Chardonnay root rot disease susceptible related gene BrSWEET14a, construction method and application
By cloning the clubroot disease-related gene BrSWEET14a in Chinese cabbage and constructing the corresponding vector, and introducing it into Arabidopsis thaliana, the problem of poor control of clubroot disease in Chinese cabbage in existing technologies was solved, and Arabidopsis thaliana resistance to clubroot disease was significantly improved.
Patent Information
- Application Number
- CN202411752752.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-02
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-12-02
AI Technical Summary
Existing technologies are insufficient to effectively control clubroot disease in Chinese cabbage. Traditional methods, such as physical, chemical, and biological methods, have limited effectiveness and are difficult to maintain long-term efficacy.
By cloning the BrSWEET14a gene, which is associated with clubroot disease in Chinese cabbage, and constructing silencing, overexpression, and subcellular localization vectors, the gene was introduced into Arabidopsis thaliana using Agrobacterium-mediated transformation to study its role in disease resistance.
It significantly improved Arabidopsis resistance to clubroot disease, indicating that BrSWEET14a has good application prospects in Chinese cabbage breeding and can promote disease resistance during clubroot infection.
Smart Images

Figure CN119552881B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and relates to a Chinese cabbage clubroot disease susceptible related gene BrSWEET14a, a construction method and application, and the application relates to the application of Chinese cabbage BrSWEET14a and the encoded protein in the plant disease resistance process. BACKGROUND
[0002] Chinese cabbage (Brassica rapa L. syn. B. campestris L.) is a Cruciferae Brassica plant, accounting for 15% of the global vegetable yield. At present, clubroot disease caused by Plasmodiophora brassicae Woronin infection poses a serious threat to the production of cruciferous crops worldwide. Clubroot disease spreads quickly and widely, and has various transmission modes, including seed, soil, farm tools, irrigation water, animal manure and feed. Clubroot disease has been reported in many countries around the world, resulting in yield loss of up to 10%-15%. The disease was first reported in the 10s of the 20th century and then spread throughout China. Spores of the root-knot fungus in the soil reach the inside of the plant by infecting root hairs, and then secondary zoospores infect the plant cortex to form root tumors. Plants infected with root-knot fungus have swollen root tissues, affecting the absorption and transport of mineral elements and water by the root system, so the aboveground part of the plant shows dwarfing and wilting symptoms, leaf redness, chlorosis, necrosis and shedding, early flowering, and serious impact on the yield and quality of Brassica crops. Due to the tenacious vitality and easy transmission of the root-knot fungus, the effect of physical, chemical and biological methods for controlling clubroot disease is limited and cannot be effective for a long time, so it is crucial to develop varieties with broad and persistent resistance by finding clubroot disease resistance and susceptibility genes.
[0003] Sugar is the main source of energy for plant growth and is involved in various metabolic pathways. Studies have shown that the sugar transporter (SWEET) gene family plays a key role in plant growth, development, reproduction and disease resistance. For example, in Arabidopsis, Atsweet141 / 12 double mutant sugar transporter protein deficiency leads to reduced root tumor degree, AtSWEET4 / 15 is essential for Brassica crop development, and AtSWEET4 / 15 / 17 is up-regulated after Bacillus subtilis infection. OsSWEEt11 / 14 transcripts increase during Xanthomonas oryzae infection. According to previous studies, including transcriptome sequencing and genome-wide association studies, a large number of differentially expressed SWEET family genes in response to P. brassicae infection were found in B. rapa, indicating their involvement in sugar transport and pathogen infection.
[0004] Pathogen-induced infestation utilizes sugar resources in host plants by activating specific sugar transport proteins or SWEET genes. SUMMARY
[0005] From the foregoing, the SWEETs protein has great potential value in plant disease resistance and stress research, and new varieties with disease resistance and stress resistance can be cultivated through molecular biology means.
[0006] Therefore, the purpose of the present application is to overcome the defects of the prior art and the aforementioned values, and to provide a Chinese cabbage clubroot disease-related gene BrSWEET14a and its application.
[0007] (I) Related genes
[0008] The Chinese cabbage clubroot disease-related gene BrSWEET14a is a candidate gene, and the nucleotide sequence of the related gene BrSWEET14a comprises:
[0009] (1) the nucleotide sequence is as shown in SEQ ID No. 1; or
[0010] (2) the nucleotide sequence shown in SEQ ID No. 1 is substituted, deleted and / or increased by one or more nucleotides; or
[0011] (3) a nucleotide sequence that hybridizes to the DNA sequence defined in (1) under stringent conditions.
[0012] (II) Construction method
[0013] The first construction method of the Chinese cabbage BrSWEET14a gene silencing vector comprises the following steps:
[0014] The silencing sequence of the Chinese cabbage BrSWEET14a gene is predicted, and the silencing sequence is as shown in SEQ ID No. 2;
[0015] Double enzyme digestion of pTRV2 vector to obtain linearized pTRV2 vector;
[0016] Amplify the silencing sequence, and homologously recombine and connect the amplified silencing sequence and the linearized pTRV2 vector, and transform the connection product to obtain the Chinese cabbage BrSWEET14a gene silencing vector.
[0017] Preferably, the specific primers for amplifying the silencing sequence are as shown in SEQ ID No. 3 and SEQ ID No. 4.
[0018] The second construction method of the Chinese cabbage BrSWEET14a gene overexpression vector comprises the following steps:
[0019] Double enzyme digestion pFGC1008-EGFP vector, obtain linearized pFGC1008-EGFP vector;
[0020] Design specific primer to amplify the nucleotide sequence of the Brassica rapa BrSWEET14a gene, connect the amplified sequence and linearized pFGC1008-EGFP vector by homologous recombination, transform the connection product, obtain the Brassica rapa BrSWEET14a gene overexpression vector.
[0021] The Brassica rapa BrSWEET14a gene overexpression vector is obtained.
[0022] The specific primer is shown in SEQ ID No. 12 and SEQ ID No. 13.
[0023] The third Brassica rapa BrSWEET14a gene subcellular localization vector construction method comprises the following steps:
[0024] Double enzyme digestion pFGC5941-EGFP vector, obtain linearized pFGC5941-EGFP vector;
[0025] Design specific primer to amplify the nucleotide sequence of the Brassica rapa BrSWEET14a gene, connect the amplified sequence and linearized pFGC5941-EGFP vector by homologous recombination, transform the connection product, obtain the Brassica rapa BrSWEET14a gene subcellular localization vector.
[0026] The specific primer is shown in SEQ ID No. 14 and SEQ ID No. 15.
[0027] The fourth Brassica rapa BrSWEET14a gene mutant material construction method comprises the following steps:
[0028] DNA is extracted from Arabidopsis thaliana by DNA rapid extraction method, and the DNA and three primer method PCR are used to obtain the Brassica rapa BrSWEET14a gene mutant material, wherein the specific primer of the three primer method is shown in SEQ ID No. 9, SEQ ID No. 10 and SEQ ID No. 11; the Brassica rapa BrSWEET14a gene is the Brassica rapa BrSWEET14a gene.
[0029] (III) Related applications
[0030] The biological material comprising the Brassica rapa BrSWEET14a gene related to root rot disease susceptibility of Brassica rapa, wherein the biological material comprises at least one of an expression vector, an expression cassette, a host cell and an engineering bacteria.
[0031] The application provides a Chinese cabbage root knot disease-related gene BrSWEET14a or a biological material.
[0032] The application provides a use of the Chinese cabbage root knot disease-related gene BrSWEET14a or the biological material in preparation of a transgenic plant.
[0033] The application provides a use of the Chinese cabbage root knot disease-related gene BrSWEET14a or the biological material in improvement of plant germplasm resources.
[0034] (IV) Advantages
[0035] Compared with the prior art, the application has the following advantages or benefits:
[0036] The Chinese cabbage BrSWEET14a sequence provided by the application is shown in SEQ ID No. 1.
[0037] The application also provides a construction method of a Chinese cabbage BrSWEET14a gene silencing vector, an overexpression vector and a subcellular localization vector, and a mutant material construction method suitable for the Chinese cabbage BrSWEET14a gene, and the construction method is high in specificity and more suitable for the biological material applied to the Chinese cabbage BrSWEET14a sequence provided by the application.
[0038] The application introduces the gene into Arabidopsis thaliana by an Agrobacterium-mediated method, obtains a Chinese cabbage BrSWEET14a heterologous expression transgenic Arabidopsis thaliana strain, and finds that, in a disease resistance analysis experiment, a T-DNA insertion mutant material of a BrSWEET14a Arabidopsis thaliana homologous gene Atsweet14 is more resistant to diseases than a wild-type Columbia Arabidopsis thaliana, and overexpression of the BrSWEET14a can promote root swelling caused by root knot fungus infection of the Arabidopsis thaliana roots. This shows that the Chinese cabbage BrSWEET14a is closely related to cruciferous root knot diseases, and the gene has a good application prospect when applied to Chinese cabbage or other cruciferous vegetable breeding. BRIEF DESCRIPTION OF DRAWINGS
[0039] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed for the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.
[0040] Figure 1 FIG. 1 is a schematic diagram of a BrSWEET14a VIGS vector.
[0041] Figure 2Schematic diagram of BrSWEET14a overexpression vector.
[0042] Figure 3 Schematic diagram of BrSWEET14a subcellular localization vector.
[0043] Figure 4 Comparison of gene expression between plants in which BrSWEET14a gene was silenced and control plants 42 days after inoculation with pathogen spore suspension.
[0044] Figure 5 Comparison of disease index between plants in which BrSWEET14a gene was silenced and control plants 42 days after inoculation with pathogen spore suspension.
[0045] Figure 6 Comparison of root disease between plants in which BrSWEET14a gene was silenced and control plants 42 days after inoculation with pathogen spore suspension, it should be noted that the white line segment scale in the lower right corner of the figure is 4 cm.
[0046] Figure 7 PCR electrophoresis gel map for screening homozygous plants of T-DNA insertion mutant material SALK_010224C, three primer identification method was used, this figure is LP+RP, and DL2000 was used as marker, wherein lane 1 is wild type plant, and lanes 2-10 are plants possibly inserted with T-DNA.
[0047] Figure 8 PCR electrophoresis gel map for screening homozygous plants of T-DNA insertion mutant material SALK_010224C, three primer identification method was used, this figure is BP+RP, and DL2000 was used as marker, wherein lanes 2, 4, 5, 6, 7, 8 and 10 are homozygous plants, lane 1 is heterozygous plant, and lanes 3 and 9 are plants with negative results.
[0048] Figure 9 Comparison of growth between atsweet14 (SALK_010224C) mutant plants and control plants 21 days after inoculation with pathogen spore suspension, it should be noted that the white line segment scale in the lower right corner of the figure is 5 cm.
[0049] Figure 10 Comparison of growth between Rescue-BrSWEET14a complemented plants and control plants 21 days after inoculation with pathogen spore suspension, it should be noted that the white line segment scale in the lower right corner of the figure is 5 cm.
[0050] Figure 11Comparison of growth conditions of OE-BrSWEET14a overexpression plants and control plants 21 days after inoculation with pathogen spore suspension, it should be noted that the white line segment scale in the lower right corner of the figure is 5 cm.
[0051] Figure 12 Comparison of root conditions of atsweet14 (SALK_010224C) mutant plants and Rescue-BrSWEET14a complementation plants and control plants 21 days after inoculation with pathogen spore suspension, it should be noted that the white line segment scale in the lower right corner of the figure is 2 cm.
[0052] Figure 13 Comparison of root conditions of OE-BrSWEET14a overexpression plants and control plants 21 days after inoculation with pathogen spore suspension, it should be noted that the white line segment scale in the lower right corner of the figure is 2 cm.
[0053] Figure 14 Columnar chart of disease index investigation and analysis of atsweet14 (SALK_010224C) mutant plants and Rescue-BrSWEET14a complementation plants (A in the figure), OE-BrSWEET14a overexpression plants (B in the figure) and control plants 21 days after inoculation with pathogen spore suspension.
[0054] Figure 15 Subcellular localization of BrSWEET14a protein was observed. DETAILED DESCRIPTION
[0055] The technical solutions of the present application are described below by specific, concrete examples. It should be understood that the one or more method steps mentioned in the present application do not exclude the presence of other method steps before and after the described combination steps or the insertion of other method steps between these explicitly mentioned steps; it should also be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. Moreover, unless otherwise stated, the numbering of each method step is only a convenient tool to identify each method step, and is not a limitation on the arrangement order of each method step or a limitation on the scope of the present application that can be implemented, and changes or adjustments of the relative relationship without substantial changes in technical content are also considered as the scope of the present application that can be implemented.
[0056] In order to better understand the above technical solutions, the exemplary embodiments of the present application are described in more detail below. Although exemplary embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present application and to enable the scope of the present application to be fully conveyed to those skilled in the art.
[0057] (I) Related genes
[0058] Example 1
[0059] The present application provides a root-knot disease susceptible gene BrSWEET14a in this embodiment, which is a gene cloned from a highly susceptible Brassica rapa var. pekinensis ECD05, and the gene sequence is shown as SEQ ID No. 1.
[0060] (ii) Construction method and application
[0061] Based on the aforementioned root-knot disease susceptible gene BrSWEET14a, the present application further provides the application of the gene in the resistance of Brassica rapa (ECD05) and Arabidopsis thaliana to root-knot disease, which is specifically described as follows.
[0062] Example 2
[0063] In this embodiment, the construction of the Brassica rapa BrSWEET14a gene silencing vector is carried out, which includes the following steps:
[0064] 1.1 Prediction of silencing sequence
[0065] The aforementioned BrSWEET14a gene is predicted to have a 300bp silencing sequence (SEQ ID No. 2) using the SGN-VIGS website (https: / / vigs.solgenomics.net / ).
[0066] 1.2 Enzymatic digestion of pTRV2 vector
[0067] The pTRV2 vector is double-digested at two sites of BamH I and Sma I to obtain a linearized pTRV2 vector.
[0068] Enzymatic digestion system: Buffer 4 μl, recovered product about 2 μl, Sal I and Kpn I enzymes each 2 μl, then supplemented with double distilled water to 40 μl, 37℃ water bath for 1h.
[0069] 1.3 Design of specific primers
[0070] The primer sequence information is referred to Table 1, and the aforementioned 300bp silencing sequence is amplified by using high-fidelity KOD enzyme. The obtained PCR product is separated by 1% agarose gel electrophoresis, and the length is consistent. The gel recovery vector fragment is cut to obtain the PCR-amplified 300bp silencing sequence.
[0071] 1.4 Homologous recombination connection
[0072] The linearized pTRV2 vector and the PCR-amplified 300bp silencing sequence are connected by homologous recombination using the Nuvisen single fragment homologous recombination kit C112 to obtain a connection product.
[0073] System: 4 μl 5x CE II Buffer, 2 μl Exase II, 200 ng double enzyme cutting recovered linearized vector (linearized pTRV2 vector), 20 ng PCR amplified 300 bp silencing sequence of BrSWEET14a, ddH2O to 20 μl; 37 °C reaction for 30 min.
[0074] 1.5 Transformation of E. coli
[0075] The ligation product was transformed into E. coli DH5a competent cells using the freeze-thaw method, the obtained bacterial solution was cultured and verified by PCR, and the target plasmid was extracted and verified by sequencing. The plasmid with successful sequence verification was transformed into Agrobacterium GV3101 competent cells by electroporation, and the bacterial solution with successful transformation was verified by PCR. The bacterial solution with successful transformation was cultured in a larger volume, and the plasmid was extracted and verified by sequencing (the final vector map is shown in Figure 1 ), and the final vector was pTRV2-BrSWEET14a. The bacterial solution with successful verification was stored at 4 °C for future use.
[0076] The above detailed experimental steps were performed according to the instructions of the Novagen single fragment homologous recombination kit C112, and will not be described here.
[0077] Table 1 Primers used for VIGS silencing vector construction
[0078]
[0079]
[0080] Example 3
[0081] In this example, the silencing of Brassica rapa BrSWEET14a gene by VIGS was performed, including the following steps:
[0082] 2.1 Inoculation of Brassica rapa by seed soaking method
[0083] The bacterial solution with successful sequencing verification in the above example 1 was used as a mother solution to infect Brassica rapa (B. rapacv. Chiifu) by seed soaking method, and the steps were as follows: 100 μl of Agrobacterium containing the target vector was added to 15 ml of liquid LB containing kanamycin (0.5 μl / ml) and rifampicin (1 μl / ml), and the bacteria were shaken at 28 °C and 200 rpm for 12-16 h until the OD 600 was 1. The bacterial precipitate was resuspended in a resuspension solution prepared by dd H2O, which contained 10 mmol / L MES, 10 mmol / L MgCl2, and 150 μmol / L acetyl-syringone. Then the OD 600Adjustment to 1.0, room temperature for 2-3h standby. Subsequently, in order to infect seedlings, the bacteria containing pTRV1 were mixed with bacteria containing pTRV2-BrSWEET14a and pTRV2-empty (as a control) respectively at a volume ratio of 1:1. The cabbage seeds were germinated to a root length of about 1cm, then the seed coat was removed and placed in the above prepared mixed bacteria solution, vacuum (conditions: 0pa, 15min), then the seeds were moved to the matrix for normal culture. Among them, pTRV2-empty is pTRV2 empty vector.
[0084] 2.2 Quantification of BrSWEET14a gene expression
[0085] Take the transplanted 30-35d cabbage leaves, use Trizol reagent to extract total RNA, and then reverse transcription to obtain cDNA, which is provided by TaKaRa company PrimeScript TM RT reagent Kit with gDNA Eraser(Perfect Real Time) reverse transcription special reagent box, the detailed operation steps are carried out according to the instruction manual. The primers used for qRT-PCR analysis are designed by Primer Premier 6, as shown in Table 2.
[0086] 15μl of reaction system, 15μl of composition: 7.5μl of SYBR Green Master Mix, 0.3μl of forward and reverse primers, 1μl of template, 5.9μl of double distilled water.
[0087] qRT-PCR reaction process: 95℃: 30s, 40 cycles (95℃: 5s, 55℃: 45s). The specificity of the reaction was determined by melting curve, the internal reference gene was BrUBC10, and the relative expression of the gene was calculated by 2 -ΔΔCt Method.(Take three biological replicates when sampling)
[0088] Reference Figure 4 , the results showed that the gene was down-regulated in cabbage.
[0089] Table 2 Primers used for qRT-PCR analysis
[0090]
[0091]
[0092] Example 4
[0093] In this embodiment, the Plasmodiophora brassicae infection experiment and phenotype observation were carried out, including the following steps:
[0094] 3.1 Preparation of Plasmodiophora brassicae spore solution
[0095] 1) Take out the disease root stored in the refrigerator at -20°C and thaw.
[0096] 2) Soak in 70% ethanol solution for 1 min.
[0097] 3) 10% NaClO treatment for 20 min, cover with tin foil, then rinse with sterile water for 3 times.
[0098] Use a juicer to grind the root block into a homogenate, filter twice with sterilized gauze. Centrifuge the filtrate at 500 rpm for 5 min, discard the black precipitate, and keep the supernatant and gray precipitate. Replace the new clean 50 mL centrifuge tube, add sterile water to 45 mL, centrifuge at 4000 rpm for 15 min, discard the supernatant. Dissolve the precipitate in sterile water, centrifuge at 4000 rpm for 10 min, repeat once. Dissolve the precipitate in 50% sucrose, centrifuge at 3100 rpm for 10 min, discard the supernatant. Add sterile water to 45 mL, centrifuge at 4000 rpm for 10 min, discard the supernatant, repeat 2-3 times. Dissolve the precipitate in 1 mL of sterile water to obtain a high concentration of spore solution, store it in a refrigerator at -4°C.
[0099] 3.2 Microscopic examination of T. radicicola resting spores
[0100] Use a pipette to take the spore suspension and add it to the edge groove of the hemocytometer cover glass (model 1 / 400 mm 2 ), until the cover glass is filled with T. radicicola spore suspension. Place it under a microscope for counting. Spores pressed on the upper and left lines are counted in the squares. Spore concentration (number / ml) = [(left upper + left lower + middle + right upper + right lower) total number of resting spores in 5 large squares] / (80 x 400 x 10 4 x dilution factor).
[0101] 3.3 Infection, disease and phenotype observation
[0102] After the cabbage seeds are sown and the true leaves appear, different bacterial solutions prepared in Example 3 are injected for inoculation, respectively. After 42 days of growth under normal conditions, the plants are carefully removed, the roots are washed clean with water, and the root disease is counted and photographed. The inventors divide the disease into 4 standards from 0 to 3, 0 level, no root swelling, normal development; 1 level, no main root swelling, normal development, small lumps on lateral roots; 2 level, main and lateral root swelling area more than 1 / 3 of the whole; 3 level: main and lateral root swelling is obvious, even with cracks and rot. Calculate according to the disease index calculation formula, as follows:
[0103] Disease Index = [(0 grade plant number * 0 + 1 grade plant number * 30 + 2 grade plant number * 60 + 3 grade plant number * 100) / total plant number] * 100.
[0104] If DI≥10, it is determined to be susceptible; if DI<10, it is determined to be resistant.
[0105] The results show that: with reference to Figure 5 , the disease index of the plant in which the BrSWEET14a gene is silenced is significantly lower than the control. With reference to Figure 6 , the plant in which the BrSWEET14a gene is silenced develops better.
[0106] Example 5
[0107] In this embodiment, screening of T-DNA insertion mutant material is carried out, including the following steps:
[0108] 4.1 DNA rapid extraction method for extracting DNA:
[0109] A centrifuge tube containing Arabidopsis thaliana leaves is added with 200 μl of DNA extraction buffer and magnetic beads, and a 65 Hz crusher is used to crush the tissue for 120 s to obtain a ground tissue liquid; the ground tissue liquid is all transferred into a 1.5 ml centrifuge tube, and centrifuged at 13,000 rpm for 8 min to obtain a supernatant; a new 1.5 ml centrifuge tube is prepared, 100 μl of isopropanol is added to each tube, 100 μl of the supernatant is transferred into a centrifuge tube containing an equal volume of isopropanol, and gently shaken about 50 times, and left to stand at room temperature for 5 min; centrifuged at 13,000 rpm for 6 min, and the supernatant is removed; the precipitate is washed twice with 1 ml of 70 vol% ethanol, specifically, shaken up and down 20 times, centrifuged at 13,000 rpm for 3 min, the supernatant is discarded, and the operation is repeated once; and left empty for 1 min. After washing, the liquid is aspirated, the precipitate is left to dry for 5 min, 25-50 μl of ddH2O is added, and stored at -20°C.
[0110] 4.2 PCR detection by three-primer method
[0111] The three-primer method requires three primers, and the primers are LP (SALK_010224C-LP), RP (SALK_010224C-RP), and BP (T-DNA-BP), and the specific primers are referred to Table 3.
[0112] According to the instructions of Enzymomics, the reaction system of 1.1x T3 Super Mix PCR (Enzymomics) is as follows: 44 μl of 1.1x T3 super Mix, 2 μl of Template, 2 μl of Primer F, and 2 μl of Primer R.
[0113] The program is set as: 98℃ pre-denaturation 2min 30sec, enter 35 cycles of amplification (98℃ denaturation 10sec, 55℃ annealing 10sec, 72℃ extension 10sec), finally 72℃ full extension 2min to ensure complete amplification of the fragment; the PCR products amplified by LP+RP primers and the PCR products amplified by RP+BP primers are mixed uniformly, and are separated by 1% agarose gel electrophoresis.
[0114] Detection results refer to Figure 7 and Figure 8 In the figure, lane 6 is a homozygous strain, and the homozygous mutant material is collected for subsequent experiments.
[0115] Table 3 Primers used for screening of T-DNA insertion mutant materials
[0116] Primer name Primer sequence (5'-3') T-DNA-BP ATTTTGCCGATTTCGGAAC (SEQ ID No. 9) SALK_010224C-LP AAGCATCATCGATCTCAAACG (SEQ ID No. 10) SALK_010224C-RP CGCACCCAATATATTTGGAAG (SEQ ID No. 11)
[0117] Example 6
[0118] In this embodiment, the construction of the BrSWEET14a overexpression vector is carried out, including the following steps:
[0119] Referring to the method of Example 1,
[0120] 5.1 Double enzyme digestion of pFGC1008-EGFP vector
[0121] The pFGC1008-EGFP is double enzyme-digested at Sal I and Kpn I sites, and the linear vector is recovered by electrophoretic separation of the large fragment product.
[0122] 5.2 Design of specific primers (primer sequence information is shown in Table 4) High-fidelity KOD enzyme amplification of BrSWEET14a CDS sequence (referring to SEQ ID No. 1), the PCR product is separated by 1% agarose gel electrophoresis, the length is consistent, and the gel is recovered.
[0123] 5.3 Homologous recombination and transformation
[0124] The method is the same as that of Example 1, 1.4 and 1.5, and the final vector map is shown in Figure 2 , and the final vector is pFGC1008-EGFP (OE-BrSWEET14a)
[0125] Table 4 Primers used for construction of heterologous overexpression vector
[0126]
[0127] Example 7
[0128] In this embodiment, Arabidopsis thaliana flower immersion transformation and screening of positive transformants are carried out, including the following steps:
[0129] 6.1 Floral dip transformation of Arabidopsis thaliana
[0130] The above bacterial liquid and the agrobacterium GV3101 liquid of pFGC1008 empty vector plasmid verified by sequencing were used as mother liquor to transform Arabidopsis thaliana by floral dip method, and the steps were as follows: 500 μl of agrobacterium liquid containing the target vector was added into 200 ml of liquid LB containing kanamycin and rifampicin (50 mg / L), and the bacteria were shaken at 28°C and 200 rpm for about 30 h until the OD 600 was 1.2; centrifuged at 8000 rpm for 10 min to obtain agrobacterium precipitate, and the bacterial liquid was resuspended in 200 ml of 5% sucrose; Silwet L-77 was added to a final concentration of 200 μl / L, and the bacterial liquid was obtained by shaking at 28°C and 200 rpm for 2 min; the open flowers and silique of wild-type Arabidopsis thaliana were removed, the flower buds were dipped in the bacterial liquid for 30 sec, the excess bacterial liquid was absorbed, and the buds were incubated at 25°C in the dark for 24 h, and then incubated normally; the dipping was repeated once a week.
[0131] When the target vector was the pure mutant material of Example 4, the mutant transformed wild-type Arabidopsis thaliana to obtain T-DNA insertion mutant plant seeds;
[0132] When the target vector was the BrSWEET14a overexpression vector of Example 5, the overexpression transformed wild-type Arabidopsis thaliana to obtain complementation plant seeds; the overexpression transformed T-DNA insertion mutant plants to obtain heterologous overexpression plant seeds.
[0133] 6.2 Preparation of kanamycin seed culture medium
[0134] 2.22 g of MS powder and 10 g of sucrose were taken, 2M NaOH was added to adjust the pH to 5.8 to obtain MS medium, 4 g of agar powder was then added, and then 121°C high-pressure steam sterilization was performed for 20 min; the medium was cooled to 50-60°C in a clean bench, kanamycin was added to a final concentration of 75 mg / L, and then the solid plate was poured to obtain the kanamycin seed culture medium.
[0135] 6.3 Screening of positive transformants
[0136] The different Arabidopsis thaliana T1 generation seeds obtained by dipping were seeded on kanamycin seed culture medium, and the steps were as follows: 10 vol% NaClO was used for disinfection for 2 min; 75 vol% ethanol was used for washing the seeds for 2 min; sterile water was used for washing 5 times, each time for 1 min; the seeds were seeded on the kanamycin seed culture medium, sealed, and incubated in a 22°C incubation room (16 h light, 8 h dark); after about two weeks, the positive plants with strong growth were removed. T-DNA insertion mutant plants, complementation plants, and heterologous overexpression plants were obtained.
[0137] Example 8
[0138] In this embodiment, the disease resistance of transgenic Arabidopsis plants is identified, including the following steps:
[0139] 7.1 Arabidopsis infection, disease and phenotype observation
[0140] When the heterologous overexpression, T-DNA insertion mutant and complementation plant obtained in Example 6 grow to two true leaves, the roots of the plants are immersed in a Plasmodiophora brassicae resting spore solution (1x10 7 / mL) for 45-60 min, and then transplanted into the medium. After 21 days of inoculation, the plants are dug out, and the disease is observed and counted.
[0141] The results show that in the disease experiment, the growth of the T-DNA insertion Arabidopsis mutant SALK_010224C (atsweet14) is significantly better than that of the wild type (WT) plant Figure 9 , the root swelling degree is lighter than that of the wild type Figure 12 , and the disease index is significantly lower than that of the wild type Figure 14 in A); the lack rate of the heterologous overexpression plant (OE-BrSWEET14a) is significantly higher than that of the wild type plant Figure 11 , the root swelling degree is heavier than that of the wild type Figure 13 , and the disease index is significantly higher than that of the wild type Figure 14 in B); the growth of the complementation plant (Rescue-BrSWEET14a) has no obvious difference with that of the wild type plant Figure 10 , and the root swelling degree Figure 12 and the disease index Figure 14 in A) of the two also have no significant difference. In summary, the Brassica rapa BrSWEET14a is closely related to the Plasmodiophora brassicae disease and is a Plasmodiophora brassicae disease susceptible gene.
[0142] Example 9
[0143] In this embodiment, the Brassica rapa BrSWEET14a expression localization analysis is carried out, including the following steps:
[0144] Referring to the method of Example 1,
[0145] The cDNA extracted from the roots of Brassica rapa ECD05 is used as a template, and specific primers (Table 5) are designed to amplify the CDS sequence of the gene BrSWEET14a (referring to SEQ ID No. 1). The gel is recovered and stored at -20℃. The subcellular localization vector is constructed using the pFGC5941-EGFP vector, and the double enzyme digestion sites are BamH I and Xba I. The enzyme digestion products are recovered, ligated, and transformed into E. coli (the final vector map is shown in Figure 3), the final vector was pFGC5941-EGFP (BrSWEET14a). After identifying positive clones, plasmids were extracted and transformed into Agrobacterium GV3101 by electroporation. After obtaining positive clones, tobacco was transiently transfected. The shaken Agrobacterium solution was centrifuged at 5000 rpm for 15 min, the supernatant was discarded, and resuspension liquid was added to resuspend the bacteria to an OD 600 value of 0.5. The bacterial solution was injected into tobacco leaves using a 2 mL syringe, and after dark culture for 24-48 h, a confocal microscope (Confocal LSM 780, Carl Zeiss) was used to take pictures to observe the subcellular localization Figure 15 ) of BrSWEET14a. The results showed that BrSWEET14a was localized in the cell membrane and nucleus. Figure 15
[0146] Table 5 Primers used for subcellular localization vector construction
[0147]
[0148] It should be noted that the materials used in the above examples can be easily obtained from commercial companies, unless otherwise specified.
[0149] wherein,
[0150] Arabidopsis: Arabidopsis thaliana of Col-0 type.
[0151] Cabbage belongs to Brassica rapa.
[0152] Cabbage ECD05 was received from Professor G.R. Dixon of the University of Reading, UK, and was propagated in the laboratory.
[0153] Preparation of diseased roots: A sufficient amount of cabbage ECD05 was planted, and the roots were taken 24 h after infection with Plasmodiophora brassicae to obtain diseased roots.
[0154] The above examples can better illustrate the technical solutions of the present application, but only preferred embodiments of the present application are described, and the scope of the present application is not limited. Various changes and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application.
Claims
1. Silencing of a Chinese cabbage root-knot nematode susceptibility-related gene BrSWEET14a In use in increasing plant resistance to root-knot nematode, characterized in that, The cabbage clubroot disease susceptible related gene BrSWEET14a The nucleotide sequence of the gene is shown as SEQ ID No. 1; and the plant is cabbage.
2. Silencing of a Plasmodiophora brassicae disease-related gene BrSWEET14a In the improvement of plant germplasm resources, characterized in that, Improvement of plant germplasm resources is to improve the resistance of plants to clubroot, and the nucleotide sequence of the clubroot disease-related gene of Brassica rapa is shown as SEQ ID No. 1 BrSWEET14a The plant is Brassica rapa.