KASP marker associated with number of cotyledons of industrial hemp and application of KASP marker

Abstract

The invention relates to the technical field of industrial hemp molecular marker assisted breeding, in particular to a KASP marker associated with the number of cotyledons of industrial hemp and application of the KASP marker. The molecular marker is located on the ninth chromosome of the industrial hemp and is CanS900003 and / or CanS900004; the sequence of the CanS900003 is as shown in SEQ ID NO.1, and the CanS900003 shows remarkable G / A polymorphism at the 201bp position from the 5'end; the sequence of the CanS900004 is as shown in SEQ ID NO. 2, and the CanS900004 shows remarkable A / C polymorphism at the 201bp position from the 5'end of the CanS900004. The KASP molecular marker technology is successfully developed by excavating excellent allelic variation SNP molecular marker sites related to 3-cotyledon cannabis sativa. The application of the technology not only can effectively assist in character improvement selection of industrial cannabis sativa, but also can avoid complicated and time-consuming traditional breeding and screening processes and shorten the breeding cycle, thereby greatly improving the efficiency and accuracy of molecular breeding of industrial cannabis sativa.

Description

Technical Field

[0001] The present application relates to the technical field of molecular marker-assisted breeding of industrial hemp, and in particular to a KASP marker associated with the number of cotyledons of industrial hemp and its application. Background Art

[0002] marijuana( Cannabis sativa L.) is an annual herbaceous plant of the genus Cannabis in the family Cannabinaceae. In my country, the cultivation and utilization of hemp has a long history. Its aliases include Hanma, Huoma, Xianma, Kuima, Hanma, etc. As an ancient, traditional and important economic plant resource, the history of hemp cultivation and utilization for fiber or food in my country has exceeded 5,000 years. Industrial hemp refers to the type of hemp variety with a tetrahydrocannabinol (THC) content of less than 0.3% in the dry matter of hemp plants. Industrial hemp has attracted much attention for its wide application prospects in many fields such as textiles, papermaking, construction, food, medicine and soil ecological restoration. Its multiple uses are gradually being recognized, developed and utilized by people.

[0003] In the plant kingdom, the phenomenon of multi-cotyledon variation in plants has been reported in many plants, some of which are naturally occurring mutations, while others are artificially induced. In the seeds of dicotyledonous plants, cotyledons, as important nutritional organs, are formed in the early stages of embryonic development and provide necessary nutritional support for the early growth of seedlings. In addition, the development process of cotyledons is crucial for the polar development of embryos. Therefore, the study of the development mechanism of cotyledons helps to reveal the regulatory principles of the entire embryonic development. The discovery of multi-cotyledon mutants with significant phenotypic mutations and stable inheritance will undoubtedly promote the rapid development of this research field. This invention obtains a high-generation stable 3-cotyledon industrial hemp population by purifying and screening a large number of 3 cotyledons of double-embryo industrial hemp materials. Compared with traditional 2-cotyledon industrial hemp, 3-cotyledon industrial hemp shows a more superior growth potential, and the number of leaves significantly exceeds the normal dicotyledon industrial hemp population. This finding may suggest that there is a certain correlation between the number of cotyledons and the number of leaves of industrial hemp. Given that the number of industrial hemp leaves is directly related to the yield of industrial hemp, screening and cultivating new varieties of tricotyledonous industrial hemp has important practical significance for increasing the yield of industrial hemp flowers and leaves.

[0004] KASP (Kompetitive Allele-Specific PCR) technology uses the specific recognition ability of fluorescent probes to accurately type gene loci, thereby achieving rapid detection of SNP (single nucleotide polymorphism) loci. Compared with molecular marker technologies such as SSR, RFLP, and InDel, KASP marker technology has the advantages of fast detection speed, low cost, and easy large-scale application. KASP marker technology does not need to be typed according to the size of DNA fragments, thus getting rid of the constraints of traditional gel electrophoresis and other cumbersome steps and low-throughput detection methods, and is more in line with the needs of the current rapidly developing high-throughput molecular detection platform. Therefore, the development of low-cost, KASP molecular markers for tricotyledon industrial hemp-related genes suitable for high-throughput molecular detection platforms is of great significance for promoting and popularizing the application of molecular marker technology and improving the efficiency and level of breeding work related to industrial hemp with excellent traits in my country. Summary of the invention

[0005] The main purpose of the present invention is to develop a KASP marker associated with the number of cotyledons of industrial hemp and its application technology. The technology is to develop a low-cost, 3-cotyledon industrial hemp related gene KASP molecular marker technology system suitable for high-throughput molecular detection platform. By promoting the application of this molecular marker technology, the present invention is expected to significantly improve the efficiency and level of my country's breeding of industrial hemp varieties with excellent traits, thereby promoting scientific and technological progress in this field and the healthy development of the industry.

[0006] Specifically, the present invention provides the following technical solutions: The KASP molecular marker associated with the number of cotyledons of industrial hemp is located on chromosome 9 of hemp and is CanS900003 and / or CanS900004; the sequence of the CanS900003 is shown in SEQ ID NO.1, and the 201bp from the 5' end presents a G / A polymorphism; the sequence of the CanS900004 is shown in SEQ ID NO.2, and the 201bp from the 5' end presents an A / C polymorphism.

[0007] Furthermore, a primer for amplifying the molecular marker is provided, characterized in that the primers for amplifying the CanS900003 molecular marker are shown as SEQ ID NOs.3 to 5; the primers for amplifying the CanS900004 molecular marker are shown as SEQ ID NOs.6 to 8.

[0008] Furthermore, a kit is provided, which contains primers for amplifying the molecular markers.

[0009] Furthermore, there is provided an application of the molecular marker, or the primer, or the kit in molecular marker-assisted breeding of industrial hemp.

[0010] Furthermore, there is provided an application of the molecular marker, the primer, or the kit in distinguishing between 2-cotyledon and 3-cotyledon industrial hemp varieties.

[0011] Further, in the application, when the KASP marker detection result CanS900003 is haplotype AA at 201bp from the 5' end, and CanS900004 is haplotype CC, the hemp to be tested is 3-cotyledon industrial hemp; when the KASP marker detection result CanS900003 is haplotype GG at 201bp from the 5' end, and CanS900004 is haplotype AA, the hemp is 2-cotyledon industrial hemp.

[0012] Furthermore, a method for breeding tricotyledonous industrial hemp varieties using the molecular markers is provided, comprising the following steps: (1) obtaining genomic DNA of a sample to be tested; (2) using genomic DNA as a template and performing competitive allele-specific PCR amplification using the primers described in claim 2; (3) After the PCR reaction is completed, the fluorescent signal generated by each reaction well is collected, and the genotype of the molecular marker is determined according to the type of the fluorescent signal. When the KASP marker detection result shows that CanS900003 is haplotype AA at 201 bp from the 5' end, and CanS900004 is haplotype CC, the sample to be tested is tricotyledonous industrial hemp.

[0013] The technical effects achieved by the present invention are: The present invention has successfully developed the KASP molecular marker technology associated with the number of cotyledons of industrial hemp. The KASP molecular marker was developed by mining the excellent allele variant SNP molecular marker sites associated with tri-cotyledon industrial hemp. This technology not only provides a powerful tool for the tri-cotyledon molecular breeding of industrial hemp, but also brings new detection technology to the analysis of hemp germplasm resources. In addition, this technology can effectively avoid the complicated and time-consuming problems of traditional breeding screening in assisting the improvement of industrial hemp traits, thereby shortening the breeding cycle and significantly improving the efficiency of industrial hemp molecular breeding.

[0014] Compared with the traditional two-cotyledon industrial hemp, the three-cotyledon industrial hemp shows a better growth potential, and the number of leaves significantly exceeds that of the two-cotyledon industrial hemp group. Given that the number of industrial hemp leaves is directly related to the yield of industrial hemp, screening and cultivating new three-cotyledon industrial hemp varieties can significantly increase the yield of industrial hemp flowers and leaves and improve economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Phenotypic diagram of the segregation phenomenon of 2, 3 and 4 cotyledons of the hybrid F1 generation; Figure 2 Comparison of the growth of 2-cotyledon industrial hemp and 3-cotyledon industrial hemp groups at the seedling stage; Figure 3 Schematic diagram of KASP typing of marker locus CanS900003; AA typing indicates that the sample is a homozygous AA genotype at this KASP marker locus (marked in red in the typing diagram, located in the upper left corner of the diagram), GG typing indicates that the sample is a homozygous GG allele genotype at this KASP marker locus (marked in blue in the typing diagram, located in the lower right corner of the diagram), and GA type indicates that the sample is a heterozygous genotype at this KASP marker locus (marked in purple in the typing diagram); Figure 4 Schematic diagram of KASP typing of marker site CanS900004; CC typing indicates that the sample is a homozygous CC genotype at this KASP marker site (marked in red in the typing diagram, located in the upper left corner of the diagram), AA typing indicates that the sample is a homozygous AA genotype at this KASP marker site (marked in blue in the typing diagram, located in the lower right corner of the diagram), and AC type indicates that the sample is a heterozygous genotype at this KASP marker site (marked in purple in the typing diagram); Figure 5 Statistical results of KASP detection of CanS900003 site in cannabis sample population; Figure 6 Statistical results of KASP detection of CanS900004 site in cannabis sample population; Figure 7 Statistical results of KASP detection of dual-marker sites in the cannabis sample population; AC indicates that marker CanS900003 is of AA genotype and CanS900004 is of CC genotype; GA indicates that marker CanS900003 is of GG genotype and CanS900004 is of AA genotype. DETAILED DESCRIPTION

[0016] The preferred embodiments of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Example 1

[0017] KASP molecular marker loci associated with cotyledon number in industrial hemp

[0018] Screening germplasm resources to obtain industrial hemp double embryo material (Yunma No. 11), using double embryo mutant plants (numbered YMT) as the mother, hybridized with normal diploid industrial hemp varieties (Yunma No. 10), F1 generation has 2 cotyledons, 3 cotyledons and 4 cotyledons segregation groups, select the F1 generation with 3 cotyledons for self-pollination, observe and count the proportion of 2 cotyledons and 3 cotyledons, and timely remove plants with 2 cotyledons. After 5-6 generations of self-pollination purification selection, the high-generation segregation population is constructed into 2 cotyledons (30 plants) and 3 cotyledons (30 plants) extreme mixed pools (BSA) for sequencing. Figure 2 It can be seen that the number of true leaves of tricotyledonous industrial hemp is significantly higher than that of bicotyledonous industrial hemp.

[0019] Using GCF_029168945.1_ASM2916894v1 as the reference genome, BSA (Bulked Segregant Analysis) analysis based on the ED method was performed (Hill JT, Demarest BL, Bisgrove BW, 2013). The gene interval related to the number of cotyledons was located on chromosome 9, and the SNP sites with high significance in the target interval were screened. Finally, two SNP sites CanS900003 (Chr9: SNP_1318994) and CanS900004 (Chr9: SNP_1350788) were obtained. At least 150bp flanking sequences upstream and downstream of the SNP sites were extracted. The sequence copy number and sequence GC content of the sites to be developed were analyzed. The sequences can only be aligned to the unique physical position on the genome, which is a non-repetitive sequence. The sequence information is shown in Table 1: Table 1 Target SNP sites and flanking sequence information Example 2

[0020] KASP molecular marker kit and detection method

[0021] Bacthprimer 3 software was used to design primers for SNP sites and flanking sequences. Each set of KASP markers consisted of 2 specific primers and 1 universal primer. The primer sequence information is shown in Table 2. A fluorescent linker sequence was attached to the 5' end of the specific primer ( GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence; GAAGGTCGGAGTCAAC GGATT is the HEX fluorescent linker sequence).

[0022] Table 2 KASP marker primer sequences designed according to the flanking sequences of the target SNP sites

[0023] KASP marker verification was performed using 96 samples on the Douglas Scientific Array Tape system. DNA sample extraction and quality control: DNA was extracted from sample tissue using the magnetic bead method, and the concentration of the DNA sample was detected using the Qubit fluorescence quantifier; the integrity of the DNA sample was detected using 1% agarose gel electrophoresis, and the DNA samples that passed the quality control were used for marker detection. The PCR system was assembled using NEXAR, and the PCR reaction system is shown in Table 3 below: Table 3. KASP reaction system

[0024] PCR amplification was performed using SOELLEX. The conditions for touch down PCR amplification were as follows:

[0025] After the PCR reaction is completed, ARAYA is used to scan the fluorescence signal of the reaction system; then INTELLICS is used for data analysis and genotyping. Figure 3 As shown, the schematic diagram of the classification of CanS900004 is as follows Figure 4 shown. Example 3

[0026] For 348 cannabis materials with 2 and 3 leaves in the cotyledons, the KASP primer kit designed for CanS900003 and CanS900004 in Example 2 was used to perform genotype detection on the 348 materials. The test results showed that the genotypes detected by these two markers in the 348 materials were consistent with the corresponding cannabis cotyledon types, such as Figure 5 , 6 As shown, the use of these two markers for separate and combined detection can significantly distinguish between 2-cotyledon industrial hemp and 3-cotyledon industrial hemp. When the KASP marker CanS900003 is the AA genotype, the number of cotyledons is more than that of the GG genotype. When the marker CanS900004 is the CC genotype, the number of cotyledons is more than that of the AA genotype. Figure 7 As shown, when the markers CanS900003 and CanS900004 were used for simultaneous screening, the cannabis with the genotype of markers CanS900003 being AA and CanS900004 being CC (AC for short) was mostly three-cotyledon cannabis; conversely, the cannabis with the genotype of markers CanS900003 being GG and CanS900004 being AA (GA for short) was mostly two-cotyledon cannabis, and the difference reached an extremely significant level.

[0027] In summary, the present invention has excavated the SNP molecular marker sites related to the number of hemp cotyledons and developed the KASP molecular marker to assist in the improvement of industrial hemp cotyledon traits, which can avoid the complicated and time-consuming screening process, shorten the breeding period, and improve the efficiency of hemp molecular breeding. Although the present invention has been described in detail above with general descriptions and specific implementation schemes, it is obvious to those skilled in the art that some modifications or improvements can be made to it on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed in the present invention.

Claims

1. KASP molecular marker associated with the number of cotyledons of industrial hemp, characterized in that: The molecular markers are located on chromosome 9 of cannabis, namely CanS900003 and / or CanS900004; the sequence of CanS900003 is shown in SEQ ID NO.1, and 201 bp from the 5' end presents a G / A polymorphism; the sequence of CanS900004 is shown in SEQ ID NO.2, and 201 bp from the 5' end presents an A / C polymorphism.

2. A primer for amplifying the molecular marker according to claim 1, characterized in that: The primers for amplifying the CanS900003 molecular marker are shown in SEQ ID NOs. 3 to 5; the primers for amplifying the CanS900004 molecular marker are shown in SEQ ID NOs. 6 to 8.

3. A kit, characterized in that: The kit contains primers for amplifying the molecular marker according to claim 1.

4. Use of the molecular marker described in claim 1, or the primer described in claim 2, or the kit described in claim 3 in molecular marker-assisted breeding of industrial hemp.

5. Use of the molecular marker described in claim 1, or the primer described in claim 2, or the kit described in claim 3 in distinguishing between 2-cotyledon and 3-cotyledon industrial hemp varieties.

6. The use according to claim 5, characterized in that: When the KASP marker detection result shows that CanS900003 is haplotype AA at 201bp from the 5' end and CanS900004 is haplotype CC, the industrial hemp to be tested is tri-cotyledon industrial hemp; when the KASP marker detection result shows that CanS900003 is haplotype GG at 201bp from the 5' end and CanS900004 is haplotype AA, the industrial hemp is di-cotyledon industrial hemp.

7. A method for breeding tricotyledonous industrial hemp using the molecular markers of claim 1, characterized in that: The following steps are involved: (1) obtaining genomic DNA of a sample to be tested; (2) Using genomic DNA as a template, competitive allele-specific PCR amplification; (3) After the PCR reaction is completed, the fluorescent signal generated by each reaction well is collected, and the genotype of the molecular marker is determined according to the type of the fluorescent signal. When the KASP marker detection result shows that CanS900003 is haplotype AA at 201 bp from the 5' end, and CanS900004 is haplotype CC, the sample to be tested is tricotyledonous industrial hemp.

Images