaOAC 5ul; anhydrous ethanol 250ul. Mix, 4℃, 10000g, centrifugal 30min, discard supernatant, 70% ethanol gently rinse the precipitate, discard supernatant, air dry at room temperature until the precipitate is colorless and transparent, add 50ul sterilized water to dissolve the precipitate, measure the concentration with NanoDrop 2000, and store at -20℃.

[0043] (2) Double enzyme digestion

[0044] The backbone vector used is pEarlyGate201 (CE8);

[0045] The vector is digested using double enzyme digestion, and the enzyme digestion sites used are: 5'Xho1: CTCGAG; 3'Spe1: ACTAGT.

[0046] The enzyme digestion system is: XbaI 1ul; SpeI 1ul; vector plasmid 1ng; rCutsmartbuffer 5ul; sterilized water to 50ul; 37℃ overnight enzyme digestion.

[0047] Enzyme digestion product recovery; enzyme digestion product 50ul; 3M NaOAC 5ul; anhydrous ethanol 250ul; mix, 4℃, 10000g, centrifugal 30min; discard supernatant, 70% ethanol gently rinse the precipitate, discard supernatant; air dry at room temperature until the precipitate is colorless and transparent, add 50ul sterilized water to dissolve the precipitate, measure the concentration with NanoDrop 2000, and store at -20℃.

[0048] (3) Recombinant vector

[0049] The method of infusion is used to construct the recombinant vector, and the reaction system is: 2XCE mix 5ul; target gene fragment 0.03pmol; enzyme digestion vector fragment 0.06pmol; sterilized water to 10ul, gently mix; 50℃ 15min; store on ice.

[0050] (4) Transformation

[0051] The transformation of E. coli is as follows: 50ul of DH5a competent cells; 5ul of the target gene and vector ligation product; mix gently, stand on ice for 30min, heat shock at 42℃ for 45s, stand on ice for 2min, add 1ml of LB liquid medium without antibiotics, cultivate at 37℃ on a shaker at 220rpm for 1h; centrifuge at 12000rpm for 1min, discard the supernatant, resuspend the bacterial body, evenly spread on a 50mg / L Kana LB solid medium plate, and cultivate at 37℃ in an incubator overnight; screen the bacteria by colony PCR and sequencing, extract the plasmid, and use it to transform Agrobacterium.

[0052] The plasmid extraction method is as follows: centrifuge at 13,000xg for 1min to collect 1-5ml of bacterial body. Discard the culture medium, and pat the bacterial body on an absorbent paper to absorb the residual liquid; add 250ul of Buffer P1 / RNase A mixture, and resuspend the bacteria by high-speed vortex; ensure that RNase A has been added to Buffer P1 before use; completely resuspend the bacteria, which is crucial for yield, and no bacterial clumps should be seen after resuspension; add 250ul of Buffer P2 to the resuspension liquid, mix by inverting 8-10 times; add 350ul of Buffer NP3, immediately invert 8-10 times to completely neutralize the solution; centrifuge at 13,000xg for 2min; place the HiPure DNA Mini Column IV in a collection tube, transfer the supernatant to the column, and centrifuge at 13,000xg for 30-60s; discard the filtrate, put the column back into the collection tube, and add 500ul of Buffer PW1 to the column. Centrifuge at 13,000xg for 30-60s; discard the filtrate, put the column back into the collection tube, and add 600ul of Buffer PW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 13,000xg for 30-60s; discard the filtrate, put the column back into the collection tube, and add 300ul of Buffer PW2 (diluted with anhydrous ethanol) to the column; centrifuge at 13,000xg for 3min; discard the filtrate, put the column back into the collection tube, and centrifuge at 13,000xg for 3min to dry the column. Put the column into a sterilized 1.5ml centrifuge tube, add 50ul of Elution Buffer to the center of the column membrane. Stand for 1min, and centrifuge at 13,000xg for 1min to elute the DNA. Discard the column, and store the plasmid at -20℃.

[0053] The EcaRAD-pEarlyGate201 vector as shown in Figure 1 and the LcRAD-pEarlyGate201 vector as shown in Figure 2 are obtained.

[0054] Example 2: Agrobacterium transformation

[0055] 1) Take 2 μL of the constructed vector from Example 1 and add it to 30 μL of GV3101 competent cells. Mix carefully and let stand on ice for 5 min.

[0056] 2) Quick-freeze in liquid nitrogen for 5 minutes;

[0057] 3) 37℃ for 5 minutes;

[0058] 4) Let it rest on the ice for 5 minutes;

[0059] 5) Add 1 ml of antibiotic-free YEP liquid medium and incubate at 28°C in a shaker for 1.5 h;

[0060] 6) Centrifuge at 28℃, 8000rpm for 1min, spread onto K / Rif YEP medium plates, and incubate statically at 28℃ for 2 days;

[0061] 7) Select single-clonal colonies for screening, shake and preserve the bacteria; obtain Agrobacterium with the vector of Example 1.

[0062] Example 3: Preparation of Infection Solution

[0063] 1) Take the Agrobacterium tumefaciens culture prepared in Example 2 into 10 ml of YEP medium (with kanamycin and rifampin added), and incubate overnight at 28°C on a shaker.

[0064] 2) Take 2 ml of the overnight culture and add it to 60 ml of freshly prepared sterile YEP medium (with kanamycin and rifampin). Add acetylsuccinyl syringone to enhance bacterial activity and culture until the OD600 is between 0.8 and 1.0.

[0065] 3) Centrifuge at 28℃, 5000 rpm, 5 min, collect the bacterial cells, wash once with sterile water, and collect the bacterial cells again.

[0066] 4) Add sterile water to OD600 = 0.8, add sucrose (final concentration 5%), and 0.05% Silweet L-77; obtain the infection solution containing Agrobacterium tumefaciens from Example 2.

[0067] Example 4: Infection of Arabidopsis thaliana plant material

[0068] 1) Water thoroughly the night before infection to encourage the Arabidopsis thaliana stomata to open. If it is the first time infecting Arabidopsis thaliana, cut off the pods and open flowers to improve infection efficiency; if it is an infected Arabidopsis thaliana, do not remove the pods and open flowers.

[0069] 2) Soak the unopened inflorescence of Arabidopsis in the infection solution in Example 3 for 30s, shake gently, take out the inflorescence after timing, pinch the inflorescence gently to promote infection; use filter paper to absorb the excess infection solution, and place the Arabidopsis flat in the humidity box, cover with plastic wrap to keep moist, and avoid light and stand overnight.

[0070] 3) The next day, take out the infected Arabidopsis and culture under normal conditions (24°C, 16 / 8h light / dark).

[0071] 4) After a week, infect again, a total of 3 times of infection, and obtain transgenic Arabidopsis.

[0072] Example 5: Infection of tobacco plant material

[0073] 1) Preparation of sterile seedlings: Take a proper amount of Nicotiana benthamiana seeds, put them into a sterile 1.5ml centrifuge tube, add 70% alcohol, shake vigorously for 30s. Centrifuge for 10s, quickly pour off the supernatant and add 1ml sterilized water, shake vigorously to wash. Centrifuge for 10s, discard the supernatant, add 2% NaClO solution, sterilize for 8min. Centrifuge for 10s, discard the supernatant, wash with sterilized water for 5 times. Sow the seeds on MS medium, culture at 24°C, 16 / 8h light / dark.

[0074] 2) Infection and screening culture: Take a healthy sterile Nicotiana benthamiana seedling grown for about 30d, clamp the tobacco out of the tissue culture bottle, cut off the leaves, cut off the four edges, cut into squares, and put on wet filter paper for standby. Put the cut tobacco leaves into the infection solution with adjusted OD, 28°C, dark, 100rpm, shake culture for 15min. Use sterilized filter paper to absorb the excess bacteria solution, leaf back upward, spread on tobacco co-culture medium, 25°C, dark condition, co-culture for 2d. Transfer the leaves from the tobacco co-culture medium to the tobacco differentiation medium, and culture under light, replace the medium every 2 weeks. Very obvious callus can be seen after about 20d, and differentiated buds can be seen after 25d. Cut the buds and put them into the tobacco rooting medium to root. After 20d of culture in the rooting medium, acclimate the seedlings and obtain transgenic tobacco.

[0075] Example 6: Screening and identification of transgenic material

[0076] Genomic DNA of plant material was extracted by CTAB method for transgene identification. Respectively, Arabidopsis in Example 4 and tobacco in Example 5 were taken into 2ml centrifuge tube, one 3mm diameter steel ball was added, and then frozen in liquid nitrogen, and ground into powder by a sample machine. 900ul of 65℃ preheated CTAB extraction solution was added and mixed well. It was placed in a 65℃ water bath for 30min, and mixed well every 10min. 900ul of chloroform:isopentanol (24:1) was added, shaken well, and centrifuged at 12000rpm for 10min at room temperature. 600ul of supernatant was taken into a new 1.5ml centrifuge tube, 400ul of isopropyl alcohol was added, mixed well, and centrifuged at 1200rpm for 10min at room temperature. The supernatant was discarded, 1ml of 70% ethanol was added, and centrifuged at 1200rpm for 5min at room temperature. The ethanol was discarded and repeated once. The centrifuge tube was opened and placed in a fume hood to dry until the precipitate was colorless and transparent. 50ul of sterile water was added to dissolve the precipitate, and the DNA concentration was detected by Nano Drop 2000. It was stored at -20℃.

[0077] In this example, the primer sequence used for DNA identification is:

[0078] 35S: ATGACGCACAATCCCACTATCC

[0079] EcaRAD201-R: TTATACATTGACTTCAGCGGGAAG

[0080] LcRAD201-R: TTACACGTTTACTTTTGCTGGAAGG.

[0081] In this embodiment, the PCR identification system used is: 2x TaqMix 5ul; primer F 0.5ul; primer R 0.5ul; template DNA 1ul; sterile water 3ul.

[0082] The PCR program used is: 95℃ 2min; 95℃ 15s; 58℃ 15s; 72℃ 1min 40s; step 231 cycle; 72℃ 5min; 12℃ ∞.

[0083] The extracted genomic DNA was subjected to electrophoresis experiment.

[0084] 1% agarose gel preparation: 1.5g agarose powder was added to 150ml 1X TAE solution, and heated in a microwave oven until completely dissolved, and became colorless and transparent; after cooling, nucleic acid dye GelRed was added, and poured into the gel plate.

[0085] Electrophoresis was carried out under the following conditions: 120V, 0.13A, 16W, 30min.

[0086] Result analysis:

[0087] The identification primers used were the vector primer sequence 35S and the R-end primer of the target gene. The expected size of the amplified bands should be 3180bp (LcRAD) and 2780bp (EcaRAD), respectively. As can be seen from the results, the size of the amplified bands is between 3000bp-5000bp, and is closer to 3000bp, which is a bright band, as expected. Figure 3

[0088] Example 7: Fluorescent quantitative PCR

[0089] Total RNA was extracted by trizol method. About 0.1 g of Arabidopsis thaliana 4 and tobacco 5 plant tissues in the examples were ground into powder in liquid nitrogen, transferred to a 1.5 ml centrifuge tube, and 1 ml of trizol (previously added with 2% β-mercaptoethanol) was added, mixed well, and room temperature was kept for 5 min. 200ul of chloroform was added, mixed well, and room temperature was kept for 5 min. 4℃, 12000g, centrifugation for 5 min, 600ul supernatant was taken to a new 1.5ml centrifuge tube. Add 600ul of isopropanol, mix well, and room temperature is kept for 10 min. 4℃, 12000g, centrifugation for 5 min, discard the supernatant. Carefully add 1ml of 75% ethanol, gently rinse, 4℃, 7500g centrifugation for 5 min, discard the supernatant, repeat once. Room temperature is kept for drying the precipitate, until the precipitate is colorless and transparent, add 30ul of RNase free water to dissolve the precipitate. NanoDrop2000 detects the concentration of RNA, and is stored at -80℃.

[0090] Synthesis of first strand cDNA

[0091] The system used in this embodiment is as follows: gDNA eraser 1ul; total RNA 1ug; 5x gDNAeraserbuffer 2ul; RNase free water Up to 10ul; 42℃ reaction 2min.

[0092] Take 10ul of the reaction solution of the previous step; 5x PrimeScript buffer 4ul; RNase Inhibitor 0.5ul; PrimeScript RTase 1ul; RNase free water Up to 20ul; 37℃ 15min; 85℃ 5s; ice, use NanoDrop2000 to detect the concentration; -20℃ storage.

[0093] The qRT-PCR procedure is as follows: 95℃ 10min; 95℃ 15s; 55℃ 1min; fluorescence detection to step 240 cycle.​

[0094] The primer sequences used for quantitative real-time PCR are as follows:

[0095] Arabidopsis thaliana internal reference gene

[0096] AtActin-F:5'CGCTCTTCTTTCCAAGCTC 3'

[0097] AtActin-R:5'AACAGCCCTGGGAGCATC 3'

[0098] Ben's tobacco internal reference gene

[0099] NtEF1a-F:5'AGAGGGCCCTCAGACAAAC 3'

[0100] NtEF1a-R:5'TAGGTCCAAAGGTCACAA 3'

[0101] LcRAD gene

[0102] LcRAD-F:5'CGAAGATCATCTCCGAAACAC 3'

[0103] LcRAD-R:5'TCAGGTCCAACGAAAGTAAGC 3'

[0104] EaRAD gene

[0105] EcaRAD-F:5'AGGCAAGGCAGACGCGAACAT 3'

[0106] EcaRAD-R:5'GACTCCAGACGCAAACATCC 3'

[0107] Based on the above measurements, such as Figure 4 As shown, EcaRAD was successfully expressed in Arabidopsis thaliana; Figure 5 As shown, LcRAD was successfully expressed in Arabidopsis thaliana; Figure 6 As shown, EcaRAD was successfully expressed in tobacco; Figure 7 As shown, LcRAD was successfully expressed in tobacco.

[0108] Example 8: Arabidopsis thaliana cultured at different temperatures

[0109] Arabidopsis thaliana were cultured under fixed light conditions at different temperatures. The light conditions were: 16 / 8h light / dark; light intensity 8000 lx; ​​relative humidity 65%; and the culture temperatures were as follows:

[0110] The lowest temperature is 22℃ / 20℃ during the day / night;

[0111] Normal is 24℃ / 22℃ day / night;

[0112] High temperature is 28℃ / 26℃ day / night.

[0113] The two genes were introduced into Arabidopsis and tobacco by inflorescence infection method and leaf disc method, respectively. The results showed that the transgenic Arabidopsis had better tolerance to temperature stress and better growth condition than wild-type Arabidopsis. Specifically as follows:

[0114] (1) As shown in Figure 8 , compared with the control group of Arabidopsis, the fruit pod number of transgenic Arabidopsis increased significantly, and the fruit pod number of EcaRAD Arabidopsis was the most;

[0115] (2) As shown in Figure 9 , 10 , the transgenic Arabidopsis obtained in Example 4 grew more vigorously than wild-type Arabidopsis in low temperature environment (22℃ / 20℃ day / night) and high temperature environment (28℃ / 26℃ day / night), and had high temperature resistance and low temperature resistance, and the leaf area and leaf number increased significantly.

[0116] (3) As shown in Figure 11 , 12 , the Arabidopsis seedlings in Example 4 grew better than wild-type Arabidopsis, and the number was more dense. The overexpression Arabidopsis root hair development was more dense than wild-type Arabidopsis root hair development, and the relative level of overexpression EcaRAD and LcRAD Arabidopsis expression was higher, and the seedling and root hair growth condition improved significantly.

[0117] It can be understood that the above examples only express the preferred embodiments of the present application, which are described in more detail and in detail, but cannot be understood as limiting the scope of the patent of the present application; It should be pointed out that for ordinary skilled in the art, the above technical features can be freely combined without departing from the concept of the present application, and some deformations and improvements can be made, which belong to the protection scope of the present application; Therefore, any equivalent transformation and modification within the scope of the claims of the present application shall belong to the scope of the claims of the present application.

Claims

1. Use of overexpression of temperature stress tolerance resistance gene EcaRAD cds and temperature stress tolerance resistance gene LcRAD cds in promoting plant growth or improving plant temperature adaptation, characterized in that, The nucleotide sequence of the temperature stress resistance gene EcaRAD cds is shown as SEQ ID No. 1; the nucleotide sequence of the temperature stress resistance gene LcRAD cds is shown as SEQ ID No. 2; and the plant is Arabidopsis thaliana or tobacco.

2. The use according to claim 1, characterized in that, The method comprises the following steps: Constructing a vector, transforming the vector into Agrobacterium, and transforming the plant with the Agrobacterium.

3. Use according to claim 2, wherein the compound is ###0002### The vector is a pEarlyGate201 vector.

Images