Penicillium strain F5 and application thereof

Abstract

The present application relates to the technical field of biological control, in particular to a Penicillium sp. strain F5 and application thereof. A Penicillium sp. strain F5 is provided, and the preservation number of the strain is GDMCC No: 65364. The application of the Penicillium sp. strain F5 in preventing and treating plant fusarium wilt caused by Fusarium oxysporum and tobacco black shank caused by Phytophthora nicotianae is also provided. The Penicillium sp. strain F5 can not only significantly inhibit the growth of Fusarium oxysporum and Phytophthora nicotianae, but also effectively promote plant growth, and has a good application prospect in plant disease control.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological control, in particular to a penicillium strain F5 and application thereof. BACKGROUND

[0002] Soil-borne disease is a kind of disease caused by pathogens living in soil, which is an urgent problem in modern agricultural production. Fusarium and Phytophthora are two important soil-borne pathogenic fungi, which can cause 20-30% reduction in crop yield and cause significant economic losses.

[0003] Fusarium spp. is a widely distributed soil-borne pathogenic fungus, belonging to the semi-knowledge fungus, from the stem spore order, the tumor spore family, and the fusarium genus. Its host range is very wide, and it can cause wilt disease in more than 100 plants such as melons, solanaceae, legumes, etc. The infection of Fusarium spp. can cause symptoms such as brown of plant vascular bundle, wilting and death of plant, rot of corm and root, and weak growth of plant. These symptoms develop most rapidly and severely in summer high temperature. Fusarium wilt disease poses a major threat to agricultural production, especially in heavy soil, which directly affects the yield and economic benefits of crops.

[0004] There are many species of Phytophthora, among which Phytophthora nicotianae causes tobacco black shank disease, which is an important soil-borne fungal disease. It mainly infects the roots and stem base of tobacco, forming black and sunken lesions. This disease is distributed worldwide and occurs more severely in temperate, subtropical and tropical regions. In recent years, tobacco black shank disease has seriously threatened the production of flue-cured tobacco in China.

[0005] Currently, the prevention and control of plant pathogenic fungi mainly relies on chemical pesticides. However, the overuse of chemical pesticides not only leads to excessive pesticide residues in agricultural products, endangering consumer health, but also causes environmental pollution and ecological imbalance, affecting the sustainable development of agriculture. Therefore, it is necessary to seek more environmentally friendly and sustainable control methods. Biological control, as an important measure for plant disease control, can prevent or reduce disease through inducing resistance in host plants or antagonizing pathogenic fungi. Biological agents or preparations can reduce or replace the use of chemical pesticides, effectively preventing diseases while avoiding the negative effects of chemical pesticides. This method not only helps to protect the environment, but also maintains ecological balance and promotes the sustainable development of agriculture. SUMMARY

[0006] The purpose of the present application is to use microorganisms to control plant wilt caused by Fusarium spp. and tobacco black shank caused by Phytophthora nicotianae, and to promote plant growth.

[0007] To achieve the above object, the present application provides a Penicillium sp. strain F5, the preservation number of which is GDMCC No:65364.

[0008] The Penicillium sp. strain F5 is isolated from the rhizosphere soil of corn, and the nucleotide sequence of its endogenous transcription spacer region (ITS) is shown as SEQ ID NO:3. After the strain is grown on a potato glucose agar medium for 7 days, the colony color is light green or light blue-green, the hyphae are well developed and short in length, and the hyphae are in a felt-like shape. Figure 3 The hyphae are long and slender with multiple branches, and the straight phialide spore stalks are produced on the aerial hyphae, and the phialide spore head at the top is in a broom-like shape. Figure 4

[0009] The present application also provides a culture of the Penicillium sp. strain F5.

[0010] The culture can be a liquid culture, such as a fermentation broth obtained by culturing the Penicillium sp. strain F5 in a potato glucose liquid medium. The culture can also be a solid culture, such as a culture obtained by culturing the Penicillium sp. strain F5 in a potato glucose agar medium.

[0011] The present application also provides a microbial agent, which comprises the Penicillium sp. strain F5.

[0012] The microbial agent can be a solid or liquid microbial agent.

[0013] The microbial agent can comprise a suitable solid or liquid carrier. The solid or liquid carrier can be an organic carrier, an inorganic carrier, or a biological carrier. Suitable surfactants, stabilizers, or pH regulators can be added to the microbial agent.

[0014] The present application also provides a method for preparing the microbial agent, which comprises culturing the Penicillium sp. strain F5 and preparing it into a microbial agent as an active ingredient.

[0015] The application of the Penicillium sp. strain F5 in inhibiting the growth of Fusarium oxysporum and Phytophthora nicotianae also belongs to the scope of the present application.

[0016] The application of the Penicillium sp. strain F5 in preventing and treating plant fusarium wilt caused by Fusarium oxysporum also belongs to the scope of the present application.

[0017] The application of the Penicillium sp. strain F5 in preventing and treating tobacco black shank caused by Phytophthora nicotianae also belongs to the scope of the present application.​

[0018] The application of the Penicillium strain F5 in promoting the growth of corn and tomato also belongs to the scope of the present application.

[0019] The present application also provides a method for preventing and treating tobacco black shank, which comprises: applying the Penicillium strain F5 or its culture to the soil around the roots of tobacco plants.

[0020] The isolated Penicillium strain F5 of the present application not only has broad-spectrum fungistatic effect and can significantly inhibit the growth of Fusarium oxysporum and Phytophthora parasitica, but also has significant plant growth-promoting ability. The results of the plate confrontation experiment show that the mycelial growth inhibition rate of the strain F5 on Fusarium oxysporum is 65% ( Figure 1 ), and the mycelial growth inhibition rate on Phytophthora parasitica is 68.3% ( Figure 2 ). The results of the biocontrol potting experiment show that the prevention effect of the strain F5 on tobacco black shank reaches 64.69%. The results of the corn growth experiment show that after applying the strain F5 to the planting soil, the plant height of corn plants increases by 38.78%, the root length increases by 94.36%, the plant fresh weight increases by 37.27%, and the root fresh weight increases by 74.3% ( Figure 6 ). The results of the tomato seed germination experiment show that after soaking tomato seeds with the spore suspension of the strain F5, the root length of tomato seedlings increases by 28.45%, and the bud length increases by 22.43%.

[0021] In summary, the Penicillium strain F5 provided by the present application can enhance the resistance of plants to fungal diseases and increase the yield of plants, while avoiding environmental pollution, protecting ecological balance and food safety, and has good application prospects in plant disease control.

[0022] The preservation information of the Penicillium strain F5 provided by the present application is as follows:

[0023] Biological material name: Penicillium sp. F5

[0024] Taxonomic name: Penicillium sp.

[0025] Preservation date: October 28, 2024

[0026] Preservation number: GDMCC No: 65364

[0027] Preservation agency: Guangdong Microbial Culture Collection Center (GDMCC)

[0028] Address: No. 59, Building 5, Guangzhou, Guangdong Province BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1Figure 1 is the results of a plate confrontation experiment between strain F5 and Fusarium oxysporum; the left panel is the control group: only F. oxysporum was inoculated in the center of a PDA plate; the right panel is the treatment group: the colony in the center of the PDA plate is F. oxysporum, and the light green colonies around F. oxysporum are strain F5.

[0030] Figure 2 Figure 2 is the results of a plate confrontation experiment between strain F5 and Phytophthora nicotianae; the left panel is the control group: only P. nicotianae was inoculated in the center of a PDA plate; the right panel is the treatment group: the colony in the center of the PDA plate is P. nicotianae, and the light green colonies around P. nicotianae are strain F5.

[0031] Figure 3 Figure 3 is the colony of strain F5 after it was grown on a PDA plate for 7 days.

[0032] Figure 4 Figure 4 is the conidial phialide and conidium of strain F5 as observed under a microscope.

[0033] Figure 5 Figure 5 is the phylogenetic tree of strain F5.

[0034] Figure 6 Figure 6 is the results of a growth promotion experiment of strain F5 on corn; CK in the figure represents the control group of corn plants (not inoculated with strain F5 in the planting soil); F5 in the figure represents the treatment group of corn plants (inoculated with strain F5 in the planting soil).

[0035] SEQUENCE DESCRIPTION

[0036] SEQ ID NO: 1 is the nucleotide sequence of primer ITS1.

[0037] SEQ ID NO: 2 is the nucleotide sequence of primer ITS4.

[0038] SEQ ID NO: 3 is the nucleotide sequence of the endogenous internal transcribed spacer (ITS) of strain F5. DETAILED DESCRIPTION

[0039] The following embodiments are provided:

[0040] 1. A Penicillium sp. strain F5, the strain having a deposit number of GDMCC No: 65364.

[0041] 2. A culture of the Penicillium sp. strain F5 of embodiment 1.

[0042] 3. The culture of embodiment 2, comprising a fermentation broth obtained by culturing the Penicillium sp. strain F5 in a liquid medium.

[0043] 4. The culture of embodiment 2, comprising a culture of the Penicillium sp. strain F5 in a solid medium.

[0044] 5. A microbial inoculant comprising the Penicillium sp. strain F5 of embodiment 1.

[0045] 6. The microbial inoculant of embodiment 5, comprising a solid or liquid inoculant.

[0046] 7. A method of making the microbial inoculant of embodiment 5 or 6, comprising culturing the Penicillium sp. strain F5 of embodiment 1 and formulating it as an active ingredient in the microbial inoculant.

[0047] 8. Use of the Penicillium sp. strain F5 of embodiment 1 to inhibit the growth of Fusarium oxysporum and Phytophthora nicotianae.

[0048] 9. Use of the Penicillium sp. strain F5 of embodiment 1 to control plant wilt caused by Fusarium oxysporum.

[0049] 10. The use of embodiment 9, wherein the plants comprise cucurbits, solanaceous, and leguminous plants.

[0050] 11. Use of the Penicillium sp. strain F5 of embodiment 1 to control tobacco black shank caused by Phytophthora nicotianae.

[0051] 12. The use of embodiment 11, comprising applying the Penicillium sp. strain F5 to the soil surrounding the roots of the tobacco plant.

[0052] 13. The use of embodiment 12, comprising pouring a fermentation broth or spore suspension of the Penicillium sp. strain F5 into the soil surrounding the roots of the tobacco plant after the tobacco plant is transplanted, or mixing the Penicillium sp. strain F5 or a culture thereof into the soil before the tobacco plant is transplanted.

[0053] 14. Use of the Penicillium sp. strain F5 of embodiment 1 to promote the growth of corn.

[0054] 15. The use of embodiment 14, comprising soaking corn seeds with a fermentation broth or spore suspension of the Penicillium sp. strain F5 after the corn seeds have germinated, and then continuing to incubate the soaked corn seeds.

[0055] 16. The use of embodiment 14, comprising applying the Penicillium sp. strain F5 to the soil surrounding the roots of the corn plant.

[0056] 17. The use of embodiment 16, which comprises pouring the fermentation broth or spore suspension of the Penicillium sp. strain F5 into the soil around the roots of the corn plants after the corn plants are transplanted, or mixing the Penicillium sp. strain F5 or its culture into the soil before the corn plants are transplanted.

[0057] 18. The use of the Penicillium sp. strain F5 of embodiment 1 in promoting the growth of tomato.

[0058] 19. The use of embodiment 18, which comprises soaking the tomato seeds with the fermentation broth or spore suspension of the Penicillium sp. strain F5 after the tomato seeds germinate, and then continuing to cultivate the soaked tomato seeds.

[0059] 20. The use of embodiment 18, which comprises applying the Penicillium sp. strain F5 in the soil around the roots of the tomato plants.

[0060] 21. The use of embodiment 20, which comprises pouring the fermentation broth or spore suspension of the Penicillium sp. strain F5 into the soil around the roots of the tomato plants after the tomato plants are transplanted, or mixing the Penicillium sp. strain F5 or its culture into the soil before the tomato plants are transplanted.

[0061] 22. A method for preventing and treating black shank of tobacco, which comprises applying the Penicillium sp. strain F5 of embodiment 1 or its culture in the soil around the roots of the tobacco plants.

[0062] The technical solutions of the present application will be described in detail below in conjunction with the examples and the accompanying drawings.

[0063] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be commercially available or prepared according to conventional methods in the art, and the specifications are laboratory grade. Unless otherwise specified, the experimental methods and conditions used in the following examples are all conventional experimental methods and conditions in the art, which can be referred to relevant experimental manuals, known documents or manufacturer's instructions. Unless otherwise defined, the meanings of all technical and scientific terms used herein are the same as those commonly understood by those of ordinary skill in the art to which the present application belongs.

[0064] The Fusarium oxysporum used in the following examples was isolated from corn root rot diseased plants in Dongchuan farmland, Yunnan, by the laboratory of the present application. The Phytophthora nicotianae used in the following examples was isolated from black shank diseased tobacco plants in Yuxi tobacco area by the laboratory of the present application.

[0065] Example 1: Isolation, screening and identification of biocontrol bacteria

[0066] 1. Isolation and screening of strains

[0067] Ten corn rhizosphere soil samples were selected, transferred into sterile physiological saline, and glass beads were added to disperse the soil to obtain a soil suspension. The soil suspension was diluted 10 3 , 10 4 , 10 5 , 10 6 times with sterile water, and 100 μL of each concentration of the diluent was spread on a Bengal red agar medium (peptone 5 g / L, glucose 10 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, agar 15 g / L, Bengal red 0.03 g / L, chloramphenicol 0.1 g / L, final pH 7.2±0.2) and incubated at 28°C for 7 days. Single colonies were picked and purified 2-3 times using potato glucose agar medium (potato 200 g was washed, cut into pieces, and boiled in water for 20-30 hours, then filtered with gauze to obtain potato juice, and then 20 g of glucose and 20 g of agar were added, and the volume was made up to 1000 mL, and the natural pH was used).

[0068] Single colonies of the mold were picked, and plate confrontation experiments were used to test the antagonistic effect of the candidate mold on Fusarium oxysporum and Phytophthora nicotianae. The method was as follows: the candidate mold and the two pathogens (Fusarium oxysporum and Phytophthora nicotianae) were inoculated on potato glucose agar medium (PDA) plates and incubated at 26-28°C for 3-5 days for standby. In the plate confrontation experiment for each pathogen, a control group and a treatment group were set up, with three replicates in each group. The treatment group: the pathogen was inoculated in the center of the PDA plate, and the candidate mold was inoculated at four evenly distributed positions on the medium around the pathogen, with the inoculation site of the candidate mold being 4 cm from the center of the pathogen, and then the culture dish was inverted and incubated at 26-28°C for 10 days. The control group: the candidate mold was not inoculated, and the rest of the experimental steps were the same as those of the treatment group. The mold inhibition effect was observed, the colony radius of the pathogen was measured with a ruler, and the mycelial growth inhibition rate of the candidate mold on the pathogen was calculated using formula (1).

[0069] Mycelial growth inhibition rate = [(R1-R2) / R1] x 100% (1)

[0070] Wherein R1 is the colony radius of the pathogen in the control group, and R2 is the colony radius of the pathogen in the treatment group.

[0071] After a large number of screenings, a mold strain with strong inhibition of the mycelial growth of both Fusarium oxysporum and Phytophthora nicotianae was obtained, and the number of the strain was F5. The results of the plate confrontation experiment of strain F5 and Fusarium oxysporum are shown in Table 1. Figure 1The results of the plate confrontation experiment of strain F5 and Phytophthora nicotianae are shown in Table 2. Figure 2 The results show that the mycelium growth inhibition rate of strain F5 on Fusarium oxysporum is 65%, and the mycelium growth inhibition rate of strain F5 on Phytophthora nicotianae is 68.3%, so strain F5 has broad-spectrum antibacterial properties.

[0072] 2. Morphological observation of strain F5

[0073] After inoculating strain F5 on potato glucose agar medium and culturing at 25°C for 7 days, the colony color was light green or light blue-green, the mycelium was well developed and relatively short, and the mycelium was in a felt-like shape. Figure 3 Under a microscope, the mycelium of strain F5 was a multi-branched slender line, and the aerial mycelium produced upright conidial stalks, and the conidial heads at the top were in a broom-like shape. Figure 4

[0074] 3. Molecular identification of strain F5

[0075] Genomic DNA of strain F5 was extracted. The endogenous internal transcribed spacer (ITS) of strain F5 was amplified by PCR using universal primers ITS1 and ITS4 with the genomic DNA as a template. The nucleotide sequences of the primers are as follows:

[0076] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO: 1)

[0077] ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 2)

[0078] The PCR reaction system was as follows: 2x PCR Master Mix 12.5 μL, ITS1 (10 μM) 1 μL, ITS4 (10 μM) 1 μL, template 1 μL, and ddH2O 9.5 μL.

[0079] The PCR reaction program was as follows: 94°C pre-denaturation for 10 min; (94°C denaturation for 30 s, 52°C annealing for 30 s, and 72°C extension for 1 min) for 30 cycles; and 72°C final extension for 10 min.

[0080] The PCR reaction program was as follows: 94°C pre-denaturation for 10 min; (94°C denaturation for 30 s, 52°C annealing for 30 s, and 72°C extension for 1 min) for 30 cycles; and 72°C final extension for 10 min.

[0081] ​After the reaction was completed, the amplification product was sent to Shanghai Paixinnuo Biotechnology Co., Ltd. for sequencing. The sequencing result showed that the nucleotide sequence of the ITS fragment of the strain F5 was as shown in SEQ ID NO: 3. The ITS sequence of the strain F5 was aligned with the ITS sequences of known fungi in the NCBI database. The alignment result showed that the sequence matching rate of the strain F5 and Penicillium oxalicum strain rubem E2 (GenBank: MH282514.1) reached 99.64%. By establishing a phylogenetic tree (Fig. 1), Figure 5 ), it was determined that the strain F5 belonged to the genus Penicillium. The strain F5 was preserved in the Guangdong Microbial Culture Collection Center on October 28, 2024, with the preservation number of GDMCC No: 65364, and the classification name of Penicillium sp. F5.

[0082] The nucleotide sequence of the ITS fragment of the strain F5 was as follows:

[0083] TGACCTCCTGATCGAGGTCACCTGGTTAAGATTGATGGTGTTCGCCGGCGGGCGCCGGCC

[0084] GGGCCTACAGAGCGGGTGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCG

[0085] CTGCCTTTCGGGCCCGCCCCCCGGAAGCGGGGGGCGAGAGCCCAACACACAAGCCGTGC

[0086] TTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATG

[0087] TGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGC

[0088] TGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTTAGT

[0089] CAAGTACTCAGACTGCAATCTTCAGACAAGAGTTCGTTTGTGTGTCTTCGGCGGGCGCGG

[0090] GCCCGGGGGCCGGATGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTAC

[0091] GATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCCTACGGAAG(SEQ ID NO:3)

[0092] Example 2: Biocontrol pot experiment of strain F5 against tobacco black shank

[0093] To confirm the efficacy of strain F5 against tobacco black shank, a potted tobacco experiment was conducted. The tobacco variety tested (Nicotiana tabacum), Yunyan 87, was purchased from a local agricultural supply company and maintained in the laboratory.

[0094] 1. Preparation of tobacco phytophthora spp.

[0095] Rice grains were cooked in distilled water until 2 / 3 of the grains were open. Drain the water with gauze, place the mixture in a 500 mL conical flask, and sterilize it by autoclaving at 121°C for 1 hour. Meanwhile, Phytophthora nicotianae was inoculated onto potato dextrose agar (PDA) plates and activated at 28°C for 7 days. Mycelium of Phytophthora nicotianae was picked with an inoculating loop and inoculated into the sterilized grains. The mixture was then incubated at 28°C until the mycelium covered the grains and the culture medium. This yielded Phytophthora nicotianae grains.

[0096] 2. Tobacco potted plant experiment

[0097] The strain F5 was inoculated into PDA liquid culture medium and cultured at 28° C. for 7 days to obtain the strain F5 fermentation liquid.

[0098] The experimental soil was collected from field soil (red soil) in the tobacco-growing area of ​​Yuxi, Yunnan. Tobacco Phytophthora fusca was added to the soil at a ratio of 1000 g soil: 10 g tobacco Phytophthora fusca grains and mixed thoroughly to create the diseased soil. Yunyan 87 seedlings with essentially uniform growth and five true leaves were transplanted into pots containing 500 g of diseased soil, with one plant per pot. A control group and a treatment group were set up, with four replicates per group and 10 pots per replicate. The control group did not apply the F5 fermentation broth. The treatment group added 5 mL of the F5 fermentation broth to the soil around the roots of the tobacco seedlings on the day of transplanting. All tobacco seedlings were routinely cultured at 28°C and 70% relative humidity. Nine days after inoculation with the black shank pathogen (transplanted into the diseased soil), the incidence and severity of tobacco black shank were measured, and the disease index and disease prevention efficacy were calculated.

[0099] Tobacco black shank disease grading standards: 0 level, no disease on the whole plant; 1 level, stem lesion not more than 1 / 3 of the stem circumference, or 1 / 3 or less of the leaf wilting; 3 level, stem lesion 1 / 2-2 / 3 of the stem circumference, or 1 / 3-1 / 2 of the leaf wilting; 5 level: stem lesion more than 1 / 2 of the stem circumference, but not completely around the stem circumference, or 1 / 2-2 / 3 of the leaf wilting; 7 level, stem lesion completely around the stem circumference, or 2 / 3 or more of the leaf wilting; 9 level: the diseased plant is basically dead.

[0100] Incidence rate = (number of diseased plants / total number of inoculated plants) x 100%;

[0101] Disease index = [(number of plants of each disease level x representative level value) / (total number of plants x representative level value of the highest disease level)] x 100;

[0102] Control effect = [(control disease index - treatment disease index) / control disease index] x 100%.

[0103] The experimental results are shown in Table 1. The preventive effect of strain F5 on tobacco black shank disease reached 64.69%.

[0104] Table 1

[0105] Group Disease index Relative control (%) Control 80.18 —— Treatment 28.31 64.69

[0106] Example 3: Strain F5 growth-promoting experiment on corn

[0107] In order to confirm the influence of strain F5 on plant growth, a corn growth experiment was conducted. The variety name of the tested corn (Zea mays) was Yangujin 2000, from Shouguang Jilong Seed Company.

[0108] The experimental method is as follows: strain F5 was inoculated on a potato dextrose agar (PDA) plate, and after 3-5 days of activation culture at 26-28°C, spores of strain F5 were scraped directly from the PDA plate, the spores were suspended using purified water and the concentration was adjusted to 10 6 After the corn seeds were sterilized, they were soaked for 6-8 h, germinated for 2-3 days in the dark at 25°C, and the corn seeds with the same germination degree were selected and planted in flowerpots containing 1 kg of sterile soil, 3 corn seeds per pot. The control group and the treatment group were set up, each group was set up 3 repeats, and each repeat was 4 pots. Treatment group: after the corn seeds were planted in the flowerpots, 20 mL of F5 spore suspension with a concentration of 10 6 After the corn seeds were sterilized, they were soaked for 6-8 h, germinated for 2-3 days in the dark at 25°C, and the corn seeds with the same germination degree were selected and planted in flowerpots containing 1 kg of sterile soil, 3 corn seeds per pot. The control group and the treatment group were set up, each group was set up 3 repeats, and each repeat was 4 pots. Treatment group: after the corn seeds were planted in the flowerpots, 20 mL of F5 spore suspension with a concentration of 10

[0109] The results show that, compared with the control group of corn plants, the plant height of the treatment group of corn plants increased by 38.78%, the root length increased by 94.36%, the plant fresh weight increased by 37.27%, and the root fresh weight increased by 74.3% Figure 6 ). Therefore, strain F5 can significantly promote the growth of corn plants and increase the biomass of corn plants.

[0110] Example 4: Strain F5 promotes growth of tomato

[0111] To confirm the influence of strain F5 on plant growth, a tomato seed germination experiment was conducted. The variety name of the test tomato (Solanum lycopersicum) was Provence, from the local agricultural market.

[0112] The experimental method is as follows: strain F5 was inoculated on potato dextrose agar (PDA) plates and cultured at 26-28°C for 3-5 days. Spores of strain F5 were scraped directly from the PDA plates, and the spores were suspended in purified water and adjusted to a concentration of 10 6 After the tomato seeds were sterilized, they were placed in moist sterile quartz sand and germinated in a dark environment at 20°C for 2-3 days. The tomato seeds with the same germination degree were selected and randomly divided into a control group and a treatment group, with 3 replicates in each group and 6 seeds in each replicate. Treatment group: tomato seeds were soaked in F5 spore suspension with a concentration of 10 6 Control group: tomato seeds were soaked in sterile water for half an hour. After the soaked tomato seeds were placed on 0.8% agar plates for 2-3 days of germination, the length of the sprouts and roots of each tomato seedling was measured, and the average value of each group was calculated.

[0113] The results are shown in Table 2. Compared with the control group of tomato seedlings, the root length of the treatment group of tomato seedlings increased by 28.45%, and the sprout length increased by 22.43%. Therefore, strain F5 can significantly promote the germination and growth of tomato seeds.

[0114] Table 2

[0115] Group Root length (cm) Sprout length (cm) Control 2.32 4.86 Treatment 2.98 5.95

Claims

1. A Penicillium sp. strain F5, the preservation number of the strain is GDMCC No: 65364; the strain can increase the plant height, plant fresh weight, root length and root fresh weight of corn, can increase the root length and bud length of tomato, and can inhibit the growth of Fusarium oxysporum and Phytophthora nicotianae. 2.A culture of the Penicillium sp. strain F5 of claim 1. 3.A microbial agent comprising the Penicillium sp. strain F5 of claim 1.

4. The bacterial agent of claim 3, characterized in that, The microbial agent is a solid or liquid microbial agent. 5.A method for preparing the microbial agent of claim 3 or 4, the method comprising culturing the Penicillium sp. strain F5 of claim 1 and preparing it into a microbial agent as an active ingredient. 6.Use of the Penicillium sp. strain F5 of claim 1 in inhibiting the growth of Fusarium oxysporum and Phytophthora nicotianae. 7.Use of the Penicillium sp. strain F5 of claim 1 in preventing plant fusarium wilt caused by Fusarium oxysporum. 8.Use of the Penicillium sp. strain F5 of claim 1 in preventing tobacco black shank caused by Phytophthora nicotianae. 9.Use of the Penicillium sp. strain F5 of claim 1 in promoting the growth of corn and tomato.

10. A method of controlling black shank of tobacco, comprising: The Penicillium sp. strain F5 of claim 1 or its culture is applied to the soil around the roots of tobacco plants.

Images