KASP markers associated with wheat thousand kernel weight and their application

By using exome sequencing and KASP marker technology, SNP sites related to the thousand-grain weight of wheat were screened out, and primer combinations were designed for PCR amplification, which solved the problem of identifying the thousand-grain weight of wheat, and achieved efficient and accurate breeding screening and improvement, thus promoting the development of high-yield wheat varieties.

CN119553003BActive Publication Date: 2025-11-04INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411712637.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-27
Publication Date
2025-11-04
Estimated Expiration
2044-11-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and economically identify and improve the thousand-grain weight of wheat, which affects wheat yield and quality.

Method used

Exome sequencing technology was used to screen for SNP sites associated with wheat thousand-grain weight, and KASP markers and primer combinations were designed. KASP technology was used for efficient and accurate genotyping, and corresponding detection reagents or kits were provided for PCR amplification. Thousand-grain weight was evaluated through genotyping analysis.

Benefits of technology

It enables rapid and accurate assessment of the thousand-grain weight of wheat, improves breeding efficiency, shortens the breeding cycle, and allows for the rapid screening of high-yielding wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and discloses a KASP marker related to the thousand-grain weight of wheat and an application thereof.A SNP site of the present application is located at the 33397938 bp of the 1A chromosome of wheat, and the polymorphism is C / T.Through phenotype difference and exon capture analysis, the SNP site closely related to the thousand-grain weight is determined, and a specific KASP primer combination is designed to realize the rapid and accurate identification of the thousand-grain weight of wheat.The application of this technology has a significant meaning for accelerating the wheat high-yield breeding.It not only improves the selection efficiency, but also shortens the breeding period, and is helpful for quickly identifying and cultivating the wheat varieties with ideal thousand-grain weight.The use of the KASP primer combination provides an effective tool for the molecular marker-assisted selection of the yield-related traits of wheat, and can improve the overall yield and quality of crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a KASP marker associated with the thousand-grain weight of wheat and its application. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is a widely cultivated food crop globally, and its extensive planting area and high yield have a significant impact on food security. Thousand-grain weight, the weight of one thousand grains of wheat, is a key indicator for measuring wheat plumpness and potential yield. It not only affects wheat plant type and lodging resistance but also directly relates to final yield and quality. Therefore, increasing the thousand-grain weight of wheat is one of the important goals in breeding and agricultural production.

[0003] Exome sequencing is a technique that uses sequence capture technology to capture and enrich DNA from the exon regions of the entire genome, followed by high-throughput sequencing to discover genetic mutations associated with protein functional variations. Compared to whole-genome sequencing, exome sequencing is more economical and efficient, and has significant advantages in studying known SNPs and InDels. KASP (Kompetitive Allele Specific PCR) is a molecular marker method based on SNP sites, favored in genotyping due to its high stability, accuracy, and cost-effectiveness. It is particularly suitable for high-throughput analysis, especially when processing large numbers of samples but with limited available SNP sites. The application of KASP technology not only improves the speed and efficiency of genotyping but also reduces costs, making it a promising area for application in agricultural breeding, genetic research, and molecular diagnostics. Summary of the Invention

[0004] The purpose of this invention is to provide a KASP marker related to the thousand-grain weight of wheat and its application.

[0005] To achieve the objectives of this invention, in a first aspect, this invention provides a KASP marker associated with the thousand-grain weight of wheat, which is an SNP molecular marker associated with the thousand-grain weight of plants, the marker containing a nucleotide sequence with a polymorphism of C / T at position 33397938 bp on wheat chromosome 1A.

[0006] Furthermore, plants with the TT genotype containing the polymorphic site of the marker have a higher thousand-grain weight compared to plants with the CC genotype.

[0007] In a second aspect, the present application provides a KASP primer combination for amplifying the marker, comprising a forward primer 1 (GCAGCAGCTGGCCGCGGCG) as shown in SEQ ID NO: 1, a forward primer 2 (GCAGCAGCTGGCCGCGGCA) as shown in SEQ ID NO: 2, and a reverse primer (AGCTATAGGTTGGAGGTAGTATA) as shown in SEQ ID NO: 3.

[0008] Further, the 5' end of the forward primer 1 and the forward primer 2 in the KASP primer combination can be further connected to a fluorescently labeled sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0009] In one specific embodiment of the present application, the KASP primer combination is as follows:

[0010] 33397938-F1: 5'-GAAGGTGACCAAGTTCATGCTTGCAGCAGCTGGCCGCGGCG-3' (SEQ ID NO: 4)

[0011] 33397938-F2: 5'-GAAGGTCGGAGTCAACGGATTTGCAGCAGCTGGCCGCGGCA-3' (SEQ ID NO: 5)

[0012] 33397938-R: 5'-AGCTATAGGTTGGAGGTAGTATA-3' (SEQ ID NO: 3).

[0013] In a third aspect, the present application further provides a detection reagent or kit containing the primer combination.

[0014] In a fourth aspect, the present application provides a method for identifying the thousand-grain weight (high / low, large / small) of a plant, comprising: using the DNA of a plant sample to be tested as a template, and performing PCR amplification using the KASP primer combination or the detection reagent or kit, and judging the thousand-grain weight of the plant sample to be tested according to the amplification result.

[0015] Preferably, the system used for PCR amplification includes 2xKASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the rest is water, based on a total system of 10 μL.

[0016] The primer mixture, in 100 μL, comprises: 100 μM forward primer 1 10~14 μL, 100 μM forward primer 2 10~14 μL, 100 μM reverse primer 28~32 μL, and the rest is water.

[0017] Preferably, the reaction program for PCR amplification is: 95℃ 8~12 min; 95℃ 15~25 s, 61℃ 60 s, 8~12 cycles, and the annealing temperature decreases by 0.5℃~0.7℃ in each cycle; 95℃ 15~25 s, 55℃ 35~45 s, 32~36 cycles; 25℃ 10~20 min.

[0018] Further, judging the thousand-grain weight of the plant sample according to the amplification result comprises: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with genotype TT has higher thousand-grain weight than the plant with genotype CC.

[0019] Further, the plant is wheat.

[0020] In a fifth aspect, the present application provides any one of the following applications of the marker, the marker combination, or the detection reagent or kit:

[0021] (1) used for identifying, breeding and improving the thousand-grain weight of wheat;

[0022] (2) used for early prediction of the thousand-grain weight trait of wheat;

[0023] (3) used for molecular marker-assisted breeding of wheat;

[0024] (4) used for screening or breeding high-yield plants.

[0025] By the above technical solutions, the present application has at least the following advantages and beneficial effects:

[0026] (I) The present application successfully identifies a SNP site closely related to the thousand-grain weight of plants through phenotype difference analysis and exon capture sequencing technology. The polymorphism detection of the site can accurately and quickly evaluate the thousand-grain weight characteristics of plants.

[0027] (II) Using KASP technology, the SNP site and the corresponding primer combination provided by the present application not only improve the efficiency of plant variety selection, but also help to shorten the breeding period and accelerate the breeding of high-quality plant varieties. These markers have good genetic stability, high resolution, are suitable for high-throughput detection, and have significant application value in the field of plant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 is obtained by the exon capture sequencing technology provided in Example 1 of the present applicationTraesCS1A02G052000 Exon SNP site map of the gene.

[0029] Figure 2 is a statistical diagram of the thousand-grain weight of different genotypes of the 33397938 site on chromosome 1A provided in Embodiment 2 of the present application.

[0030] Figure 3 is a genotyping result of the wheat genotype of the 33397938 site on chromosome 1A provided in Embodiment 2 of the present application; wherein CC represents 33397938-C, TT represents 33397938-T, and CK represents a no template control, i.e., using ultrapure water instead of sample DNA.

[0031] Figure 4 is a sequencing peak diagram of different genotypes of the 33397938 site on chromosome 1A provided in Embodiment 2 of the present application. The genome of the gene is negative, and the sequencing result is positive sequencing. That is: C-G, A-T. DETAILED DESCRIPTION

[0032] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art, and the raw materials used are commercially available.

[0033] The related wheat varieties (lines) involved in the following examples are all provided by Professor Zhang Xueyong of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and the related wheat is sown in Xinxiang, Henan, and harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0034] It should be noted that, as a professional agricultural research institution, the applicant has long-term preservation of related germplasm materials, and the related wheat varieties are publicly available in the market or existing germplasm banks.

[0035] Example 1 Obtaining of SNP marker related to plant thousand-grain weight and KASP primer design

[0036] 1. Exon capture sequencing of 111 samples

[0037] The process of whole-exome sequencing mainly includes the following four main steps:

[0038] 1) Sample detection: Before DNA sequencing, the quality and quantity of the sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration is required to be not less than 20 ng / ul, and the total amount is required to be not less than 800 ng, to ensure the accuracy and repeatability of the sequencing.

[0039] 2) Library construction: The genomic DNA was randomly broken into 180-280 bp fragments using a Covaris disruptor. Then, the end repair, phosphorylation, and poly A tailing of the DNA were completed using an Agilent SureSelect kit. The exonic region was enriched by liquid-phase hybridization, and specific hybridization was performed between the biotin-labeled probe and the library with a specific index, followed by PCR amplification. Finally, the quality of the amplified library was detected to ensure that the quality of the library before sequencing met the standard.

[0040] 3) Library detection: After the library construction was completed, the Qubit 2.0 was first used for preliminary quantification. Then, the Agilent 2100 Bioanalyzer was used to detect the insert size to ensure that the size was appropriate. After passing the test, the library was accurately quantified to 3 nmol / L by Q-PCR to ensure the quality and accuracy of the sequencing library.

[0041] 4) Sequencing: After passing the library detection, the Illumina HiSeq platform was used for PE150 sequencing according to the effective concentration of the library and the data requirement. PE150 refers to double-end sequencing, each end reads 150 bp, and the small fragment library insert is used for high-throughput sequencing, which is convenient for subsequent sequence alignment and analysis, and improves the accuracy and reliability of the data.

[0042] 2. Obtain the thousand-grain weight of different wheat and develop SNP molecular markers

[0043] To screen the key genes affecting the thousand-grain weight of wheat, we first determined the thousand-grain weight of 111 wheat varieties to evaluate the phenotypic variation. This basic data collection work is the first step to understand the genetic background of the thousand-grain weight. The determination results are shown in Table 1, which lays the foundation for further gene analysis and breeding research.

[0044] Based on the 111 thousand-grain weight phenotype data obtained in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to the thousand-grain weight was explored, and a SNP site was screened on chromosome 1A of the wheat genome TraesCS1A02G052000 The SNP site exists in the gene exon, and the thousand-grain weight of the SNP variation is significantly increased, and a significant site affecting the thousand-grain weight of wheat is identified (1A: 33397938 bp) (part of the results are shown in Figure 1 ), and the site is named: 33397938. It should be noted that the gene in the genome is negative, and the designed sequencing and KASP primers are positive sequences.

[0045] Based on the above sequence differences, and based on the KASP principle, further development and design of PCR amplification to obtain the primer set for the wheat molecular marker are as follows:

[0046] 33397938-F1: 5'- GAAGGTGACCAAGTTCATGCTTGCAGCAGCTGGCCGCGGCG -3', (5' end "GAAGGTGACCAAGTTCATGCT" part sequence is FAM labeled sequence)

[0047] 33397938-F2: 5'- GAAGGTGACCAAGTTCATGCTTGCAGCAGCTGGCCGCGGCA-3', (5' end "GAAGGTCGGAGTCAACGGATT" part sequence is HEX labeled sequence)

[0048] 33397938-R: 5'- AGCTATAGGTTGGAGGTAGTATA -3';

[0049] When the primer pair combination of 33397938-F1 and 33397938-R is used, the sequence of the 33397938 locus on the 1A chromosome in the wheat molecular marker is amplified, and the base is C.

[0050] When the primer pair combination of 33397938-F2 and 33397938-R is used, the sequence of the 33397938 locus on the 2A chromosome in the wheat molecular marker is amplified, and the base is T.

[0051] Example 2 Application of SNP marker in identifying wheat thousand-grain weight

[0052] 1. Based on the primer pair design in Example 1, the genotypes (CC 30, TT 20) of 111 wheat materials were detected, and the correlation between the genotypes and the thousand-grain weight phenotype was identified, and the specific process is as follows:

[0053] First, the genomic DNA of each wheat variety was extracted;

[0054] Then, according to the primer designed in Example 1, the above extracted DNA was used as a template to detect and analyze different wheat samples by PCR (Quant Studio 1 fluorescent quantitative PCR instrument was used).

[0055] The specific PCR amplification is as follows:

[0056] KASP Mix (2x), 5 μL (i.e. HiGeno 2x Probe Mix (provided at 2x concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2 and reference dye ROX);

[0057] Primer Mix, 0.14 μL;

[0058] DNA, 30 ng;

[0059] ddH2O, supplemented to 10 μL.

[0060] wherein the Primer Mix, per 100 μL:

[0061] 33397938-F1, 100 μM, 12 μL;

[0062] 33397938-F2, 100 μM, 12 μL;

[0063] 33397938-R, 100 μM, 30 μL;

[0064] ddH2O, 46 μL.

[0065] PCR reaction program (may be adjusted according to the amplification results) is:

[0066] 95°C 10 min; 95°C 20 s, 61°C 60 s (10 cycles, each cycle reduced by 0.6°C); 95°C 20 s, 55°C 40 s, 34 cycles; 25°C 15 min.

[0067] 2. Using the genomic DNA of each wheat variety extracted in step 1, ordinary PCR is performed, and sequencing is performed to verify the accuracy of KASP genotyping.

[0068] First, specific primers are designed for amplification at 33397938 bp of wheat chromosome 1A (reference sequence is Chinese Spring wheat), and the primer sequence is:

[0069] WAF: 5'- GCCTATAATAACCCCTGCCCA-3'

[0070] WAR: 5'- TGCTGCAGCAGCGGAGGAGGC-3'

[0071] Randomly select 8 wheat varieties of GG / AA genotype KASP genotyping results, use ordinary PCR instrument for amplification, electrophoresis detection, and then sequencing to verify the reliability of the genotyping results.

[0072] The 25 μL amplification system is designed as follows during specific PCR amplification:

[0073] Full-style Jinbio 2x EasyTaq PCR SuperMix for PAGE (+dye), 10 μL;

[0074] 10 μM primer WAF / WAR, 1 μL each;

[0075] DNA, 60 ng;

[0076] ddH2O, supplemented to 25 μL.

[0077] PCR reaction program (can be adjusted according to the amplification results) is as follows:

[0078] 94℃ 5min; 94℃ 30 s, 58℃ 30 s, 72℃ 40 s (35 cycles); 72℃ 10 min; 16℃ end.

[0079] The specific genotype and wheat thousand kernel weight statistical results are shown in Tables 1-3 and Figures 1-4 .

[0080] Table 1 Corresponding results of different wheat variety genotypes and their thousand kernel weight

[0081]

[0082] Table 2 Corresponding results of different wheat variety genotypes and their thousand kernel weight

[0083]

[0084] Table 3 Corresponding results of different wheat variety genotypes and their thousand kernel weight

[0085]

[0086] From the above experimental results, it can be seen that the average thousand kernel weight of CC genotype wheat is 33.163 g; the average thousand kernel weight of TT genotype wheat is 45.132 g. The thousand kernel weight of TT genotype wheat is significantly higher than that of CC genotype wheat, increasing by 36.09%, and there is a significant difference at the level of p<0.01. That is, the thousand kernel weight of CC genotype wheat is significantly lower than that of TT genotype wheat.

[0087] The present application can accurately determine the thousand kernel weight trait of wheat by detecting specific SNP sites with carefully designed primers. This technology not only provides accurate genotype information for molecular breeding, but also helps to quickly screen wheat varieties with ideal thousand kernel weight. In addition, the technical and theoretical support of the present application has a significant technical contribution to the development of high-yield wheat varieties, and promotes the progress of agricultural science and technology and the improvement of crop yield.

[0088] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. A method for identifying the thousand kernel weight of a plant, characterized in that, The application relates to a method for identifying, selecting and improving the thousand-grain weight of wheat, and belongs to the technical field of plant molecular biology. The method comprises the following steps: taking the DNA of a plant sample to be tested as a template, using a KASP primer combination or a detection reagent or kit containing the primer combination to perform PCR amplification on a polymorphic site, the polymorphic site is a base at 33397938 bp of wheat chromosome 1A, the polymorphism is C / T, and the thousand-grain weight of the plant sample to be tested is determined according to the amplification result. The primer combination comprises primer 1 as shown in SEQ ID NO: 4, primer 2 as shown in SEQ ID NO: 5 and primer 3 as shown in SEQ ID NO:

3. The plant is wheat.

2. The method of claim 1, wherein, The PCR amplification system comprises the following components in a total system of 10 muL: 2xKASP Mix 4-6 muL, primer mixture 0.12-0.16 muL, DNA template 25-35 ng, and the rest is water. The primer mixture comprises the following components in 100 muL: 100 muM primer 1 10-14 muL, 100 muM primer 2 10-14 muL, 100 muM primer 3 28-32 muL, and the rest is water.

3. The method of claim 2, wherein, The reaction program for the PCR amplification comprises the following steps: 95 DEG C for 8-12 min; 95 DEG C for 15-25 s, 61 DEG C for 60 s, 8-12 cycles, and the annealing temperature is reduced by 0.5 DEG C-0.7 DEG C for each cycle; 95 DEG C for 15-25 s, 55 DEG C for 35-45 s, 32-36 cycles; and 25 DEG C for 10-20 min.

4. The method according to claim 2 or 3, characterized in that, The method further comprises the following steps: analyzing the genotype of the polymorphic site contained in the amplification product, and the plant with the genotype of TT has a higher thousand-grain weight than the plant with the genotype of CC.

5. Any one of the following applications of the KASP primer combination or the detection reagent or kit containing the primer combination: (1) used for identifying, selecting and improving the thousand-grain weight of wheat; (2) used for early prediction of the thousand-grain weight of wheat. The primer combination comprises primer 1 as shown in SEQ ID NO: 4, primer 2 as shown in SEQ ID NO: 5 and primer 3 as shown in SEQ ID NO: 3.

Citation Information

Patent Citations

  • Plant grain trait-related protein, gene, promoter and SNPS and haplotypes

    CA3049172A1

  • KASP molecular marker related to thousand seed weight and plant height of wheat, primer and application of KASP molecular marker

    CN117467790A