A pig feed conversion rate related SNP molecular marker, a screening method and application thereof

By screening the SNP molecular marker at position 235291491 on chromosome 1 of the international pig reference genome, the problem of difficulty in screening markers related to pig feed conversion rate in existing technologies was solved, the effect of reducing feed costs and environmental pollution was achieved, and the efficiency of genetic improvement of pig feed conversion rate was improved.

CN119552970BActive Publication Date: 2025-10-10CHONGQING ACAD OF ANIMAL SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411656476.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2025-10-10
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively screen molecular markers related to pig feed conversion efficiency, resulting in high feed costs and serious environmental pollution, and a lack of efficient genetic improvement methods.

Method used

Through whole-genome selection signal detection, the SNP molecular marker at position 235291491 on chromosome 1 in the International Pig Reference Genome Version 11.1 was screened out. Gene chip technology was used for detection, combined with PLINK software for quality control and population differentiation index method to screen out SNP molecular markers related to feed conversion rate.

Benefits of technology

It achieves rapid, sensitive and specific marker-assisted selection, reduces the feed conversion rate of pigs, reduces nitrogen emission pollution and improves the efficiency of genetic improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119552970B_ABST
    Figure CN119552970B_ABST
Patent Text Reader

Abstract

The application discloses a pig feed conversion rate related SNP molecular marker and a screening method and application thereof, and belongs to the technical field of molecular biology. The pig feed conversion rate related SNP molecular marker is located at the 235291491th position of the first chromosome in the international pig reference genome 11.1 version, and is screened through the following steps: (1) constructing a pig feed conversion rate phenotype; (2) collecting a pig tissue sample and extracting DNA; (3) sequencing and quality-controlling the SNP molecular marker; and (4) detecting a whole genome selection signal based on a population differentiation index method, and screening the SNP molecular marker. The application aims to screen the SNP molecular marker related to the feed conversion rate trait, and provides a new thought for reducing cost and increasing efficiency in actual production work.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and in particular relates to a pig feed conversion rate-related SNP molecular marker and a screening method and application. Background Art

[0002] Feed conversion efficiency (FCR) is a key indicator for measuring pigs' feed efficiency. FCR is the ratio of an individual's average daily feed intake to their average daily weight gain. Because FCR is easy to calculate and correlates well with body weight, it is widely used to assess pig feed efficiency. With the rapid development of the livestock industry, feed costs have gradually increased as a proportion of total production costs, accounting for approximately 50% to 85% of total costs. The key to reducing feed costs is improving feed efficiency. Improving feed efficiency not only reduces feed consumption, but also lowers breeding costs and energy use, and also reduces manure production and potential greenhouse gas emissions.

[0003] In recent years, with the rapid development of high-throughput genotyping and molecular technologies, there has been increasing interest in the molecular processes and genetic mechanisms that influence FCR in pigs. Selection signals refer to structural changes in the animal genome during natural or artificial selection. Capturing existing selection signals and potential selected loci across the entire genome of an animal population through selection signal detection can help reveal the underlying selection and genetic mechanisms for important economic traits in livestock and poultry. Therefore, this study conducted genome-wide selection signal detection in Large White pigs to screen for molecular markers associated with feed conversion efficiency, providing a reference for cost reduction and efficiency improvement in actual production. Summary of the Invention

[0004] In response to the above-mentioned existing technologies, the present invention provides a pig feed conversion rate-related SNP molecular marker and screening method and application, aiming to screen out SNP molecular markers related to feed conversion rate traits, and provide new ideas for reducing costs and increasing efficiency in actual production work.

[0005] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention is: to provide a SNP molecular marker related to pig feed conversion rate, which is located at position 235291491 on chromosome 1 in the international pig reference genome version 11.1, and the SNP molecular marker has a C / T polymorphism.

[0006] On the basis of the above technical solution, the present invention can also be improved as follows.

[0007] Furthermore, the SNP molecular marker is located at position 200 in the nucleotide sequence shown in SEQ ID No.1.

[0008] Furthermore, the method for screening SNP molecular markers related to pig feed conversion efficiency includes the following steps:

[0009] (1) Construct a feed conversion efficiency phenotype for pigs, where feed conversion efficiency is the ratio of average daily feed intake to average daily weight gain;

[0010] (2) Collect pig tissue samples and extract DNA;

[0011] (3) Use gene chips for sequencing and quality control of SNP molecular markers;

[0012] (4) Based on the population differentiation index method, whole-genome selection signal detection was performed to screen out SNP molecular markers.

[0013] Furthermore, step (3) was quality controlled using PLINK software. The quality control criteria were to exclude the following sites: sites on abnormal chromosomes, SNP molecular markers with a site detection rate < 0.1, individuals with an individual detection rate < 0.1, sites with a minimum allele frequency < 0.05, and sites with a Hardy-Weinberg equilibrium < 1 × 10 -6 's location.

[0014] Furthermore, the specific method of step (4) is: sorting according to the feed conversion rate, dividing the top 30 and bottom 30 into two groups, using the fst method of PLINK software to perform genome-wide selection signal detection on the two groups, and screening F ST SNP molecular markers with scores > 0.15.

[0015] The beneficial effect of the above-mentioned further technical solution adopted by the present invention is that the screening method for SNP molecular markers related to the feed conversion rate trait of pigs provided by the present invention can detect the genotype of pigs by using gene chip technology in vitro, and perform marker-assisted selection on the feed conversion rate trait of pigs, which has the advantages of being simple, fast, highly sensitive and specific.

[0016] Furthermore, the application of pig feed conversion rate-related SNP molecular markers in screening pig breeds with excellent pig feed conversion rate.

[0017] Furthermore, the screening method is to detect the base type of chromosome 1 at position 235291491 in the International Pig Reference Genome version 11.1, and select pig breeds with the genotype of this site being CC or CT.

[0018] Furthermore, pig strains with a CC genotype at position 235291491 of chromosome 1 in the International Pig Reference Genome version 11.1 were selected.

[0019] Further, the screening method comprises the following steps:

[0020] (1) Take pig tissue samples and extract genomic DNA;

[0021] (2) PCR amplification of genomic DNA using primers representing the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3;

[0022] (3) Sequencing the PCR amplification product obtained in step (2) to determine the base type of the SNP molecular marker.

[0023] The present invention has the following beneficial effects: The method for screening SNP molecular markers associated with feed conversion efficiency provided by the present invention, which screens out a molecular marker at position 235291491 on chromosome 1 in the International Porcine Reference Genome version 11.1, can be used in association analysis of feed conversion efficiency in Large White pigs. Using the significant SNP molecular markers identified by this method for marker-assisted selection can rapidly screen for genotypes with low feed conversion efficiency. Applying Large White pigs with CC or CT genotypes, which have even lower feed conversion efficiency, to production can not only reduce feed costs but also mitigate environmental pollution from nitrogen emissions without affecting animal production performance or product quality, greatly accelerating the genetic improvement of the feed conversion efficiency trait in Large White pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Flow chart of the screening steps for SNP molecular markers related to pig feed conversion efficiency;

[0025] Figure 2 The PCA graph and phylogenetic tree graph of the experimental population, where a is the PCA graph and b is the phylogenetic tree graph;

[0026] Figure 3 Manhattan plot of signal analysis results for the selected experimental population;

[0027] Figure 4 For use F ST PCA diagram and phylogenetic tree diagram of the experimental population drawn for significant sites with a value greater than 0.15, where a is the PCA diagram and b is the phylogenetic tree diagram;

[0028] Figure 5 This is a feed conversion efficiency analysis chart of different genotypes at position 235291491 on chromosome 1 in the International Pig Reference Genome version 11.1. DETAILED DESCRIPTION

[0029] The specific implementation methods of the present invention are described in detail below with reference to the embodiments.

[0030] The flow chart of the screening steps for SNP molecular markers related to pig feed conversion rate is as follows Figure 1 shown.

[0031] Example 1: Constructing a pig feed conversion efficiency phenotype

[0032] Large White pigs with an average initial weight of 20.28 kg and an average initial age of 74.76 days were selected and fed a 555 fattening feed from Weinan Dabeinong Agricultural and Animal Husbandry Technology Co., Ltd. until approximately 168.06 days of age, with ad libitum access. The average daily feed intake and average daily weight gain (ADG) of the pigs were recorded throughout the feeding process, as well as their final age and weight. The ratio of average daily feed intake to ADG was used as the feed conversion rate for each individual pig. Phenotypes were constructed using the mean ± 3 standard deviations for quality control. A total of 113 individual phenotypes were constructed.

[0033] Feed conversion ratio was calculated using the following formula:

[0034] .

[0035] Example 2: Sample collection and DNA extraction

[0036] Ear tissues of experimental Large White pigs were collected and DNA was extracted as sequencing samples. Genotyping was performed using the "Zhongxin No. 1" 50K SNP breeding chip produced by Beijing Compson Agricultural Technology Co., Ltd.

[0037] The genotyping procedures for the "SMIC-1" 50K SNP breeding chip are as follows: quantitative analysis of gDNA from all samples using agarose gel electrophoresis and Nanodrop ND-2000; whole-genome amplification of all samples (incubation at 37°C for 24 h); fragmentation, precipitation, and resuspending of gDNA in hybridization buffer; application of the resuspended DNA fragments to the chip and hybridization (incubation at 48°C for 24 h); washing to remove nonspecifically bound DNA after hybridization, and single-base extension of the remaining specifically bound sites; scanning using the Illumina iScan Reader; and finally, reading of genotype data using GenomeStudio software.

[0038] Example 3: Gene chip version conversion and SNP molecular marker quality control

[0039] The "SMIC-1" 50K SNP breeding array used by Compson Agricultural Technology Co., Ltd. uses the International Porcine Reference Genome version 10.2. The chip version was converted to the International Porcine Reference Genome version 11.1. PLINK v1.90 software was used to perform quality control on the 11.1 version of the array. The quality control criteria included excluding the following sites: non-somal sites, SNP markers with a site detection rate of <0.1, individuals with an individual detection rate of <0.1, sites with a minimum allele frequency of <0.05, and sites with a Hardy-Weinberg equilibrium of <1×10 -6 After quality control, 36,127 SNP molecular markers from the remaining 113 individuals were used for subsequent analysis.

[0040] Example 4: Principal component analysis of the experimental population

[0041] SNP molecular markers with linkage disequilibrium <0.5 between adjacent sites screened using PLINK v1.90 software (--indep-pairwise 50 5 0.5) were used for principal component analysis; the first 10 principal components were then calculated using GCTA v1.94 software, and the principal component results were visualized using R v4.4.1 software. The results are shown in Figure 2. Figure 2 As shown in a.

[0042] Example 5: Construction of experimental population evolutionary tree

[0043] PLINK v1.90 software was used to calculate the IBS (identity-by-descent) distance between individuals. MEGA v11.0.13 software was then used to convert the genetic distance file format and construct a phylogenetic tree using the neighbor-joining method. Finally, the Rv4.4.1 software ggtree package was used to visualize the graph. The results are shown in the figure. Figure 2 As shown in b.

[0044] Example 6: Genome-wide selection signal detection

[0045] The experimental population was divided into T and L populations according to the phenotypic values ​​of the 113 models. The phenotypic values ​​were sorted in ascending order. The top 30 individuals were selected to form the T population, and the bottom 30 individuals were selected to form the L population. The selection signal of the two subpopulations was detected using the fst method of PLINK v1.90 software (--fst). The ggplot package of R v4.4.1 software was used to plot the results. F ST The Manhattan diagram of the analysis results is as follows Figure 3 shown.

[0046] Example 7: Screening for SNP markers with significant selection signals

[0047] When SNP molecular markers F ST When the score is greater than 0.15, it is considered that there is a large genetic differentiation between the SNP molecular markers among the groups. F ST SNP molecular markers with a score > 0.15 were selected as significant SNP molecular markers. A total of 78 significant SNP molecular markers were screened in the present invention, distributed on chromosomes 1, 3, 5, 6, 8, 11, 14 and 17, of which 62 significant SNP molecular markers were distributed on chromosome 1, including Figure 3 shown F STThe SNP molecular marker with the highest score is position 235291491.

[0048] Example 8: Using significant SNP molecular markers to draw PCA diagrams and phylogenetic tree diagrams;

[0049] The methods of Examples 4 and 5 were used to perform PCA analysis and phylogenetic tree construction on the signal-significant SNP molecular markers screened out in Example 7. The results are as follows: Figure 4 a. Figure 4 As shown in b. Figure 2 Compared with 2a and 2b, PCA analysis and phylogenetic tree construction using significant SNP molecular markers can distinguish the T group from the L group, indicating that there is a large genetic differentiation between the two groups using the significant SNP molecular markers identified by the present invention.

[0050] Example 9: F ST Analysis of phenotypic values ​​corresponding to different genotypes of the SNP molecular marker with the highest score

[0051] right Figure 3 The SNP molecular markers at position 235291491 of chromosome 1 were analyzed and the frequencies of different genotypes at this site were statistically analyzed. The results are as follows Figure 5 As shown, this SNP molecular marker has a C / T polymorphism. There are 9 individuals with the CC genotype, 18 individuals with the CT genotype, and 33 individuals with the TT genotype. The T test was used to calculate whether there are differences in the phenotypic values ​​of different genotype values ​​at this site. The T test results showed that when the genotype was CC, the feed conversion rate was the lowest, and when the genotype was TT, the feed conversion rate was the highest. The difference between the two was extremely significant.

[0052] The nucleotide sequences upstream and downstream of the SNP marker at position 235291491 on chromosome 1 in the International Pig Reference Genome 11.1 are as follows:

[0053] 5'-TGGGAGCTAGAGATAAGCAGAAATTTTTTACACTTTACCCCCTTACACACACACACACACAAAAAAACATGAAAAAAGGGAGGGAAAGGGAAAATTGATAAACTGGATTTCATCAAAATTTAAAACTTCTGCTTTGCAAAAGCTCATGTAAAGATGCTGGAAAGGCAAGCTACAGACTGGGAAAGAAATTATGCAAATTA CATATCCAGTGAAGAATTAATATCTAGAATATATAAGGAACCCTCAAAATTTATCAGGGAAAATTTTTTAAAATGAGAAAATGGGCAAAAGATAAGTAGAGACAGTTCACTGACAAGGCTATAGAAATGGTAAATAAGCTCATGAAAAGATATTCATTATTAGCCATGAAGGAGATGCAAATTAAAAATACGATGAAA-3' (SEQ ID No.1);

[0054] The SNP molecular marker is located at position 200 in the nucleotide sequence shown in SEQ ID No.1.

[0055] Example 10: A method for screening the genotype of chromosome 1 at position 235291491 in the International Porcine Reference Genome Version 11.1, comprising the following steps:

[0056] (1) Obtain pig ear tissue and extract genomic DNA;

[0057] (2) PCR amplification of genomic DNA, the amplification primers are:

[0058] Forward primer: 5'-AAGGGAGGGAAAGGGAAA-3' (SEQ ID NO. 2);

[0059] Reverse primer: 5'-TATAGCCTTGTCAGTGAACT-3' (SEQ ID NO.3);

[0060] The amplification system is shown in Table 1:

[0061] Table 1 PCR amplification system

[0062]

[0063] Amplification conditions are shown in Table 2:

[0064] Table 2 PCR amplification conditions

[0065]

[0066] (3) Sequencing the PCR amplification product obtained in step (2) to determine the base type of the SNP molecular marker.

[0067] The length of the obtained PCR amplification product was 248 bp. Based on the sequencing results, pig strains with a genotype of CC or CT at position 235291491 on chromosome 1 in the International Pig Reference Genome Version 11.1 were selected.

[0068] Although the specific embodiments of the present invention have been described in detail in conjunction with the embodiments, this should not be construed as limiting the scope of protection of this patent. Within the scope described by the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of this patent.

Claims

1. Application of SNP molecular markers related to pig feed conversion efficiency, characterized by: The SNP molecular marker associated with pig feed conversion rate is located at position 235291491 on chromosome 1 in the international pig reference genome version 11.

1. The polymorphism of this SNP molecular marker is C / T; the SNP molecular marker associated with pig feed conversion rate is used to screen Large White pig breeds with excellent pig feed conversion rate.

2. The use according to claim 1, characterized in that The screening is to detect the base type of position 235291491 of chromosome 1 in the International Pig Reference Genome Version 11.1, and select pig strains with a genotype of CC or CT at this site.

3. The use according to claim 2, characterized in that: The pig strains with CC genotype at position 235291491 of chromosome 1 in the International Pig Reference Genome Version 11.1 were selected.

4. The use according to claim 3, characterized in that The screening comprises the following steps: (1) Take pig tissue samples and extract genomic DNA; (2) PCR amplification of genomic DNA using primers representing the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3; (3) Sequencing the PCR amplification product obtained in step (2) to determine the base type of the SNP molecular marker.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to pig feed conversion rate and application thereof

    CN114182025A

  • SNP (Single Nucleotide Polymorphism) molecular marker associated with total nipple number of Sushan pigs and application of SNP molecular marker

    CN116121402A