Wheat scab resistance related TaDRB gene and application thereof

Abstract

The invention provides a wheat scab resistance related TaDRB gene, which has a nucleotide sequence as shown in SEQ ID NO: 1 and an amino acid sequence as shown in SEQ ID NO: 2. The invention further provides application, the TaDRB gene is expressed in wheat plants, the resistance of the wheat to the gibberellic disease is improved, the TaDRB gene is silenced in the wheat plants, the resistance to the gibberellic disease is reduced, and the TaDRB gene can also be applied to breeding of gibberellic disease resistant varieties of the wheat. The TaDRB gene provided by the invention is a key gene of wheat scab resistance, and can be applied to cultivation of wheat scab-resistant varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat fusarium head blight resistance, and specifically relates to a TaDRB gene related to wheat fusarium head blight resistance and an application thereof. Background Art

[0002] Fusarium head blight (FHB) is a serious fungal disease caused by Fusarium graminearum, which can cause a significant reduction in wheat yield and quality. In addition to causing large-scale yield reduction, wheat head blight also produces a class of fungal toxins represented by deoxynivalenol (DON), which has been listed as a Class 3 carcinogen and seriously threatens human and animal health. So far, head blight is still preventable but not curable. Once it occurs, it cannot be controlled and only preventive measures can be taken. Because the occurrence of head blight is affected by meteorological conditions, it is difficult to accurately predict the extent of the disease. Regardless of whether it occurs or not, it is generally necessary to prevent and control it 1 to 2 times, which also causes unnecessary waste and environmental pollution, which is contrary to the requirements of green production. Moreover, it is difficult to control highly susceptible varieties even with chemical control in the recurrence year. Therefore, cultivating and promoting disease-resistant varieties is the most economical and efficient way to solve the problem of head blight. However, factors such as the lack of wheat head blight resistance resources, few resistance genes, and unclear resistance mechanisms make it difficult to cultivate high-resistant and high-yield wheat varieties.

[0003] The Fhb1 resistance locus on the short arm of chromosome 3B from Sumai 3 is the strongest and most stable resistance locus to wheat fusarium head blight. However, due to the large size of the wheat genome and the fact that it is allopolyploid, research on cloning the resistance gene at the Fhb1 locus has been slow. It was not until 2016 that Rawat et al. used mutation analysis, gene silencing and transgenic overexpression techniques to identify a pore-forming toxin-like gene (PFT) in the Fhb1 locus of Sumai No. 3 that conferred resistance to wheat head blight. After the PFT gene was overexpressed in the susceptible varieties Bobwhite and Fielder, it was found that the transgenic plants had significantly improved resistance to head blight. Therefore, PFT was considered to be the main resistance gene in the Fhb1 locus (Rawat N, Pumphrey MO, Liu S, et al. Wheat Fhb1 encodes a chimeric lectin with agglutinin domains and a pore-forming toxin-like domain conferring resistance to Fusarium headblight. Nature genetics, 2016, 48(12): 1576). However, the resistance effect of this gene has been questioned since then, because the presence of the PFT gene has also been identified in many varieties susceptible to Fusarium fusarium and has a certain gene expression (He Y, Zhang X, Zhang Y, et al. Molecular characterization and expression of PFT, an FHBresistance gene at the Fhb1 QTL in wheat. Phytopathology, 2018, 108(6): 730-736).In 2019, Su et al. (Su Z, Bernardo A, Tian B, et al. A deletion mutation in TaHRC confersFhb1 resistance to Fusarium head blight in wheat. Nature genetics, 2019, 51(7): 1099-1105) and Li et al. (Li G, Zhou J, Jia H, et al. Mutation of a histidine-rich calcium-binding-protein gene in wheat confers resistance to Fusarium headblight. Nature genetics, 2019, 51(7): 1106-1112) used Ning7840 and Wangshuibai germplasm resources (containing the Fhb1 resistance site) respectively and identified a histidine-rich calcium-binding protein gene (His or TaHRC) near the PFT position of the Fhb1 site as the main resistance gene at this site. However, the two research teams had different results on the resistance mechanism of this gene. Su et al. believed that the protein encoded by TaHRC is a sensitive factor protein, the expression of this gene contributes to the infection of Fusarium graminearum, and the resistance at the Fhb1 locus is a gene-deficient resistance (loss-of-function) caused by the loss of this gene; while Li et al. believed that this protein is a host immune resistance-related protein, the expression of this gene improves wheat resistance, and the resistance at the Fhb1 locus is caused by the expression of the His gene, which is a gene-acquired resistance (gain-of-function). These studies also show that the Fhb1 resistance mechanism is relatively complex and may involve a series of genes. Lagudah et al. believed that PFT and TaHRC (or His) may both be involved in the resistance of the Fhb1 locus, and this locus may be a complex resistance mechanism mediated by multiple genes. In the future, further in-depth research and interpretation of the Fusarium fusarium resistance mechanisms of PFT and TaHRC (or His) are needed to truly understand the resistance mechanism of Fhb1.

[0004] Cultivating and planting fusarium head blight resistant varieties is the most economical and environmentally friendly way to control the damage caused by wheat fusarium head blight (Bai and Shaner 2004, Foroud et al., 2009). The scarcity of wheat fusarium head blight resistance genes and the unclear verification of resistance mechanisms restrict the progress of wheat fusarium head blight resistance breeding. Therefore, the cloning and functional research of disease resistance genes is of great significance for the study of the molecular mechanism of wheat disease resistance and molecular disease resistance breeding. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a TaDRB gene related to wheat fusarium ergot resistance and its application in view of the deficiencies of the above-mentioned prior art. The TaDRB gene is a key gene for wheat fusarium ergot resistance and can be applied to the breeding of wheat fusarium ergot-resistant varieties.

[0006] To solve the above technical problems, the technical solution adopted by the present invention is: a TaDRB gene related to wheat fusarium resistance, the nucleotide sequence of the TaDRB gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the TaDRB gene is shown in SEQ ID NO:2.

[0007] The present invention also provides the application of the above-mentioned TaDRB gene related to wheat fusarium head blight resistance. The TaDRB gene is expressed in wheat plants to improve the resistance of wheat to fusarium head blight. The TaDRB gene is silenced in wheat plants to reduce the resistance to fusarium head blight.

[0008] The present invention also provides the application of the above-mentioned TaDRB gene related to wheat fusarium head blight resistance, and the application of the TaDRB gene in wheat fusarium head blight-resistant varieties.

[0009] Compared with the prior art, the present invention has the following advantages:

[0010] The TaDRB gene in the present invention is a key gene for wheat fusarium head blight resistance and can be applied to the breeding of wheat fusarium head blight-resistant varieties.

[0011] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It indicates that DRB interacts with PFT in yeast two-hybrid, and the screening pressure is SD / -Trp / -Leu / -His / -Ade / ABA / X-α-gal.

[0013] Figure 2 Indicates the bimolecular fluorescence complementation interaction between DRB and PFT.

[0014] Figure 3 The yellowing phenotype produced by VIGS silencing of the DRB gene in wheat Sumai 3. Left: empty control wheat plants; right: PDS silenced wheat plants.

[0015] Figure 4 Indicates the expression level detection of wheat DRB gene silencing. F: indicates FES-treated control plants; B: indicates VIGS empty-load control plants; S: indicates DRB gene silencing-treated plants.

[0016] Figure 5The figure shows the quantitative phenotype of the resistance to Fusarium fusarium after silencing the DRB gene of wheat Sumai 3. The ordinate represents the number of diseased spikelets in the detected spike head, and the abscissa represents the number of days after inoculation of the pathogen.

[0017] Figure 6 The figure shows the phenotype of Fusarium head blight resistance in wheat Sumai 3 after VIGS-silenced DRB gene 21 days after pathogen inoculation. Left: control wheat plant; right: DRB-silenced wheat plant. DETAILED DESCRIPTION

[0018] Example 1

[0019] This example is a TaDRB gene related to wheat fusarium head blight resistance. The nucleotide sequence of the TaDRB gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the TaDRB gene is shown in SEQ ID NO:2.

[0020] The wheat fusarium head blight resistance-related genes also include nucleotide sequences having wheat disease resistance activity formed by base deletion, substitution, insertion or mutation based on SEQ ID NO: 1.

[0021] This embodiment also provides the application of the above-mentioned TaDRB gene related to wheat ergot resistance. The TaDRB gene is expressed in wheat plants to improve the resistance of wheat to ergot. The TaDRB gene is silenced in wheat plants to reduce the resistance to ergot. The TaDRB gene can be used in the breeding of wheat varieties resistant to ergot.

[0022] 1. Extraction of total RNA and synthesis of cDNA from wheat

[0023] Wheat total RNA was extracted according to the instructions of the RNA extraction kit (RNAsimply total RNA Kit, Beijing Tiangen Company), and the extracted RNA was reverse transcribed into cDNA using Prime Script RT regant Kit (Dalian TaKaRa Company).

[0024] 2. Cloning of wheat TaDRB gene

[0025] Based on the information obtained from PFT screening of the wheat yeast two-hybrid library, the wheat TaDRB gene sequence (SEQ ID NO: 1) was obtained after searching NCBI, and primers were designed.

[0026] Forward primer: 5'-ATGTACAAGAACCAGCTGC-3',

[0027] Reverse primer: 5′-GTGCTCTGCAGGTGCTGCC-3′.

[0028] The cDNA of "Sumai No. 3" was used as a template for amplification. The PCR reaction conditions were: 94℃5min, 94℃30s, 55℃30s, 72℃90s, 30 cycles in total; 72℃5min. After PCR was recovered by 1.2% agarose gel electrophoresis, it was connected to the pMD18-T vector and transformed into Escherichia coli DH5α. The extracted plasmid was sent to Wuhan Jinkairui Biotechnology Co., Ltd. for sequencing after identification.

[0029] 3. Yeast two-hybrid experiment verifies the interaction between DRB and PFT

[0030] (1) Construction of required vectors: The coding gene of TaDRB (SEQ ID NO: 1) was constructed into the pGADT7 vector to obtain TaDRB-pGADT7; the coding gene of PFT (Rawat N, Pumphrey MO, Liu S, et al. Wheat Fhb1encodes a chimeric lectin with agglutinin domains and a pore-forming toxin-like domain conferring resistance to Fusarium head blight. Nature genetics, 2016, 48(12): 1576) was constructed into the pGBKT7 vector to obtain PFT-pGBKT7.

[0031] (2) Activation of strains: Streak Y2HGold competent yeast cells on YPDA solid medium and culture at 28°C for 3 days.

[0032] (3) Pick 2-3 fresh monoclonal colonies and inoculate them into 2-3 mL YPDA liquid culture medium. Incubate overnight at 28°C with a shaker at 200 rpm.

[0033] (4) The shaken bacteria were inoculated into 200 mL YPDA liquid culture medium and cultured at 28°C in a shaker at 200 rpm until OD600 = 0.6.

[0034] (5) Centrifuge at 700 g for 5 min at room temperature to collect the bacteria and discard the supernatant.

[0035] (6) Use 50 mL ddH 2 Resuspend the cells in 5% paraformaldehyde and centrifuge at 700 g at room temperature to collect the cells, and discard the supernatant.

[0036] (7) Calculate the required volume of 1×TE / LiAc and use it to resuspend the bacteria to make yeast competent cells.

[0037] (8) Add the vector plasmid (TaDRB-pGADT 7 +PFT-pGBKT 7 , TaDRB-pGADT 7 +pGBKT 7 , pGADT 7 +PFT-pGBKT 7 , pGADT 7 +pGBKT 7 , Figure 1 ) were added with 600 ng each, and then 10 μL of ssDNA was added respectively. After mixing, 100 μL of yeast competent cells in step (7) was added and mixed.

[0038] (9) After mixing 50% PEG:10×TE:10×LiAc=8:1:1, add 600 μL to the mixture in step (8), vortex to mix, and incubate at 30°C, 200 rpm for 30 min.

[0039] (10) Add 70 μL of DMSO, mix well, heat shock in a 42°C water bath for 15 min, immediately place on ice for 5 min, and centrifuge at 12,000 g at room temperature to collect the bacteria.

[0040] (11) Remove the supernatant, add 200 μL 1× TE to resuspend the cells, spread them directly on SD / -Trp / -Leu medium, and culture them inverted at 30°C for 3 days.

[0041] (12) Pick a single clone on the SD / -Trp / -Leu medium and use 100 μL ddHO 2 O suspension, mix well and then add ddH 2 Dilute 10 times of 5 μL ...

[0042] The results showed that TaDRB-pGADT 7 +PFT-pGBKT 7 After co-transformation, yeast can grow on the four-deficient medium and appear blue, indicating that TaDRB and PFT have an interaction relationship ( Figure 1 a).

[0043] 4. Bimolecular fluorescence complementation experiments verify the interaction between TaDRB and PFT

[0044] The interaction between TaDRB and PFT was verified by bimolecular fluorescence complementation experiments. First, the coding genes of TaDRB and PFT were connected to the yellow fluorescent protein (YFP) C-terminal vector YC and YFP N-terminal vector YN to obtain TaDRB-YC and PFT-YN, respectively. Then, after transformation with Agrobacterium, the two proteins were transiently expressed in tobacco. If the two proteins interacted and formed a functional YFP protein when close to each other, fluorescence could be observed under the irradiation of yellow fluorescent excitation wave. If the corresponding negative control did not emit light, it indicated that there was an interaction between the two proteins.

[0045] The specific operation steps are as follows: (1) First, the coding genes of DRB and PFT are connected to the YFP C-terminal vector YC (pEarleyGate201-YC) and the YFP N-terminal vector YN (pEarleyGate202-YN) to obtain TaDRB-YC and PFT-YN, and then transformed into Agrobacterium. (2) Pick a single clone of Agrobacterium, inoculate it in 3-5mL liquid YEB culture medium, and culture it in a shaking incubator at 28℃ overnight. Other Agrobacterium that need to be cultured include YN and YC. (3) Use a spectrophotometer to measure OD 600 , general OD 600 = 0.6 is the most suitable. Calculate the volume of bacterial solution required to prepare the transformation solution. The formula is: V construct =V final ×0.5 / OD 600 . (4) Mix the calculated Agrobacterium required according to the experimental requirements in the same 2mL centrifuge tube, and centrifuge at room temperature and 12000g for 1 min. (5) Discard the supernatant and retain the bacteria, resuspend the bacteria in 2mL of transformation solution. The transformation solution formula is 10mlMES-KOH (pH 5.7), 10ml MgCl2, 150μlAcetosyringone. (6) Place the transformation solution in a 28℃ oven for 2h to recover and culture before it can be used for injection into tobacco. (7) Select well-grown tobacco leaves, inject Agrobacterium on the back, grow under normal conditions for 2-3 days, cut the leaves, and observe the luminescence under a laser confocal microscope.

[0046] The results showed that TaDRB and PFT had an interactive relationship ( Figure 2 ).

[0047] 5. Construction of BSMV-VIGS vector system for inducing DRB gene downregulation

[0048] Primer DRB-F (VIGS) was designed based on the forward sequence of DRB gene (TAGCTGAGCGGCCGCCCCGGGTGTACAAG AACCAGCTGCAG) and DRB-R(VIGS)( TAGCTGATTAATTAACCCGGGCGCCGCATTGCCGTCG CAAC), the 15bp terminal sequence of the vector after SmaI digestion was introduced into the 5' end of the upstream and downstream primers (the underlined sequence at the 5' end of the primer is the 15bp terminal sequence of the vector), so that the amplified fragment can be seamlessly connected to the BSMV-γ vector. The specific amplification is as follows: PCR is performed using DRB-F (VIGS) and DRB-R (VIGS) as primers and the pMD-18T vector containing TaDRB as a template to amplify the 831bp fragment in TaDRB. PCR program: 1μL plasmid template (100ng / μL), 2μL 5' primer, 2μL 3' primer, 25μL Max Premix, add water to 50μL. PCR reaction conditions: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 55℃ annealing for 15s, 72℃ extension for 20s, 35 cycles, and 72℃ extension for another 5min. PCR was recovered after detecting the amplified band by 1.5% agarose gel electrophoresis. After the TaDRB fragment was amplified and recovered, the TaDRB amplified fragment was connected to the BSMV-γ vector (Vazyme, China) using seamless ligation technology, and transformed into DH5α competent cells. The single clone containing the target fragment was selected for sequencing, which showed that the TaDRB gene in the single clone was reversely inserted between the SmaI restriction sites of BSMV-γ. The γ-DRB vector was successfully constructed and can be used for the next step of in vitro transcription and gene silencing. The γ-PDS vector carrying the barley phytoene dehydrogenase gene (PDS) fragment was preserved by our laboratory and used as a positive control for gene silencing. After the gene was silenced, the leaves of the plants showed whitening ( Figure 3 ).

[0049] 6. In vitro transcription process: According to the instructions for plasmid extraction (Tiangen Company), BSMV viral vectors α, β, γ, γ-PDS and recombinant γ-DRB plasmids carrying exogenous insertion fragments of target genes were extracted respectively, and then the linearized vectors were transcribed in vitro using the mMESSAGE mMACHINET7 in vitro transcription kit (AM1340, Ambion). After in vitro transcription, equal volumes of α chain transcripts, β chain transcripts and γ chain transcripts were mixed, diluted with three volumes of DEPC water, and then 2×GKP Buffer (50mM glycine, 30MmK2HPO4, PH 9.2, 1% bentonite, 1% celite) was added, and the mixture was stored in a -80℃ refrigerator for later use.

[0050] 7. Virus inoculation of wheat ears: Before inoculation, select wheat ears that are in the heading stage and will soon go out in one or two days, and water the corresponding plants sufficiently. When inoculating, first use the thumb and index finger of the right hand wearing latex gloves to rub the leaf sheath wrapped around the wheat ears with moderate force until all the liquid disappears. At this time, you can feel that the resistance of the finger rubbing the leaf sheath has increased significantly, and a slight "squeaking" sound is emitted. After all the inoculations are completed, use a spray bottle to spray a small amount of DEPC water on the inner wall of the large plastic bag, put the entire large plastic bag outside the flower pot of the inoculated plant, and then place it in a dark growth room at about 23°C. After 24 hours, remove the plastic bag, and the plant will be transferred to normal culture conditions for growth, and the growth temperature is controlled at 20°C-28°C.

[0051] 8. Fusarium graminearum inoculation and resistance identification: About one week after inoculation, wheat ears entered the initial flowering stage, and Fusarium graminearum single flower drip method was used to identify Fusarium graminearum resistance. Ten days after inoculation, the Fusarium graminearum spikelets inoculated with blank control Mock, empty vector control BSMV-γ, and BSMV-TaDRB carrying gene fragment vector were sampled and RNA was extracted, and the silencing efficiency of TaDRB was detected by fluorescent quantitative PCR.

[0052] 9. Inoculate the ear of Sumai No. 3 resistant to scab to induce gene silencing, and then inoculate the scab pathogen to identify whether the resistance has changed. The results showed that the expression of TaDRB was analyzed 10 days after the application of the pathogen. Compared with the control BSMV-γ, the relative expression of TaDRB in BSMV-TaDRB was significantly decreased ( Figure 4 ). The number of diseased spikelets was investigated 7, 14 and 21 days after inoculation with the fusarium scab pathogen. The results showed that the number of diseased spikelets in the BSMV-γ and Mock control plants remained basically unchanged, and the plant resistance did not change. However, the number of diseased spikelets in the BSMV-TaDRB silenced plants was significantly higher than that in the control 7, 14 and 21 days after inoculation with the fusarium scab pathogen, and it showed a continuous increasing trend with the extension of time after inoculation with the fusarium scab pathogen ( Figure 5 ). 21 days after inoculation with the pathogen, the fusarium phenotype of the BSMV-TaDRB-silenced plants had spread to the entire spikelet, while the fusarium phenotype of the BSMV-γ and Mock control plants was limited to no or little expansion in the inoculated spikelet ( Figure 6 ). In summary, TaDRB silencing can significantly reduce the resistance of the disease-resistant material Sumai No. 3.

[0053] The expression splicing regulatory factor TaDRB of the target defense gene mRNA derived from the wheat scab resistant variety "Sumai No. 3" of the present invention can interact with the scab resistant protein PFT of "Sumai No. 3" to improve the disease resistance of the plant, and its nucleotide sequence is shown in SEQ ID NO.1. The present invention determines that the TaDRB gene is a splicing regulatory factor TaDRB of the target defense gene mRNA derived from the wheat scab resistant variety "Sumai No. 3", which interacts with TaPFT in both yeast and plants; and after silencing the TaDRB gene in the plant, the plant's susceptibility to disease increases. Therefore, the TaDRB gene can be used to analyze the TaPFT scab resistance mechanism and improve wheat resistance to scab, and has a broad application space in plant resistance theory analysis, breeding, and cultivation.

[0054] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A TaDRB gene related to wheat fusarium head blight resistance, characterized in that: The nucleotide sequence of the TaDRB gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the TaDRB gene is shown in SEQ ID NO:

2.

2. An application of the TaDRB gene related to wheat fusarium resistance as claimed in claim 1, characterized in that: The TaDRB gene is expressed in wheat plants to improve the resistance of wheat to fusarium head blight, and the TaDRB gene is silenced in wheat plants to reduce the resistance to fusarium head blight.

3. An application of the TaDRB gene related to wheat fusarium resistance as claimed in claim 1, characterized in that: The application of the TaDRB gene in wheat varieties resistant to ergot.

Images