Application of tomato genes or their encoded proteins in regulating plant tolerance to low nitrogen stress

By studying the RBOH1 and TGA4 genes in tomato roots and regulating the H2O2 signaling pathway, the problem of insufficient nitrogen absorption under low nitrogen stress was solved, and the tolerance of tomatoes to low nitrogen stress was improved.

CN119570838BActive Publication Date: 2025-10-28ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411605980.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-11
Publication Date
2025-10-28
Estimated Expiration
2044-11-11

AI Technical Summary

Technical Problem

It is unclear from the current technology whether H2O2-induced oxidative post-translational modifications affect the function of nitrogen absorption and metabolism-related proteins in tomatoes under low nitrogen stress, leading to insufficient tolerance of tomatoes to low nitrogen stress.

Method used

By studying the RBOH1 gene and transcription factor TGA4, which are closely related to H2O2 production in tomato roots, it was found that H2O2-oxidatively modified TGA4 promotes the expression of NRT1.1 and NRT2.1 under low nitrogen conditions. This provides a method for regulating plant tolerance to low nitrogen stress, including silencing or overexpressing the RBOH1 and TGA4 genes to regulate nitrogen uptake in tomatoes.

Benefits of technology

It significantly improved the tolerance of tomatoes to low nitrogen stress and enhanced nitrogen absorption capacity by regulating the expression levels of RBOH1 and TGA4 genes to improve the low nitrogen stress tolerance of the germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570838B_ABST
    Figure CN119570838B_ABST
Patent Text Reader

Abstract

This invention discloses the application of tomato genes or their encoded proteins in regulating plant tolerance to low nitrogen stress, relating to the field of biotechnology. By knocking out the RBOH1 gene in tomatoes, compared to wild-type plants, nitrogen uptake capacity was reduced, and the expression of nitrate transporter genes NRT1.1 and NRT2.1 was restricted. Under low nitrogen stress, RBOH1 gene expression was upregulated 3.2-fold after one day of treatment and maintained a sustained and significant increase for 1 to 3 days, demonstrating that RBOH1 positively regulates nitrogen uptake in tomatoes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of tomato genes or their encoded proteins in regulating plant tolerance to low nitrogen stress. Background Technology

[0002] Reactive oxygen species (ROS) are key mediators in plant stress responses. ROS can be produced in various organelles, such as chloroplasts, mitochondria, peroxisomes, and the redox enzyme system on the plasma membrane. In plants, NADPH oxidase / respiratory burst oxidase homolog (RBOH) proteins produce localized ROS bursts, which are crucial for regulating plant growth, development, and stress responses. In Arabidopsis, the RBOH family comprises 10 members (RBOHA to RBOHJ), each with specific functions in plant development and stress responses. Among them, RBOHD and RBOHF are highly expressed in root tissues and play a key role in regulating root growth and responses to environmental stimuli. RBOHF plays an important role in responding to abiotic stresses such as the abscisic acid signaling pathway and salt stress tolerance. In tomato, the RBOH family contains 8 members (RBOH1, RBOHA-F, and RBOHH), with RBOH1 (Solyc08g081690) being the most similar to Arabidopsis RBOHF. RBOH1 is highly expressed in the roots of tomatoes and participates in plant responses to heat and oxidative stress through the hydrogen peroxide (H2O2) signaling pathway.

[0003] Tomato (Solanum lycopersicum L.) belongs to the genus Solanum in the family Solanaceae and is an annual or perennial herbaceous plant. As one of the most widely cultivated and consumed vegetable crops globally, tomatoes have significant economic value due to their short growth cycle and increasingly sophisticated greenhouse cultivation techniques. Furthermore, as a typical climacteric fruit, the tomato is gradually becoming an important model plant in plant molecular biology research.

[0004] Under stress conditions, the accumulation of reactive oxygen species (ROS) affects the redox state of various proteins, including enzymes, receptors, and small molecules. ROS accumulation can activate, modify, or integrate multiple stress response signaling pathways, thereby altering gene expression and enhancing plant tolerance to stress. H2O2 is the most stable ROS due to its relatively long half-life in living cells. H2O2 directly oxidizes proteins through oxidative post-translational modifications (Oxi-PTMs), primarily targeting methionine and cysteine ​​residues. These modifications can alter protein conformation, subcellular localization, and activity, including transcription factor activity, thereby triggering specific H2O2 signaling pathways. For example, H2O2 promotes the oxidation of C-repeat binding translation factor (CBF) oligomers and monomers, and inhibits the expression of cold-response genes under low-temperature stress. Furthermore, H2O2-induced Oxi-PTMs enhanced the transcriptional activity of BZR1, regulated plant growth, and promoted its interaction with key regulators in the auxin and light signaling pathways, such as auxin response factor 6 (ARF6) and phytochrome interacting factor 4 (PIF4). However, it remains unclear whether H2O2-induced Oxi-PTMs affect the function of proteins related to nitrogen uptake and metabolism under low nitrogen stress. Summary of the Invention

[0005] The applicant identified the RBOH1 gene, closely related to root H2O2 production, and the H2O2-sensitive transcription factor TGA4 in tomatoes. Furthermore, the RBOH1 mutant reduces the tomato's tolerance to low nitrogen stress. This reveals a novel mechanism by which H2O2 participates in tomato nitrogen uptake, providing crucial evidence for accelerating research on tomato nitrogen uptake mechanisms and gene discovery, and possessing significant scientific and practical implications. The study found that H2O2 plays a vital role in plant nitrogen uptake.

[0006] This invention has discovered the gene RBOH1, which is closely related to the production of reactive oxygen species in tomato roots.

[0007] (Solyc08g081690) A BIAM protein labeling experiment determined that the transcription factor TGA4 (Solyc04g054320) is sensitive to H2O2. TGA4 modified by H2O2 oxidation promotes the expression of NRT1.1 and NRT2.1 under low nitrogen conditions. Based on this, the present invention provides an application of RBOH1-dependent H2O2 in promoting nitrogen uptake in tomatoes.

[0008] The specific technical solution is as follows:

[0009] This invention provides the application of a tomato gene or its encoded protein in regulating plant tolerance to low nitrogen stress, wherein the tomato gene is the RBOH1 gene or the TGA4 gene.

[0010] Specifically, the RBOH1 mutant tomato exhibits reduced nitrogen absorption capacity. The lower the expression level of the RBOH1 gene in plants, the weaker the tomato's nitrogen absorption capacity.

[0011] Specifically, the amino acid sequence of the protein encoded by the RBOH1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the TGA4 gene is shown in SEQ ID NO.4.

[0012] The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.2.

[0013] The present invention also provides a method for regulating plant tolerance to low nitrogen stress. When it is necessary to reduce plant tolerance to low nitrogen stress, the RBOH1 gene or TGA4 gene in the plant is silenced or knocked out; when it is necessary to increase plant tolerance to low nitrogen stress, the RBOH1 gene or TGA4 gene in the plant is overexpressed. The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.2.

[0014] Preferably, the plant is Arabidopsis thaliana, tomato, or tobacco.

[0015] This invention provides the application of tomato genes or their encoded proteins in creating germplasm with high tolerance to low nitrogen stress. The tomato gene is either the RBOH1 gene or the TGA4 gene. Germplasm with high tolerance to low nitrogen stress is obtained by screening for germplasm with high expression of the tomato gene or the protein encoded by the tomato gene.

[0016] Specifically, the amino acid sequence of the protein encoded by the RBOH1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the TGA4 gene is shown in SEQ ID NO.4;

[0017] The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.2.

[0018] The present invention also provides a method for constructing germplasm with high tolerance to low nitrogen stress, comprising the following steps: overexpressing the RBOH1 gene in the germplasm, wherein the nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1.

[0019] The method for constructing germplasm with high tolerance to low nitrogen stress specifically includes the following steps:

[0020] (1) Construct a vector for overexpressing the RBOH1 gene;

[0021] (2) The vector for overexpressing the RBOH1 gene constructed in step (1) was introduced into tomato explants to overexpress the RBOH1 gene with the nucleotide sequence shown in SEQ ID NO.1. After culturing, germplasm with high tolerance to low nitrogen stress was obtained. Specifically, in step (2), the vector for overexpressing the RBOH1 gene was transformed into Agrobacterium EHA105 and then infected tomato explants.

[0022] The beneficial effects of this invention are:

[0023] This invention knocks out the RBOH1 gene in tomatoes, resulting in reduced nitrogen uptake compared to wild-type plants. The expression of nitrate transporter genes NRT1.1 and NRT2.1 is also restricted. Under low nitrogen stress, the expression of the RBOH1 gene is upregulated by 3.2-fold after one day of treatment and remains significantly increased over one to three days, indicating that RBOH1 positively regulates nitrogen uptake in tomatoes. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the CRISPR / Cas9 vector construction. It includes a structural diagram of the vector sgRNA locations, labeled with the sequences of the two sgRNAs on the tomato RBOH1 genome, and the sequencing results of the tomato RBOH1 CRISPR / Cas9 knockout plants. The sgRNA-specific recognition sequences are shown in red.

[0025] Figure 2 This shows the expression of RBOHs genes in tomato roots. Among them, Figure 2 A shows the expression of eight RBOH genes in the root system of tomato; Figure 2 B represents the changes in the expression of the RBOH1 gene in tomato roots at 0d, 1d, 3d, 5d, 7d, and 12d after treatment with full nutrient solution and low nitrogen nutrient solution (LN indicates low nitrogen stress). Figure 2 The data shown is the average of four replicates, and the standard error is indicated by a vertical line. Tukey's test was used, with different lowercase letters indicating a 5% significance level for differences between treatments.

[0026] Figure 3 The changes in H2O2 content and NADPH oxidase activity in tomato roots after treatment with total nutrient solution and low nitrogen nutrient solution were shown. Figure 3 A shows the DAB staining phenotypic diagrams of the roots of each plant line after treatment with full nutrient solution and low nitrogen nutrient solution, with a scale bar of 300 μm. Figure 3B shows the DCF staining phenotypic diagrams of the roots of each line after treatment with full nutrient solution and low nitrogen nutrient solution, with a scale bar of 300 μm. Figure 3 C represents the CeCl3 staining phenotypic diagram of the root fine cells of each plant line after treatment with full nutrient solution and low nitrogen nutrient solution, scale bar = 0.5 μm; Figure 3 D is a quantitative statistical chart of H2O2 content in the roots of each plant line after treatment with full nutrient solution and low nitrogen nutrient solution. Figure 3 E is a quantitative statistical chart of NADPH oxidase activity in the roots of various plant lines after treatment with total nutrient solution and low nitrogen nutrient solution. Figure 3 The data shown in D and 3E are the averages of four replicates, with standard errors indicated by vertical lines. Tukey's test was used, with different lowercase letters indicating differences between treatments at the 5% significance level. WT represents the non-transgenic wild-type tomato Ailsa Craig; rboh1-1 and rboh1-2 are RBOH1 mutant plants.

[0027] Figure 4 The phenotypic characteristics of each line after treatment with total nutrient solution and low nitrogen nutrient solution are shown. Figure 4 A shows the phenotypic figures of each plant after treatment with full nutrient solution and low nitrogen nutrient solution, with a scale bar of 10cm. Figure 4 B is a statistical chart of chlorophyll content and biomass of each strain after treatment with total nutrient solution and low nitrogen nutrient solution; Figure 4 C is a statistical graph showing the nitrogen and carbon content in the roots of each plant line after treatment with total nutrient solution and low nitrogen nutrient solution. Figure 4 The data shown in B and 4C are the average of four replicates, with standard errors indicated by vertical lines. Tukey's test was used, with different lowercase letters indicating differences between treatments at the 5% significance level. WT represents the non-transgenic wild-type tomato Ailsa Craig; rboh1-1 and rboh1-2 are rboh1 mutant plants.

[0028] Figure 5 This diagram shows the binding of transcription factor TGA4 to the promoters of NRT1.1 and NRT2.1 genes. Figure 5 A is a schematic diagram showing the binding of transcription factor TGA4 to the promoters of NRT1.1 and NRT2.1 genes; Figure 5 B is the EMSA result image; Figure 5 C represents the experimental results of LUC-REN; Figure 5 D is a graph showing the results of the CUT-RUN experiment. Figure 5 The data shown in C and 5D are the average of four replicates, with the standard error indicated by a vertical line. Tukey's test was used, with different lowercase letters indicating a 5% significance level for differences between treatments.

[0029] Figure 6 This diagram shows the binding of the oxidatively modified transcription factor TGA4 to the promoters of the NRT1.1 and NRT2.1 genes. Figure 6 A represents the experimental results labeled with BIAM. Figure 6 B shows the results of the in vitro oxidation experiment; Figure 6 C represents the results of the in vivo oxidation experiment; Figure 6 D is the experimental result diagram of LUC-REN; Figure 6 E represents the results of the CUT-RUN experiment; Figure 6 F is a graph showing the results of a real-time quantitative PCR experiment. Figure 6 The data shown in D, 6E, and 6F are the average of four replicates, with the standard error indicated by a vertical line. Tukey's test was used, with different lowercase letters indicating a 5% significance level between treatments. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Operating methods not specifically specified in the following embodiments are generally performed under conventional conditions or as recommended by the manufacturer.

[0031] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available. The experimental material used was the tomato cultivar Ailsa Craig (Solanum lycopersicum L.cv).

[0032] Example 1

[0033] Total RNA extraction and gene expression analysis.

[0034] 1. Total RNA extraction from tomatoes

[0035] Total RNA was extracted from tomato roots using the Tiangen Plant total RNA extraction kit.

[0036] (1) Take 0.1g of root sample and grind it in liquid nitrogen, add 1mL of lysis buffer RZ, and vortex mix well;

[0037] (2) Centrifuge at 4℃ and 12000rpm for 5min, then discard the supernatant;

[0038] (3) Add 200 μL of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes;

[0039] (4) Centrifuge at 4℃ and 12000rpm for 10min. The sample will be divided into three layers: a yellow organic phase, an intermediate layer and a colorless aqueous phase. Transfer the aqueous phase to a new tube for the next step.

[0040] (5) Add 0.5 times the volume of anhydrous ethanol, mix well, transfer to the adsorption column CR3, centrifuge at 4℃ and 12000rpm for 30s, and discard the waste liquid in the collection tube.

[0041] (6) Add 500 μL of protein removal solution RD to the adsorption column CR3, centrifuge at 12000 rpm for 30 s at 4℃, and discard the waste liquid.

[0042] (7) Add 600 μL of washing solution RW to the adsorption column CR3, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 30 s at 4℃, and discard the waste liquid.

[0043] (8) Repeat step (7);

[0044] (9) Place the adsorption column into a 2mL collection tube, centrifuge at 4℃ and 12000rpm for 2min to remove residual waste liquid;

[0045] (10) After the adsorption column was dried in the clean bench for 5 min, it was transferred to a new RNase-free centrifuge tube, 50 μL of RNase-Free ddH2O was added, and the column was placed at room temperature for 2 min, then centrifuged at 12000 rpm for 2 min at 4℃.

[0046] (11) OD was measured using an ultraviolet spectrophotometer. 260 / OD 280 To test the content and purity of RNA samples.

[0047] 2. Real-time quantitative PCR (qRT-PCR)

[0048] A 480II Real-Time PCR detection system (Roche, Swiss) was used with SYBR Green PCR Master Mix (Takara, RR420A). PCR reaction conditions were: 95℃ for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, and 72℃ extension for 30 s, for 40 cycles. Fluorescence data were collected at the end of the extension phase of each cycle. Tomato Actin and Ubiquitin3 genes were used as internal controls. Gene-specific primers were designed based on the cDNA sequences, and the primer sequences are shown in Table 1. Relative gene expression levels were calculated using the method of Livak and Schmittgen (2001).

[0049] Table 1 Primers for Real-Time Quantitative PCR

[0050]

[0051]

[0052] To elucidate the role of RBOHs / NADPH oxidase-dependent ROS in tomato response to low nitrogen stress, we first examined the expression levels of all eight RBOH genes in tomato roots. Figure 2 A). Under normal conditions, the transcriptional level of RBOH1 was significantly higher than that of the other seven RBOH genes, especially in tomato roots. RBOH1 expression in roots and flowers was significantly higher than in other tissues, indicating its crucial role in root ROS production. Under low nitrogen stress, RBOH1 gene expression was upregulated 3.2-fold after one day of treatment and remained consistently and significantly increased over 1 to 3 days. Figure 2 B).

[0053] Example 2

[0054] Construct tomato RBOH1 gene mutant plants.

[0055] First, total RNA was extracted from the young roots of wild-type tomatoes. The obtained tomato total RNA was reverse transcribed into cDNA. Using the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), the following sgRNA sequence was designed (RBOH1-sgRNA: ACGTCGGATACGGTGTCTTC). The synthesized sequence was annealed and inserted into the BbsI site of the AtU6-sgRNA-AtOBQ-Cas9 vector, and the AtU6-sgRNA-AtoBQ-Cas9box was inserted into the HindIII and KpnI sites of the pCAMBIA1301 binary vector. All the obtained plasmids were transformed into Agrobacterium tumefaciens strain EHA105. Agrobacterium-mediated infection of tomato cotyledons was used to transform the target vector into the cotyledons. Hygromycin was used for preliminary screening of candidate plants. Transformed plants were selected based on hygromycin resistance, and knockout was identified by sequencing the PCR amplicon of the target locus. Specific primers were designed near the sgRNA sequence location of the tomato RBOH1 gene to detect changes in the target gene sequence. The primers are shown below, and the detection fragment length is 363 bp. Homozygous mutants from RBOH1 knockout transgenic plants can be screened for experimental use based on the size of the PCR product bands and sequencing results. The PCR products were then sent for testing. Figure 1 Sequencing results of tomato RBOH1 CRISPR / Cas9 knockout plants. CRISPR-RBOH1-F: 5'-GGTCAGGCTTCTACAGAAAACT-3',

[0056] CRISPR-RBOH1-R: 5′-GATCGAGTTTCCGACGTCGA-3′.

[0057] The specific steps are as follows:

[0058] 1) Preparation of culture medium

[0059] Sowing medium: 2.15 g / L MS powder + 100 mg / L inositol + 10 g / L sucrose + 8 g / L agar. pH 5.8.

[0060] Nursing medium: alcohol + 1.3 g / L thiamine hydrochloride + 0.2 mg / L 2,4-D + 200 mg / L KH2PO4 + 0.1 mg / L KT + 7.5 g / L agar. pH 5.8.

[0061] 2Z regeneration medium: 4.44 g / L MS powder + 30 g / L sucrose + 100 mg / L inositol + 2 mg / L ZR + 300 mg / L timentin + 6 mg / L hygromycin. pH 5.8.

[0062] 0.2Z selective regeneration medium: 4.44 g / L MS powder + 30 g / L sucrose + 100 mg / L inositol + 0.2 mg / L ZR + 300 mg / L timentin + 6 mg / L hygromycin. pH 5.8.

[0063] Rooting medium: 4.44 g / L MS powder + 30 g / L sucrose + 100 mg / L inositol + 300 mg / L timentin + 6 mg / L hygromycin. pH 5.8.

[0064] Liquid MS 0.2 medium: 4.44 g / L MS powder + 20 g / L sucrose + 100 mg / L inositol + 0.2 mg / L thiamine hydrochloride. pH 5.8. Used for suspension infection of Agrobacterium.

[0065] YEB medium: 5g beef extract, 5g peptone, 1g yeast extract, 5g sucrose, 0.5g MgSO4·7H2O, bring to a final volume of 1 L with distilled water, adjust pH to 7.0, and autoclave at 121℃ for 20 min. For YEB solid medium, add 15g agar powder per liter, and other components are the same as for liquid medium.

[0066] 2) Cultivation of sterile seedlings

[0067] Tomato seeds were soaked in tap water (or shaken at 28°C and 200 rpm) for 6–8 hours, then disinfected with 75% alcohol for 30 seconds, followed by disinfection in 10% NaClO for 15 minutes (shaking at 28°C and 200 rpm). The seeds were rinsed three times with sterile distilled water and transferred to sterile containers, then inoculated onto 1 / 2 MS medium. After culturing in the dark at 25°C until seedlings showed signs of sprouting, they were transferred to a light-controlled culture chamber. Seedling growth conditions were 25°C, 16 hours of light / 8 hours of darkness, and a light intensity of 1800 lx.

[0068] 3) Prepare explants and culture Agrobacterium.

[0069] About a week after seed germination, before the cotyledons have unfolded but the true leaves have emerged, cut the cotyledons of the sterile seedlings into two sections with a new scalpel, leaving a small section of petiole attached. Lay these sections flat on a nurturing medium and pre-culture for 24 hours (avoid light, overnight is sufficient; prolonged nurturing can lead to over-infection). Pick a single colony of Agrobacterium from an LB agar plate containing antibiotics and inoculate it into 30 mL of LB agar (or a 150 mL Erlenmeyer flask) containing antibiotics. Incubate overnight at 28°C and 200 rpm until mid-log phase (OD600≈1.0, approximately 16–24 hours). Shake the culture first, then cut the cotyledons (inoculate between 12–20 hours).

[0070] 4) Conversion and Regeneration

[0071] The culture of *Agrobacterium tumefaciens* strain A containing the target vector plasmid was removed from a -80°C freezer and activated on a YEB plate containing antibiotics. A single colony of *Agrobacterium tumefaciens* was picked and inoculated into 2 mL of YEB containing antibiotics. The culture was incubated overnight at 28°C with shaking at 200 rpm. Then, the culture was multiplied by 1:100 in 30 mL of the culture and incubated overnight at 28°C with shaking at 200 rpm until OD reached [value missing]. 600 =0.8~1.0. Centrifuge the cultured Agrobacterium at 4000rpm for 10min at 4℃; discard the supernatant, and add 15mL of MS 0.2 suspension medium to resuspend the bacteria for later use. Transfer the pre-cultured cotyledon explants to a sterile petri dish containing 15mL of MS 0.2, pour in the resuspended bacterial solution, and incubate in the dark for 2-3min, gently agitating the dish. Gently lift the explants with tweezers, transfer them to sterile filter paper, blot off any remaining bacterial solution, and then place them back into the original nucleating medium, reverse side up. Co-culture at 22℃ in the dark for 48h.

[0072] After co-culturing, the explants were transferred face up onto 2Z medium and cultured at 25°C under a 16-hour light / 8-hour dark light cycle. The 2Z medium was replaced with fresh medium every two weeks. Once shoots differentiated, the browned explants were removed, and the differentiated shoots were transferred to 0.2Z medium for selective culture. The medium was replaced with fresh medium every three weeks.

[0073] 5) Rooting culture and transplanting

[0074] When the regenerated shoots grow to about 1 cm, cut them off (optional, to avoid damaging the rooting site) and place them in a rooting medium to root. Two weeks later, harden off the well-rooted seedlings that have grown to about 5 cm and transplant them into nutrient pots with a peat moss:vermiculite = 3:1 substrate. This yields tomato RBOH1 gene mutant plants, named mutant plants rboh1-1 and rboh1-2 (the sequencing results of rboh1-1 and rboh1-2 correspond to...). Figure 1 (M1: +1bp and M3: +2bp).

[0075] Example 3

[0076] The various indicators of the obtained wild-type tomato WT and rboh1 mutant plants were measured after low nitrogen treatment. The experimental materials were wild-type WT, mutant plants rboh1-1 and rboh1-2, and the transgenic plants were observed using F2 generation seeds with stable inheritance.

[0077] The specific methods for low-nitrogen treatment of wild-type WT and rboh1 mutant plants are as follows:

[0078] Wild-type WT and mutant plants rboh1-1 and rboh1-2 were divided into two groups: a control group and an experimental group.

[0079] When the tomatoes reached the five-leaf, one-heart stage, the experimental group was subjected to a low-nitrogen treatment, with the nutrient solution changed every 3 days. The growing conditions were: day / night temperature 23℃ / 20℃, 14h photoperiod, and 600 μmol / m³ of nitrogen. -2 s -1 Light intensity.

[0080] The total duration of the low-nitrogen treatment was 3 weeks. Samples were taken and relevant indicators were measured during and at the end of the experiment.

[0081] The method for determining chlorophyll content is as follows:

[0082] Normal functional leaves were used as samples for chlorophyll extraction. 0.1 g of leaf sample was weighed and extracted with 10 mL of 80% acetone in the dark until the leaves were completely decolorized. The sample was then centrifuged at 4000 g, and the supernatant was used for quantitative determination of chlorophyll. The absorbance of the supernatant was measured at wavelengths of 663 nm and 645 nm using a spectrophotometer to determine the chlorophyll content.

[0083] The methods for determining carbon and nitrogen content are as follows:

[0084] The entire aboveground parts and the entire root system were used as samples for carbon and nitrogen content determination. These samples were dried, finely ground, and passed through a 100-mesh sieve to ensure consistency. The nitrogen and carbon content in the plant tissues was analyzed using a Flash IRMS elemental analyzer (Thermo Fisher Scientific, USA).

[0085] The staining method for 3,3'-diaminobenzidine (DAB) is as follows:

[0086] Root tips were immersed in 50 mM Tris-HCl buffer (pH 3.8) for 15 minutes, and then stained with 0.1% DAB solution under light for 10 minutes. After staining, the root tips were rinsed three times with Tris-HCl buffer and destained with acid glycerol at 60°C for 12 hours. The treated root tips were observed using a Zeiss Stemi 305 stereomicroscope equipped with a Zeiss Axiocam ERc 5s camera, maintaining consistent imaging parameters.

[0087] The H2DCF-DA(DCF) staining method is as follows:

[0088] The root tips were immersed in 50 mM PBS buffer (pH 7.4) for 30 minutes, and then stained with H2DCF-DA (Sigma-Aldrich) in the dark for 10 minutes. After rinsing three times with PBS buffer, fluorescence images were captured using a Leica DM4000B microscope and a Leica DFC425C camera.

[0089] The CeCl3 staining method is as follows:

[0090] Root tips were immersed in 50 mM 3-(N-morpholine)propanesulfonic acid (MOPS) buffer (pH 7.2) and then vacuum permeated with 5 mM CCCl3 solution in the dark. The root tips were then fixed for 1 hour in 50 mM sodium arsenite buffer (pH 7.2) of 1.25% (v / v) glutaraldehyde and 1.25% (v / v) paraformaldehyde and observed under a transmission electron microscope.

[0091] The method for determining H2O2 content is as follows:

[0092] The entire root system was used as the sample for determining H2O2 content, with 0.1 g of tomato root sample taken for measurement. H2O2 content was quantified using a hydrogen peroxide assay kit (Solarbio, BC3595), following the detailed instructions provided with the kit.

[0093] The method for determining NADPH oxidase activity is as follows:

[0094] The plasma membrane was separated from the root samples using a modified biphase aqueous polymer partitioning system. First, the roots were homogenized in extraction buffer (50 mM Tris-HCl, pH 7.5, 0.25 M sucrose, 1 mM ascorbic acid, 1 mM EDTA, 0.6% PVP, 1 mM PMSF) and filtered through gauze. After centrifugation at 10000 g for 15 min, the micromembrane was separated by centrifugation at 50000 g for 30 min. The precipitate was resuspended in a solution (0.33 M sucrose, 3 mM KCl, 5 mM potassium phosphate, pH 7.8) and the plasma membrane was separated by a three-round partitioning system (6.2% Dextran T500, 6.2% polyethylene glycol 3350, 0.33 M sucrose, 3 mM KCl, 5 mM potassium phosphate, pH 7.8). The upper phase was diluted with Tris-HCl buffer (10 mM, pH 7.4) containing 0.25 M sucrose, 1 mM EDTA, 1 mM DTT, 1 mM ascorbic acid, and 1 mM PMSF, and centrifuged at 120,000 g for 30 minutes. The final precipitate was resuspended in Tris-HCl buffer for further analysis. BSA was used as a standard to determine the protein content in the plasma membrane. NADPH-dependent superoxide anion (O3) 2- The activity of XTT was determined by measuring its reaction with O 2- The amount of reduction was evaluated. The reaction mixture (1 mL) consisted of 50 mM Tris-HCl buffer (pH 7.5), 0.5 mM XTT, 100 μM NADPH, and 15–20 μg of membrane protein. The reaction was initiated by adding NADPH, and the reduction of XTT was monitored at 470 nm. Background activity was corrected by adding 50 units of superoxide dismutase (SOD) to the reaction. The superoxide generation rate was assessed using an extinction coefficient of 2.16 × 10⁻⁶. 4 M -1 cm -1 calculate.

[0095] The function of rboh1 mutants (rboh1-1 and rboh1-2) in ROS generation and tolerance to low nitrogen stress was investigated. Histochemical analysis by DAB and DCF staining showed that low nitrogen stress-induced ROS was significantly reduced in the rboh1 mutants. Figure 3 A-3B). Subcellular localization studies using CeCl3 showed that, compared to wild-type plants, the accumulation of H2O2 in the intercellular spaces of root cells was also suppressed in the rboh1 mutant after low-nitrogen treatment. Figure 3 C). Consistently, low-nitrogen-induced H2O2 production and NADPH oxidase activity were also inhibited in the roots of the rboh1 mutant. Figure 3This indicates that RBOH1 mediates ROS production under low nitrogen stress. We further investigated the function of RBOH1 in tomato's response to low nitrogen stress. Under normal nitrogen conditions, there was no significant difference in growth phenotype between the WT and rboh1 mutants. Figure 4 A). However, after three weeks of low-nitrogen treatment, the rboh1 mutant exhibited severe leaf yellowing, while the WT plants showed milder yellowing. Figure 4 A). Under low nitrogen stress, the chlorophyll content and total biomass of the rboh1 mutant were significantly lower than those of the WT plant (A). Figure 4 B). Under normal conditions, the nitrogen and carbon contents in the roots of WT and rboh1 plants are similar ( Figure 4 C). However, under low nitrogen conditions, the nitrogen and carbon contents in the roots and stems of the rboh1 mutant were significantly lower than those in the WT plant (C). Figure 4 C). Similarly, under normal conditions, there was no significant difference in the gene expression of NRT1.1 and NRT2.1 in the roots of WT and rboh1 plants. However, under low nitrogen conditions, the gene expression of NRT1.1 and NRT2.1 in the roots of the rboh1 mutant was significantly lower than that of WT. This highlights the crucial role of RBOH1-dependent H2O2 in responding to low nitrogen stress. Therefore, these findings demonstrate that RBOH1 positively regulates nitrogen uptake in tomatoes.

[0096] Example 4

[0097] 1. EMSA experiments verified the binding of transcription factor TGA4 to the promoters of NRT1.1 and NRT2.1 genes.

[0098] Specific primers were designed based on the full-length CDS of the TAG4 gene (amino acid sequence as shown in SEQ ID NO.4, gene sequence as shown in SEQ ID NO.2) (see Table 2), and PCR amplification was performed using tomato cDNA as a template. The vector was digested with EcoRI and BamHI and ligated into the yeast expression vector pGBKT7(BD-MED25). MBP-TGA4 and MBP-TGA4 were also used. C334S The fusion protein required affinity purification. In EMSA experiments, the probe was biotin-labeled at the 3′ end using the Biotin 3′ End DNA Labeling Kit (Pierce, 89818) and then annealed to form a double-stranded probe. Binding experiments were performed according to the guidelines provided with the Light Shift Chemiluminescent EMSA Kit (Thermo Fisher Scientific, 20148). The Biotin-EBNA Control DNA and EBNA extract provided in the kit were used as positive controls. The primers used for the probes are listed in Table 3.

[0099] 2. LUC-REN assays confirmed that transcription factor TGA4 activates the expression of NRT1.1 and NRT2.1.

[0100] TGA4 and TGA4 C334S CDS sequence (TGA4) C334S Nucleotide sequences (as shown in SEQ ID NO. 5) and promoters for NRT1.1 and NRT2.1 (NRT1.1 promoter sequence shown in SEQ ID NO. 6; NRT2.1 promoter sequence shown in SEQ ID NO. 7) were inserted into pGreen 1I002962-SK and pGreen II0800-LUC vectors, respectively. Primers used for vector construction are listed in Table 2. The promoter PCR products were cloned into the pGreenII0800-LUC vector to drive the expression of the firefly luciferase (LUC) reporter gene, while the 35S promoter (Pro35S) was used to drive the Renilla luciferase (REN) reporter gene as an internal control. Promoter activity was analyzed in *Nicotiana benthamiana* via Agrobacterium-mediated transient expression. All constructs were introduced into *Agrobacterium* strain GV3101. Agrobacterium strains containing the relevant constructs were mixed and injected into *N. benthamiana* leaves with infiltration buffer. Two days after incubation, LUC and REN activities were measured using a dual-luciferase reporter gene kit (Vazyme, DL101-01). The relative LUC / REN activities of the empty vector SK combined with the promoter were normalized to 1, and the analysis was performed in six replicates.

[0101] 3. Cut-run experiments verified that transcription factor TGA4 activates the expression of NRT1.1 and NRT2.1 in tomato.

[0102] Plant cell nuclei were extracted using the BestBio Plant Cell Nucleus Extraction Kit (BestBio, BB-36112). Cut-run experiments were performed using the High-Activity pG-M Nase CUT&RUN PCR / qPCR Kit (Vazyme, HD101) according to the manufacturer's instructions. Approximately 5 × 10⁻⁶ Ng was used in the reaction. 5 Nuclei were collected. Nucleus samples were incubated overnight at 4°C with IgG control antibody and anti-GFP monoclonal antibody (Thermo Fisher Scientific, MA5-15256), followed by cleavage and release. DNA fragments from the cut-run experiment were purified using DNA purification buffer and a centrifuge column. Finally, the DNA products were quantified using qPCR; the primers used are listed in Table 4.

[0103] Table 2 Primers for vector construction

[0104] carrier sequence MBP-TGA4-F gagggaaggatttcagaattcATGAATTCTTCAACATATACTCAATTTGTT MBP-TGA4-R caggtcgactctagaggatccAGCAGGTTCAGAAAGACGTCCA <![CDATA[MBP-TGA4 C334S -F]]> GATGTCCAGCATACTGGCTCCGCACCAATCAG <![CDATA[MBP-TGA4 C3334 -R]]> CCAGTATGCTGGACATCTGTAGAAGGGTTTCTTGG SK-TGA4-F cgctctagaactagtggatccATGAATTCTTCAACATATACTCAATTTGTT SK-TGA4-R tgatttcagcgaattggtaccAGCAGGTTTCAGAAAGACGTCCA <![CDATA[SK-TGA4 C3334 -F]]> GATGTCCAGCATACTGGCTCCGCACCAATCAG <![CDATA[SK-TGA4 C3334 -R]]> CCAGTATGCTGGACATCTGTAGAAGGGTTTCTTGG GFP-TGA4-F ctctcgagctttcgcgagctcATGAATTCTTCAACATATACTCAATTTGTT GFP-TGA4-R gcccttgctcaccatggatccAGCAGGTTCAGAAAGACGTCCA <![CDATA[GFP-TGA4 C3334 -F]]> GATGTCCAGCATACTGGCTCCGCACCAATCAG <![CDATA[GFP-TGA4 C3334 -R]]> CCAGTATGCTGGACATCTGTAGAAGGGTTTCTTGG

[0105] Table 3 Probe primers for EMSA experiments

[0106] probe sequence NRT1.1-probe-F TATCTTTTTGACGTGCAATA NRT1.1-probe-R TATTGCACGTCAAAAAGATA NRT2.1-probe-F AAACACACGTCAGGCTTCCA NRT2.1-probe-R TGGAAGCCTGACGTGTGTTT Mu-NRT1.1-probe-F TATCTTTTAAAAATGCAATA Mu-NRT1.1-probe-R TATTGCATTTTTAAAAGATA Mu-NRT2.1-probe-F AAACACAAAAAAGGCTTCCA Mu-NRT2.1-probe-R TGGAAGCCTTTTTTGTGTTT

[0107] Table 4 Primers for CUT-RUN experiment

[0108] name sequence NRT1.1-CUT-RUN-F CCCTATTGTTTGGGTGCATTCT NRT1.1-CUT-RUN-R GTCTGGCCCAGGAATTTTACAAC NRT2.1-CUT-RUN-F TTTGCAATGCCCTTATTCTTTG NRT2.1-CUT-RUN-R TCTTCACGTTTGCCTCACCC

[0109] The study on the effects of RBOH1-induced H2O2 on the expression of NRT1.1 and NRT2.1 genes under low nitrogen conditions focuses on whether H2O2 regulates these gene expression through oxidative post-translational modification (Oxi-PTM) of specific transcription factors. We identified a transcription factor, TGA4, as a regulator of NRT1.1 and NRT2.1. TGA4 has a conserved "TGACG" binding site in the promoters of NRT1.1 and NRT2.1. Figure 5 A). Electrophoretic mobility shift analysis (EMSA) confirmed that TGA4 binds to these promoters in vitro ( Figure 5 B). In vivo, using Pro35S as the effector and ProNRT1.1 or ProNRT2.1 as the luciferase (LUC) of the reporter genes, experiments showed that TGA4 significantly enhanced the LUC activity of both reporter genes. Figure 5 C). Furthermore, analysis using cut & run qPCR showed that, under low nitrogen conditions, GFP-TGA4 bound more strongly to the promoters of NRT1.1 and NRT2.1 than the GFP-EV control. Figure 5 D).

[0110] To analyze Oxi-PTM, we used biotin exchange assay to detect H2O2-sensitive cysteine ​​residues and BIAM labeling assay to detect H2O2-oxidized residues. The transcription factor maltose-binding protein (MBP) fusion protein (MBP-TGA4) was pretreated with or without H2O2 treatment and then labeled with BIAM. SDS-PAGE and Western blot analysis showed that MBP-TGA4 was BIAM-labeled, and H2O2 treatment resulted in a dose-dependent decrease in labeling levels, indicating that H2O2 reduced the number of reduced cysteine ​​residues in these proteins. Figure 6 A).

[0111] Western blot analysis showed that H2O2 induced the oxidation of TGA4, and Cys-334 was identified as the major oxidized residue. Figure 6 B).

[0112] In vivo experiments showed that nitrogen deficiency significantly induced the oxidation of TGA4, and H2O2 further enhanced this oxidation. Under these conditions, the mutation of Cys-334 significantly reduced the oxidation level of TGA4. Figure 6 C). The RBOH1 mutation also reduced the oxidation level of TGA4 under low nitrogen stress. Figure 6 C).

[0113] To determine whether H2O2-mediated TGA4 oxidation promoted the expression of NRT1.1 and NRT2.1, we measured LUC activity in *N. benthamiana* leaves under control and H2O2 treatment conditions. Pro35S expression significantly enhanced the LUC activity of the NRT1.1 and NRT2.1 reporter genes, especially under H2O2 treatment. Figure 6 D). However, in leaves expressing the Pro35S mutant, LUC activity was lower after H2O2 treatment than in leaves expressing Pro35S ( Figure 6 D) indicates that H2O2-mediated Oxi-PTM of TGA4 at Cys-334 is crucial for TGA4's ability to enhance NRT1.1 and NRT2.1 promoter binding.

[0114] Further analysis using cut-run qPCR under low-nitrogen conditions showed that the enrichment levels of NRT1.1 and NRT2.1 promoters in the roots of GFP-TGA4 / WT transgenic plants were significantly higher than those in GFP-TGA4. C334S / WT transgenic root system ( Figure 6 E).

[0115] Furthermore, the relative enrichment of NRT1.1 and NRT2.1 promoters in the roots of GFP-TGA4 / WT transgenic plants was significantly higher than that in the roots of GFP-TGA4 / rboh1-1 plants. Figure 6 F). Mutations in RBOH1 significantly weakened the ability of TGA4 to promote NRT1.1 and NRT2.1 expression under low nitrogen conditions. These results collectively suggest that RBOH1-dependent H2O2 enhances the binding of TGA4 to the NRT1.1 and NRT2.1 promoters through oxidative post-translational modification of TGA4, thereby promoting the expression of these genes under low nitrogen stress.

[0116] Compared with the prior art, the main advantages of this invention include: This invention uses CRISPR / Cas9 technology to inhibit the expression of RBOH1 in tomatoes, producing rboh1 mutant plants, which lays the foundation for finding simpler ideas and methods to create nitrogen-efficient germplasm for tomato plants.

[0117] Furthermore, it should be understood that after reading the above description of the present invention, those skilled in the art can make various alterations or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The application of the tomato gene or its encoded protein in improving plant tolerance to low nitrogen stress, wherein the application is the overexpression of the tomato gene in plants, the tomato gene being... RBOH1 Genes, the ones mentioned RBOH1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1; the plant is tomato.

2. The application as described in claim 1, characterized in that, The RBOH1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

3. A method for improving the tolerance of tomatoes to low nitrogen stress, characterized in that, Overexpression in tomatoes RBOH1 Gene; The RBOH1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The application of the tomato gene or its encoded protein in creating tomato germplasm with high tolerance to low nitrogen stress, wherein the tomato gene is... RBOH1 The gene, the application of which is overexpression in tomatoes RBOH1 Genes; the stated RBOH1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3. RBOH1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. A method for constructing tomato germplasm with high tolerance to low nitrogen stress, characterized in that, Includes the following steps: Overexpression in tomatoes RBOH1 Genes, the ones mentioned RBOH1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. The method for constructing tomato germplasm with high tolerance to low nitrogen stress as described in claim 5, characterized in that, Includes the following steps: (1) Constructing a method for overexpression RBOH1 The carrier of genes; (2) The overexpression method constructed in step (1) RBOH1 The gene vector was introduced into tomato explants, and after culture, tomato germplasm with high tolerance to low nitrogen stress was obtained.

Citation Information

Patent Citations

  • Application of tomato SlXERICO gene in improvement of tomato high-temperature tolerance

    CN116042661A

  • Application of PIF4 gene in regulation of symbiosis of tomato arbuscular mycorrhiza

    CN117070530A