Porcine rotavirus G5 type and application thereof

Abstract

The invention provides a porcine rotavirus G5 type and application thereof. According to the present invention, the porcine rotavirus G5 type SC05 strain is separated from the porcine intestinal tract tissue, and is subjected to passage purification to obtain the porcine rotavirus G5 type SC05 strain, and the microbial preservation number of the porcine rotavirus G5 type SC05 strain is CGMCC No.46179; the isolated strain can stably proliferate on passage cells to generate typical cytopathy. The G5 type isolated strain of the porcine rotavirus disclosed by the invention has excellent immunogenicity; the vaccine prepared from the isolated strain can induce piglets to generate high-level neutralizing antibodies; meanwhile, the ELISA kit prepared from the isolated strain can be used for well detecting the porcine rotavirus G5 type antibody in serum.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a separated and purified porcine rotavirus G5 type and application thereof. Background Art

[0002] Rotavirus (RV) belongs to the Reoviridae family and the genus Rotavirus. Rotavirus looks like a wheel, with icosahedral symmetry, a dense hexagonal core made of nucleic acid in the center, and no envelope. Rotavirus nucleic acid is rich in A / T base pairs, with a content of about 65%, which is different from most viruses.

[0003] Porcine rotavirus (PoRV) is a segmented double-stranded RNA virus, which consists of 11 segments encoding 6 structural proteins and 6 non-structural proteins. The structural proteins include VP1, VP2, VP3, VP4, VP6 and VP7, and the non-structural proteins include NSP1, NSP2, NSP3, NSP4, NSP5 and NSP6. The virus particle is composed of three layers of capsid protein. The innermost layer is composed of VP2 and a small amount of VP1 and VP3 proteins. The three together encapsulate the viral genome RNA and are indispensable proteins in the process of viral gene transcription and replication; the middle layer is composed of VP6 protein, which is spoke-shaped; the outermost layer is composed of two proteins, VP7 and VP4, of which VP7 protein forms the smooth surface of the virus and VP4 protein forms the spike of the virus particle. The two are the main determinants of the virus serotype. According to the antigenic characteristics of glycoprotein VP7 (G type) and outer capsid protein VP4 (P type), rotavirus can be divided into G type and P type, among which G3, G4, G5, G9 and G11 are the most common epidemic genotypes in pigs. There are three kinds of antigenic proteins on the surface of porcine rotavirus virus particles: neutralizing antigen, group antigen and hemagglutinin antigen. Neutralizing antigen is mainly determined by the outer capsid glycoprotein VP7; group antigen is related to a variety of structural proteins, mainly determined by the inner capsid protein VP6; hemagglutinin antigen is determined by the outer capsid protein VP4. VP4, VP6 and VP7 proteins are the main antigenic proteins of porcine rotavirus and are also important virulence factors that cause diarrhea.

[0004] Rotavirus is one of the important intestinal pathogens that causes diarrhea in suckling and weaned piglets. PoRV was first reported in the UK in 1974, and was first isolated in the feces of diarrheal piglets in my country in 1981. Currently, PoRV is prevalent in my country. Infection with this virus not only reduces the survival rate of piglets, but also leads to lower feed conversion rate and daily weight gain in adult pigs.

[0005] The disease has a wide range of prevalence and a high incidence rate. It is widely present in my country's pig farming industry and is particularly susceptible in intensive pig farms. The large-scale infection and diarrhea caused by the virus in pig farms are not limited to any age group, and are often mixed with other pathogens to aggravate the condition. Porcine rotavirus infection often occurs in piglets aged 10 to 60 days, with an incidence rate of up to 80%. The higher the incidence rate, the more obvious the symptoms, and the mortality rate of newborn piglets can reach 100%. The main clinical symptoms of the disease are anorexia and mental depression. Piglets have severe gastroenteritis and small intestinal lesions, dehydration diarrhea, and slow growth of piglets, which seriously affects the healthy development of my country's pig farming industry and causes serious economic losses to animal husbandry. In recent years, more and more piglets have died due to infection with porcine rotavirus. Large pigs and breeding pigs are often latently infected. Once infected with porcine rotavirus, it will seriously affect the growth and development of pigs. Even adult pigs that have recovered will stop growing, resulting in a significant increase in the elimination rate of pig farms.

[0006] There is currently no specific drug to treat the disease, so it is crucial to develop drugs or vaccines that can effectively prevent and treat the virus, and vaccination is the most powerful prevention and control measure. Therefore, selecting the ideal strain and developing the best virus propagation method are crucial for the development of porcine rotavirus vaccines.

[0007] At present, porcine rotavirus G5 is on the rise in some areas of my country, causing certain harm and economic losses to the breeding industry. However, the traditional isolation and expansion of porcine rotavirus is difficult, and the virus titer is generally not high, so there is no particularly ideal porcine rotavirus G5 vaccine product on the market. There are also relatively few studies on porcine rotavirus vaccines and diagnostic methods. Timely development of efficient vaccines and diagnostic kits is of great significance for the prevention and control of the disease. Summary of the invention

[0008] The purpose of the present invention is to provide a porcine rotavirus G5 type and its VP7 gene sequence, as well as the use of an inactivated vaccine prepared based on the isolated strain in the prevention and control of porcine rotavirus G5 type disease.

[0009] In order to achieve the object of the present invention, the technical solution of the present invention is as follows:

[0010] In a first aspect, the present invention provides a strain of porcine rotavirus G5 (Porcine rotavirus, PoRV) and its VP7 gene sequence.

[0011] The present invention inoculates Marc145 or MA104 cells with the ground liquid of pig intestinal tissue from a pig farm, and obtains a porcine rotavirus G5 strain named SC05 after cell passage, purification and identification. The strain proliferates stably on the cells, and the CT value of the porcine rotavirus fluorescence quantitative determination result can reach 12 and TCID 50 Up to 1.0×10 9TCID 50 / ml, on September 5, 2024, the General Microbiological Center of China Microorganism Culture Collection Administration (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing), with a deposit number of CGMCC No. 46179. The present invention provides a VP7 gene sequence of a porcine rotavirus G5 type isolate, as shown in SEQ ID No. 1.

[0012] In a second aspect, the present invention provides a biological product containing the porcine rotavirus G5 strain, and the biological product is used to prevent or diagnose porcine rotavirus G5 disease.

[0013] The biological product may be a vaccine or a diagnostic reagent.

[0014] Wherein, the vaccine is a live vaccine or an inactivated vaccine.

[0015] The inactivated vaccine comprising the isolated porcine rotavirus G5 type provided by the present invention is prepared by inoculating MA104 cells or MARC-145 cells with porcine rotavirus G5 type SC05 for passage, harvesting the virus liquid, determining the toxicity, and then mixing with an adjuvant in a weight ratio of 1:1. Available adjuvants include the colloidal water adjuvant made by China Animal Husbandry, 201VG of Seppic and conventional aluminum adjuvant.

[0016] The inactivated vaccine antigen content is not less than 1×10 7.0 TCID 50 / ml, the immunization route is intramuscular injection or nasal inoculation, preferably, intramuscular injection.

[0017] The reagent provided by the present invention can be an ELISA kit containing the isolated porcine rotavirus G5 type, which can better detect antibodies in serum.

[0018] In a third aspect, the present invention also provides the use of the porcine rotavirus G5 strain in the preparation of a vaccine for preventing viral diseases caused by porcine rotavirus G5; and the use of the porcine rotavirus G5 strain in the preparation of a reagent for diagnosing viral diseases caused by porcine rotavirus G5.

[0019] The beneficial effects of the present invention are:

[0020] The porcine rotavirus G5 obtained by the present invention proliferates quickly on susceptible cells (MARC-145 or MA104 cell lines) with a high proliferation titer of up to 1.0×10 9 TCID 50 / ml; the porcine rotavirus G5 strain of the present invention has low pathogenicity, and 1×10 9.0 TCID 50 / ml virus liquid was used to challenge the weaned piglets nasally, and the challenged weaned piglets were observed for 10 consecutive days. The challenged weaned piglets had no clinical symptoms such as fever and diarrhea, and all survived. The inactivated vaccine prepared with the strain of the present invention has good immunogenicity and can induce piglets to produce high levels of neutralizing antibodies, providing important biological materials for the effective prevention and control of porcine rotavirus G5 disease.

[0021] At present, there is no commercial ELISA test kit for porcine rotavirus G5, so the establishment of a serum antibody detection method plays an important role in screening negative pigs. ELISA has the characteristics of high sensitivity, good specificity, and batch operation, which is convenient for clinical promotion and application. The present invention provides an ELISA kit containing isolated porcine rotavirus G5, which can better detect porcine rotavirus G5 antibodies in serum, and provides an important basis for the effective detection of the disease.

[0022] On this basis, other biological products containing the porcine rotavirus G5 type described in the present invention in the preparation for the prevention, control and diagnosis of porcine rotavirus G5 type disease also fall within the scope of protection of the present invention.

[0023] In this study, a strain of porcine rotavirus G5 was isolated and purified from the intestinal tissue of a pig farm in Nanchong, Sichuan in 2023, and was named SC05. The isolate has good proliferation in passaged cells, has no obvious pathogenicity to piglets, and has excellent immunogenicity. It can induce piglets to produce high levels of neutralizing antibodies, laying a solid foundation for the effective prevention and control of porcine rotavirus G5. At the same time, the ELISA kit prepared using this isolate can better detect porcine rotavirus G5 antibodies in serum, laying a technical foundation for the effective diagnosis of porcine rotavirus G5. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The cytopathic effect (CPE) (×100) of porcine rotavirus G5 isolate cultured on Marc145 adherent cells, where A is the cytopathic effect (CPE) of porcine rotavirus G5 on Marc145 cells, and B is the normal Marc145 cell control.

[0025] Figure 2 The RT-PCR identification results of porcine rotavirus G5, from left to right: M. Molecular weight marker; 1. 6th generation porcine rotavirus G5 cell culture; 2. Porcine rotavirus G5 positive control; 3. Porcine rotavirus G5 negative control.

[0026] Biomaterial Deposit

[0027] Deposit number: CGMCC No.46179

[0028] Name:SC05

[0029] Classification and nomenclature: Porcine rotavirus

[0030] Depository: China General Microbiology Center (CGMCC)

[0031] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0032] Survival: Yes. DETAILED DESCRIPTION

[0033] The methods in the following embodiments are conventional methods unless otherwise specified.

[0034] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the reagents used are all commercially available products.

[0035] Example 1: Isolation of porcine rotavirus G5

[0036] 1. Collection and Processing of Intestinal Tissue

[0037] The pig intestinal tissue was collected, cut into pieces, and ground into 10 times the volume of DMEM culture medium containing 500 units of double antibody. The culture medium was centrifuged at 12000 rpm for 5 min at 4°C. The supernatant of the grinding liquid was taken and frozen at -80°C for later use.

[0038] 2. Pathogen detection in intestinal tissue

[0039] Take 200 μl of the above grinding liquid supernatant, use the Beijing Quanshijin Biotechnology Company DNA / RNA extraction kit, and extract DNA and RNA according to the instructions; then, use the Quanshijin reverse transcription kit to reverse transcribe RNA into cDNA. Using the extracted DNA and reverse transcribed cDNA as templates, 9 pairs of detection primers and Quanshijin 2╳EasyTaq PCRSuperMix were used for PCR detection, including classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine circovirus type 2 / 3 (PCV2 / PCV3), porcine parvovirus (PPV), porcine transmissible gastroenteritis (TGEV), epidemic diarrhea virus (PEDV), and porcine rotavirus G5 (PDCoV), and positive and negative controls were set at the same time. The test results showed that the diseased material grinding liquid was positive for porcine rotavirus and negative for other pathogens.

[0040] 3. Isolation of porcine rotavirus G5

[0041] In 2023, intestinal tissue was collected from an infected pig farm in Nanchong, Sichuan, and the intestinal tissue material was positive by RT-PCR. The pigs in the infected pig farm showed clinical symptoms such as watery diarrhea and vomiting. The collected intestinal tissue of the infected pigs was inoculated with Marc145 cells. After incubation for 1 hour, the incubation solution was discarded and replaced with serum-free DMEM containing 5ug / ml of pancreatic enzyme for maintenance culture. 72 hours after inoculation, the cells showed shrinkage, syncytia aggregation and a small amount of shedding ( Figure 1 ), while normal cells showed no lesions. The cell culture was collected 5 days after inoculation and subcultured 3 times on Marc145 cells. The 4th generation was inoculated on MA104 cells. After 16 hours, the cells showed obvious aggregation, shrinkage, and a small amount of shedding. The virus was collected 20 hours after inoculation and subcultured 3 times on MA104 cells. Cytopathic effect (CPE) could be stably observed.

[0042] The sixth generation product was identified by RT-PCR. Nucleic acid was extracted according to the instructions of Beijing Quanshijin DNA / RNA Extraction Kit, and reverse transcription was performed according to the instructions of Quanshijin EasyScript First-Strand cDNA Synthesis SuperMix. The porcine rotavirus identification primers used in PCR were: VP7-Beg9-F: GCCTTTAAAAGAGAGAATTTCCGTCTGG;

[0043] VP7-End9-R: GGTCACATCATACAATTCTAATCTAAG.

[0044] The product was subjected to 1% agarose gel electrophoresis, and a positive band of about 1026 bp appeared. Figure 2 This confirmed that porcine rotavirus was successfully isolated.

[0045] The amplified product was subjected to 1% agarose gel electrophoresis, the gel was cut to recover and purify the target band, and then sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The fragments were spliced ​​to obtain the porcine rotavirus VP7 genome sequence, as shown in SEQ ID No.1.

[0046] The spliced ​​porcine rotavirus VP7 genome nucleic acid sequence was compared online with NCBI Blast, and the highest homology with the existing porcine rotavirus G5 strain sequence was found to be 99.48% (the online comparison website is https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Therefore, this strain was determined to be a new porcine rotavirus G5 strain.

[0047] The isolated virus was propagated and subcultured in MA104 adherent cells. The porcine rotavirus G5 type cultured in the 6th generation adherent cells was inoculated into MA104 adherent cells at a ratio of 0.2%. Aggregation and fusion lesions appeared 15 hours after the inoculation of the cells, while normal cells had no obvious lesions. The cell culture was collected after 18 hours. The porcine rotavirus G5 type was continued to be propagated to the 7th generation. After 15 hours of culture, there was obvious cell lesions. After positive identification, a porcine rotavirus G5 type was expanded and cultured, named SC05, and classified as porcine rotavirus Porcine rotavirus; porcine rotavirus G5 type SC05 was deposited at the General Microbiology Center of China Microbiological Culture Collection Administration Committee (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing) on ​​September 5, 2024, with a deposit number of CGMCC No.46179.

[0048] When porcine rotavirus G5 is inoculated into MA104 adherent cells for culture, typical cytopathic effects appear within 15-18 hours, such as Figure 1 When the cell cytopathic effect reached about 90%, the culture was harvested and frozen and thawed once. The virus titer was determined according to the Reed & Muench method to be 1.0×10 9 TCID 50 / ml.

[0049] Example 2 Pathogenicity experiment of porcine rotavirus G5 type SC05

[0050] Nine 40-day-old piglets with negative rotavirus pathogens and antibodies were screened and randomly divided into three groups, with three pigs in each group. The experimental group was challenged with 2 ml of 10 7.0 TCID 50 F7 virus fluid, intramuscular injection 1ml10 7.0 TCID 50 F7 passage virus solution; each pig in the control group was inoculated with an equal volume of sterile PBS solution via the nasal cavity and muscle. The pigs were observed daily, and the rectal temperature was measured and recorded.

[0051] After 10 consecutive days of observation, the body temperature of the experimental and control groups fluctuated within the normal range. Clinical symptom observations showed that the pigs in the experimental and control groups had normal appetite, no diarrhea, no pig deaths, and all survived. The above data show that porcine rotavirus G5 isolate SC05 has no obvious pathogenicity to weaned piglets.

[0052] Blood and anal swabs were collected from each pig in the challenge group and the control group before the challenge (0 day) and 3 days, 5 days, 7 days, and 10 days after the challenge, and serum was separated. RT-PCR was used to detect viremia and detoxification. The results of viremia detection are shown in Table 1. The results of detoxification detection are shown in Table 2. The data showed that the challenged pigs had viremia and detoxification on the 3rd day, and no viremia and detoxification occurred after 10 days.

[0053] Table 1 Viremia detection results before and after challenge

[0054]

[0055] Table 2 Results of anal swab pathogen detection before and after virus challenge

[0056]

[0057] The data from the challenge test showed that the isolate SC05 of the present invention had no obvious clinical symptoms after infecting weaned piglets, and was a low-virulence strain.

[0058] Example 3 Application of isolate SC05 in the preparation of porcine rotavirus G5 inactivated vaccine

[0059] 1. Preparation of porcine rotavirus G5 inactivated vaccine

[0060] The SC05 isolate was inoculated into Marc145 cells or MA104 adherent cells at 1% of the culture volume for continuous passage, the virus solution was harvested, and after freezing and thawing once, the supernatant was centrifuged and the virus titer was determined. The virus titer was greater than 10 7.0 TCID50 / ml, sterility and exogenous virus inspection were qualified, and formaldehyde with a final concentration of 0.2% was added for inactivation.

[0061] Vaccine configuration method:

[0062] The formula of the colloidal aqueous adjuvant made by China Animal Husbandry is: 90% aqueous solution for injection, 3% lactic acid-glycolic acid (PLGA), 2% polyvinyl pyrrolidone, 2% alkyl glycoside (decyl glucoside) (APG0816), 1% polyethylene glycol 6000, 1% polyoxyethylene sorbitan monooleate, and 1% cetyl alcohol. Among them, % is the mass percentage.

[0063] Weigh 9 g of the colloidal aqueous adjuvant prepared by China Animal Husbandry, mix it with an equal volume of the inactivated antigen, and shake it thoroughly to mix.

[0064] 2. Vaccine safety testing

[0065] Twelve piglets of about 30 days old with negative rotavirus pathogens and antibodies were randomly divided into 4 groups, 3 piglets in each group. The experimental group was injected with 2 doses (4 ml) of inactivated vaccine in the muscle, and the vaccine was given twice at an interval of 14 days; the control group was injected with an equal volume of sterile PBS solution in the muscle, and PBS was given twice at an interval of 14 days; the piglets were observed for 21 consecutive days. The results showed that compared with the control group, there was no significant difference in the mental state, body temperature and daily weight gain of the experimental group piglets, and no adverse reactions occurred.

[0066] 3. Vaccine effectiveness test

[0067] Twelve weaned piglets with negative porcine rotavirus pathogens and antibodies were screened and randomly divided into 4 groups, 3 pigs in each group. The test group was intramuscularly injected with 1 dose (2 ml) of inactivated vaccine, and the control group was intramuscularly injected with an equal volume of sterile PBS solution; continuous observation for 35 days, blood was collected on the 7th, 14th, 21st, 28th and 35th days, serum was separated, inactivated at 56°C for 30 minutes, and porcine rotavirus G5 neutralizing antibodies were determined. The neutralizing antibody test results (as shown in Table 3) show that the inactivated vaccine prepared by passage of the strain SC05 of the present invention can produce high levels of neutralizing antibodies 28 days after immunization, and has good immunogenicity.

[0068] Table 3 Neutralizing antibody test results after inactivated vaccine immunization

[0069]

[0070] Example 4 Application of isolate SC05 in the preparation of indirect ELISA detection kit

[0071] 1. Expand the SC05 virus isolate for future use.

[0072] Amplify the SC0 indirect ELISA test kit 5 virus with MA104 adherent cells. When the cells show obvious lesions, harvest the virus and freeze it at -80℃, freeze and thaw once. Then centrifuge at 6000r / min for 5min to remove cell debris. Purify the virus by sucrose density gradient centrifugation. Dilute the purified virus with PBS and measure the protein concentration.

[0073] 2. Specific steps of indirect ELISA.

[0074] (1) Coating whole virus antigen: Use the purified whole virus as the coating antigen, dilute the antigen and serum in multiples, and use the square titration method to determine the optimal virus coating concentration and the optimal serum dilution. The optimal virus coating concentration is 2.8ug / ml, and the optimal virus coating concentration is 1:100.

[0075] The purified virus was diluted with coating solution and 100 μL per well was coated on ELISA plate at 4°C overnight.

[0076] (2) Discard the coating solution, wash with PBS 3 times, add 200 μL of 5% skim milk powder to each well, and block at 37°C for 2 hours. Discard the skim milk, and then wash with PBST 3-5 times, 3-5 minutes each time.

[0077] (3) Dilute the serum to be tested with PBS, then add 100 μL to each well and incubate at 37°C for 1 hour. Set up negative serum and positive serum controls. Discard the liquid and wash with PBST 3-5 times, 3-5 minutes each time.

[0078] (4) Determine the optimal conditions for the secondary antibody: the optimal dilution of the secondary antibody is 1:10,000, and the optimal incubation time is 1 hour.

[0079] Add diluted horseradish peroxidase-labeled anti-swine IgG secondary antibody, 100 μL per well, and incubate at 37°C for 1 hour. Discard the secondary antibody and wash with PBST 3-5 times, 3-5 minutes each time.

[0080] (5) Add 100 μL of TMB colorimetric solution to each well and develop the color for 10 minutes in the dark.

[0081] (6) Add 50 μL of stop solution 2M H2SO4 to each well and read the OD450 value.

[0082] ≥0.575 was considered positive, OD<0.354 was considered negative, and 0.354≤OD<0.575 was considered suspicious.

[0083] The negative and positive serum control results were established. 15 pig sera were randomly tested.

[0084] At the same time, the neutralization test is used for synchronous detection. The specific method is as follows:

[0085] Inactivate the serum to be tested at 56℃ for 30 minutes. Dilute the serum to be tested from 1:4 to 1:64, repeat 3 times for each dilution, add 50uL to each well, set up positive control and negative control. 50 Add 50uL of the virus solution to each well except the control well. Place in a 37℃ 5% carbon dioxide incubator for 1 hour. Dilute to 3×10 5 / mL~4×10 5 / mL MA104 adherent cell suspension, 100uL per well was added to each test well after neutralization, and cultured in a 37℃ 5% carbon dioxide incubator for 48h~72h, and CPE was observed every day. The positive control and negative control results were established, and the results of 15 pig serum antibody tests are shown in Table 4. Note: If the tested serum has lesions at 1:8, it is judged as positive; 1:4 is judged as suspicious; <1:4 is judged as negative.

[0086] 3. The results of pig serum antibody test are shown in Table 4.

[0087] 4. Conclusion: The results of detecting pig serum antibodies using the indirect ELISA kit are consistent with the results of simultaneous detection using the neutralization test, indicating that the method of detecting pig serum antibodies using the indirect ELISA kit is valid.

[0088] Table 4 Results of detecting pig serum antibodies using indirect ELISA kit

[0089]

[0090] Note: “+” represents positive; “-” represents negative.

[0091] 5. Indirect ELISA test kit specificity test

[0092] The three batches of indirect ELISA detection kits in Example 4 were used in accordance with the method of use described in Example 4 to detect 20 healthy pig sera (provided by China Animal Husbandry Industry Co., Ltd.), 3 swine fever positive sera (CSFV) (purchased from China Veterinary Drug Administration), 3 porcine reproductive and respiratory syndrome virus positive sera (PRRSV) (provided by China Animal Husbandry Industry Co., Ltd.), 3 swine foot-and-mouth disease virus type O (FMDV-O) positive sera (provided by China Animal Husbandry Industry Co., Ltd.), and 3 swine foot-and-mouth disease virus type A (FMDV-A) positive sera (provided by China Animal Husbandry Industry Co., Ltd.).

[0093] The specificity test results of the kit are shown in the following table (Table 5). The test results of 20 healthy pig sera showed that the specificity of all batches of kits was 100.0%. The test results of 3 sera positive for swine fever (CSFV), 3 sera positive for porcine reproductive and respiratory syndrome virus (PRRSV), 3 sera positive for swine foot-and-mouth disease virus type O (FMDV-O), and 3 sera positive for swine foot-and-mouth disease virus type A (FMDV-A) were all negative, so the specificity of the three batches of kits for the detection of these 12 related pathogen-positive sera was 100%.

[0094] Table 5 Indirect ELISA kit antibody detection kit specificity test results

[0095]

[0096]

[0097] 6. Indirect ELISA test kit sensitivity test

[0098] The three batches of indirect ELISA detection kits in Example 4 were used according to the method described in Example 4.

[0099] 30 samples of pig sera to be tested collected from the pig farm (all of which were wild virus infected sera, provided by China Animal Husbandry Industry Co., Ltd., and inactivated at 56°C for 30 minutes) were tested. The experimental results are shown in Table 6. The kit with batch number Z1 of the present invention detected a total of 29 samples, and the sensitivity of the kit to the 30 samples of sera to be tested was 96.67%; the kit with batch number Z2 of the present invention detected a total of 30 samples, and the sensitivity of the kit to the 30 samples of sera to be tested was 100.00%; the kit with batch number Z3 of the present invention detected a total of 29 samples, and the sensitivity of the kit to the 30 samples of sera to be tested was 96.67%.

[0100] Table 6 Indirect ELISA test kit sensitivity test results

[0101] Kit batch number Detection rate Sensitivity Z1 29 / 30 96.67％ Z2 30 / 30 100.00％ Z3 29 / 30 96.67％

[0102] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A porcine rotavirus G5 strain, characterized in that: The porcine rotavirus G5 strain is named SC05, and its classification name is porcine rotavirus, and its collection number in the General Microbiological Center of China Microbiological Culture Collection is CGMCC No.46179.

2. The porcine rotavirus G5 strain according to claim 1, characterized in that: The VP7 gene sequence of porcine rotavirus G5 type is shown in sequence 1 in the sequence table.

3. A biological product containing the porcine rotavirus G5 strain according to claims 1 and 2, wherein the biological product is used to prevent or diagnose viral diseases caused by porcine rotavirus G5.

4. The biological product according to claim 3, characterized in that: The biological product is a vaccine or a diagnostic reagent.

5. The biological product according to claim 4, characterized in that: The vaccine is a live vaccine or an inactivated vaccine, and also includes a pharmaceutically acceptable adjuvant.

6. The biological product according to claim 4, characterized in that: The diagnostic reagent is an ELISA kit, which includes an ELISA plate coated with the whole virus of porcine rotavirus CGMCC No.46179 and an enzyme-labeled secondary antibody.

7. Use of the porcine rotavirus G5 strain according to claims 1 and 2 in the preparation of a vaccine for preventing viral diseases caused by porcine rotavirus G5.

8. Use of the porcine rotavirus G5 strain according to claims 1 and 2 in the preparation of reagents for diagnosing viral diseases caused by porcine rotavirus G5.

9. The use according to claim 8, characterized in that: The reagent is an ELISA kit.

10. The use according to claim 8, characterized in that: ELISA kit for detecting porcine rotavirus G5 antibodies in serum.

Images