Directed evolution method based on error-prone DNA synthesis and application thereof

Abstract

The invention discloses a directed evolution method based on error-prone DNA synthesis and application of the directed evolution method. The invention provides a method for constructing a mutant library of nucleic acid molecules, which is used for constructing the mutant library through in-vitro synthesis of the nucleic acid molecules, and is characterized in that non-optimal conditions are adopted during in-vitro synthesis of the nucleic acid molecules so as to introduce mutation. The invention also provides a method for performing irrational directed evolution by taking nucleic acid molecules as objects. The method comprises the following steps: (1) constructing a DNA mutant library according to the method; and (2) screening mutants according to a directed evolution target, and sequencing. The method provided by the invention has the advantages of convenience and flexibility in application, abundant mutation types, adjustable mutation rate, low template pollution, high randomness and the like, and a new method is provided for directed evolution.

Description

Technical Field

[0001] The present invention belongs to the field of metabolic engineering and synthetic biology, and specifically relates to an irrational directed evolution method, and more specifically relates to a directed evolution method based on error-prone DNA synthesis and its application. Background Art

[0002] Metabolic engineering and synthetic biology represent a new phase in the development of modern biotechnology, providing new approaches and strong support for addressing major challenges facing sustainable human development, such as energy shortages, environmental pollution, food safety, and public health. Metabolic engineering and synthetic biology contribute to the development of human society by understanding, designing, modifying, and synthesizing biological systems or systems at various scales, including biomolecules, complexes, cells, and bacterial communities, to achieve specific production or application goals.

[0003] Directed evolution is a non-rational approach to genetically modifying target biomolecules or systems. It can achieve research objectives more quickly even with limited or no prior knowledge of the biomolecule or system. It is an important and commonly used research technique in metabolic engineering and synthetic biotechnology. Directed evolution is often used to improve enzyme performance, including activity, reaction selectivity, and environmental tolerance. It can also be combined with rational design-based protein modification methods. Effective directed evolution involves three key steps: generating a genetically diverse mutant library, developing an effective expression system, and implementing efficient screening and analysis methods. The generation of a genetically diverse mutant library is the most critical step in determining the success of directed evolution.

[0004] DNA synthesis is a key technology supporting metabolic engineering and synthetic biotechnology research. It can be categorized by technical approach, including chemical and enzymatic methods. Chemical DNA synthesis services have been commercially available for nearly four decades and are currently the most widely used commercial synthesis method. The high accuracy and yield required for commercial chemical DNA synthesis necessitate the synthesis reaction to be performed under strictly controlled environmental conditions, including a relatively stable indoor environment with stable temperature and humidity. Furthermore, the quality of the base monomers is highly demanding. Summary of the Invention

[0005] The purpose of the present invention is to provide a directed evolution method based on error-prone DNA synthesis and its application.

[0006] The present invention provides a method for constructing a mutant library of nucleic acid molecules, which is to construct the mutant library by synthesizing nucleic acid molecules in vitro, and is characterized in that non-optimal conditions are used during the in vitro synthesis of nucleic acid molecules to introduce mutations.

[0007] The present invention also provides a method for performing irrational directed evolution using nucleic acid molecules as objects, comprising the following steps:

[0008] (1) constructing a DNA mutant library according to the aforementioned method;

[0009] (2) Screen mutants based on the goals of directed evolution and sequence them.

[0010] The nucleic acid molecule can be a DNA molecule or an RNA molecule.

[0011] The in vitro synthesis of nucleic acid molecules adopts chemical method or enzymatic method.

[0012] The non-optimal conditions include, but are not limited to: using a non-stringent nucleic acid synthesis solvent and / or adjusting the reaction program settings of the nucleic acid synthesizer and / or replacing the dNTP monomer solution with a Mix dNTP solution.

[0013] The nucleic acid may be DNA or RNA.

[0014] The non-rigorous nucleic acid synthesis solvent refers to: nucleic acid synthesis solvent after opening, nucleic acid synthesis solvent within 2 months of the expiration date, and nucleic acid synthesis solvent within 2 months of the expiration date.

[0015] The non-rigorous nucleic acid synthesis solvent refers to a nucleic acid synthesis solvent with excessive water content.

[0016] The non-rigorous nucleic acid synthesis solvent refers to a nucleic acid synthesis solvent whose water content increases due to unsealed storage.

[0017] The non-rigorous nucleic acid synthesis solvent refers to a nucleic acid synthesis solvent with a water content of 20ppm-900ppm.

[0018] Exemplarily, the non-rigorous nucleic acid synthesis solvent refers to a nucleic acid synthesis solvent having a water content of 50 ppm-500 ppm.

[0019] Exemplarily, the non-strict nucleic acid synthesis solvent refers to a nucleic acid synthesis solvent having a water content of 100 ppm to 400 ppm.

[0020] Exemplarily, the non-strict nucleic acid synthesis solvent refers to a nucleic acid synthesis solvent having a water content of 100 ppm to 300 ppm.

[0021] The nucleic acid synthesis solvent is an organic solvent.

[0022] During nucleic acid synthesis, nucleic acid synthesis solvents are used to dissolve dNTP monomers and for washing steps.

[0023] A common solvent for nucleic acid synthesis is acetonitrile.

[0024] Typically, the quality control index for the water content of commercially available nucleic acid synthesis solvents is below 20 ppm or below 10 ppm.

[0025] When nucleic acid synthesis solvents are opened and stored, the moisture content will usually increase due to absorption of moisture from the air.

[0026] For high-fidelity in vitro nucleic acid synthesis, it is usually necessary to use freshly opened nucleic acid synthesis solvents, and unused solvents after opening are wasted a lot of money. In the present invention, freshly opened solvents can be used to save reagent costs.

[0027] In vitro synthesis of nucleic acid molecules is carried out in a nucleic acid synthesizer.

[0028] Depending on the model of the nucleic acid synthesizer, single-channel in vitro synthesis of nucleic acid molecules can be performed, or multi-channel in vitro synthesis of nucleic acid molecules can be performed.

[0029] For example, DNA molecules can be synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0030] Exemplarily, the non-optimal condition may be: P1, P2, P3, P4 or P5.

[0031] Exemplarily, the non-optimal condition may be a combination of any two, three, or four of P1, P2, P3, P4, and P5.

[0032] Exemplarily, the non-optimal conditions may be: P1, P2, P3, P4 and P5.

[0033] Based on the research idea of ​​performing DNA synthesis under non-optimal conditions, those skilled in the art can perform DNA synthesis by analogy and enumeration of a series of other non-optimal conditions, including but not limited to using dNTP monomer solutions with different ratios, adjusting the reaction procedure, solvents, etc.

[0034] P1: Adjust the duration of the coupling reaction step in the synthesis program to 50% of the default setting value.

[0035] P2: Adjust the duration of the coupling reaction step in the synthesis program to 75% of the default setting value.

[0036] P3: Use a DNA synthesis solvent with a water content of 20ppm-900ppm.

[0037] P4: Omit the washing operation (Hi Drain) after the coupling reaction (Couple reaction).

[0038] P5: Replace the four dNTP monomer solutions with the four Mix dNTP solutions.

[0039] Four dNTP monomer solutions, namely, dATP monomer solution, dTTP monomer solution, dCTP monomer solution, and dGTP monomer solution. The four dNTP monomer solutions are obtained by dissolving the four dNTP monomers in a DNA synthesis solvent. Exemplarily, the dNTP monomer concentration is 26-30 mmol / L.

[0040] Four Mix dNTP solutions, namely Mix dATP solution, Mix dTTP solution, Mix dCTP solution, and Mix dGTP solution.

[0041] Mixed dATP solution: Consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and a DNA synthesis solvent. The primary active ingredient in the mixed dATP solution is dATP monomer, along with small amounts of dTTP monomer, dCTP monomer, and dGTP monomer. Based on the desired mutation rate, those skilled in the art can determine the appropriate concentration and ratio of each monomer. For example, the molar ratio of dATP monomer, dTTP monomer, dCTP monomer, and dGTP monomer can be 1:0.001-0.01:0.001-0.01:0.001-0.01, respectively. For example, the molar ratio of dATP monomer, dTTP monomer, dCTP monomer, and dGTP monomer can be 1:0.003-0.004:0.003-0.004:0.003-0.004, respectively. Illustratively, the concentration of dATP monomer is 25.7 mmol / L, the concentration of dTTP monomer is 0.1 mmol / L, the concentration of dCTP monomer is 0.1 mmol / L, and the concentration of dGTP monomer is 0.1 mmol / L.

[0042] Mix dTTP Solution: Consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and a DNA synthesis solvent. The primary active ingredient in Mix dTTP Solution is dTTP monomer, along with small amounts of dATP monomer, dCTP monomer, and dGTP monomer. Based on the desired mutation rate, those skilled in the art can determine the appropriate concentration and ratio of each monomer. For example, the molar ratio of dTTP monomer, dATP monomer, dCTP monomer, and dGTP monomer can be 1:0.001-0.01:0.001-0.01:0.001-0.01, respectively. For example, the molar ratio of dTTP monomer, dATP monomer, dCTP monomer, and dGTP monomer can be 1:0.003-0.004:0.003-0.04:0.003-0.004, respectively. For example, the concentration of dTTP is 29.7 mmol / L, the concentration of dATP is 0.1 mmol / L, the concentration of dCTP is 0.1 mmol / L, and the concentration of dGTP is 0.1 mmol / L.

[0043] Mix dCTP Solution: Consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and a DNA synthesis solvent. The Mix dCTP Solution provides dCTP monomer as the primary active ingredient, along with small amounts of dATP monomer, dTTP monomer, and dGTP monomer. Based on the desired mutation rate, those skilled in the art can determine the appropriate concentration and ratio of each monomer. For example, the molar ratio of dCTP monomer, dATP monomer, dTTP monomer, and dGTP monomer can be 1:0.001-0.01:0.001-0.01:0.001-0.01, respectively. For example, the molar ratio of dCTP monomer, dATP monomer, dTTP monomer, and dGTP monomer can be 1:0.003-0.004:0.003-0.004:0.003-0.004, respectively. For example, the concentration of dCTP is 28.7 mmol / L, the concentration of dATP is 0.1 mmol / L, the concentration of dTTP is 0.1 mmol / L, and the concentration of dGTP is 0.1 mmol / L.

[0044] Mix dGTP Solution: Consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and DNA synthesis solvent. The Mix dGTP Solution provides dGTP monomer as the primary active ingredient, along with small amounts of dATP monomer, dTTP monomer, and dCTP monomer. Based on the desired mutation rate, those skilled in the art can determine the appropriate concentration and ratio of each monomer. For example, the molar ratio of dGTP monomer, dATP monomer, dTTP monomer, and dCTP monomer can be 1:0.001-0.01:0.001-0.01:0.001-0.01, respectively. For example, the molar ratio of dGTP monomer, dATP monomer, dTTP monomer, and dCTP monomer can be 1:0.003-0.004:0.003-0.004:0.003-0.004, respectively. For example, the concentration of dGTP is 26.7 mmol / L, the concentration of dATP is 0.1 mmol / L, the concentration of dTTP is 0.1 mmol / L, and the concentration of dCTP is 0.1 mmol / L.

[0045] Exemplarily, P3 may specifically be: using a DNA synthesis solvent with a water content of 50 ppm-500 ppm.

[0046] Exemplarily, P3 may specifically be: using a DNA synthesis solvent with a water content of 100 ppm-400 ppm.

[0047] Exemplarily, P3 may specifically be: using a DNA synthesis solvent with a water content of 100 ppm to 300 ppm.

[0048] For example, RNA molecules can be synthesized in vitro using a DNA / RNA synthesizer.

[0049] Exemplarily, the non-optimal conditions are substantially the same as those for synthesizing DNA molecules in vitro, with the only difference being that ATP monomers are used instead of dATP monomers, CTP monomers are used instead of dCTP monomers, GTP monomers are used instead of dGTP monomers, and UTP monomers are used instead of dTTP monomers.

[0050] The present invention also protects the use of any of the above methods, which is as follows (a) and / or (b) and / or (c)

[0051] (a) Directed evolution of proteins (protein-coding genes);

[0052] (b) Directed evolution of gene expression regulatory elements;

[0053] (c) Directed evolution of multigenic genetic circuits.

[0054] The present invention also protects the use of any of the above methods in the directed modification of microorganisms.

[0055] The present invention also protects the use of any of the above methods in combination with other methods in the targeted modification of microorganisms.

[0056] The other method is in vivo evolution of microorganisms.

[0057] Exemplarily, the in vivo evolution of the microorganism is an adaptive laboratory evolution.

[0058] Directed evolution is a non-rational approach in metabolic engineering and synthetic biotechnology to modify the structure and function of macromolecules such as nucleic acids and proteins. It can be used alone or in combination with rational design methods to modify the structure and function of target macromolecules or complexes. For example, it is often used to optimize the catalytic function of enzymes and proteins, enhance antibody affinity, and modify the structure of protein-nucleic acid complexes. The first key step in the successful application of directed evolution is the generation of a genetically diverse mutant library. Commonly used methods include error-prone polymerase chain reaction (epPCR) and DNA shuffling. While these methods meet the requirements of directed evolution to some extent, they still suffer from drawbacks such as susceptibility to template contamination, low randomness, and poor controllability of mutation rates. The basic principle of epPCR is to increase the random base mispairing rate by modifying the PCR reaction conditions or using a low-fidelity DNA polymerase, thereby generating multiple point mutations and generating a diverse mutant library. Mutations are introduced during amplification. However, limitations include the base preference of the polymerase (usually AG > TC), low mutation efficiency, and a lack of subsequent mutations (e.g., only 3-5 mutations per gene per round). DNA shuffling uses DNase to cut a set of homologous genes with sense mutations into random fragments (usually 10-50 bp). PCR is then used to extend and recombine these fragments to obtain the full-length gene, introducing mutations through recombination. However, a limitation of DNA shuffling is that it requires at least 70% identity between gene sequences. Therefore, existing methods still suffer from limitations such as a limited number of base mutation types, some bias, high background contamination, and low overall randomness. The development of new methods to generate rich and genetically diverse mutant libraries has become a key driver for the further development of directed evolution technology.

[0059] Through research, the inventors discovered that when environmental control requirements are lower, the accuracy of DNA synthesis decreases and the base error rate increases, which is unfavorable for commercial custom DNA synthesis, which aims for high accuracy. Through reverse thinking, the inventors realized that these unfavorable factors for commercial custom DNA synthesis could be exploited to introduce base errors generated by DNA synthesis into the construction of genetically diverse mutant libraries, which could be further used for directed evolution. Furthermore, by studying the base mutation characteristics generated under various non-optimal synthesis conditions, the present invention developed a new method for generating rich genetic diversity libraries based on error-prone DNA synthesis, proposed and developed a directed evolution method based on error-prone DNA synthesis, and further explored and demonstrated its related applications.

[0060] The present invention can be used for nucleic acid synthesis or synthesis of nucleic acid modifications.

[0061] The present invention aims to overcome the shortcomings of the prior art by providing a novel directed evolution method suitable for the directed evolution of biological systems or systems, including but not limited to biomacromolecules such as DNA, RNA, and proteins, nucleic acid-protein complexes, protein-protein complexes, and even cells. The present invention provides a directed evolution method based on error-prone DNA synthesis, which offers advantages such as ease and flexibility, rich mutation types, controllable mutation rates, low template contamination, and high randomness, providing a new technical approach for directed evolution. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 These are the results of the relative fluorescence intensity values ​​in Example 2, Example 3, and Example 4.

[0063] Figure 2 Schematic diagram of the gene circuit of the P6 vector.

[0064] Figure 3 Schematic diagram of the elements of the P6 vector.

[0065] Figure 4 This is the result of the relative fluorescence intensity value in Example 5.

[0066] Figure 5 Schematic diagram of the gene circuit of P3M vector and P4M vector.

[0067] Figure 6 Schematic diagram of the elements of the P3M vector.

[0068] Figure 7 This is the result of the relative fluorescence intensity value in Example 6.

[0069] Figure 8 Schematic diagram of the gene circuit in Example 7.

[0070] Figure 9 This is the result of the relative fluorescence intensity value in Example 7.

[0071] Figure 10 Schematic diagram of the elements of the p15C-M1-37-Kan plasmid.

[0072] Figure 11 is the bacterial concentration (OD 600nm ) results. DETAILED DESCRIPTION

[0073] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0074] Unless otherwise specified, the experimental methods in the following examples are all conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged. All primers are single-stranded DNA molecules. ppm stands for parts per million (volume ratio). Dr. oligo192 DNA synthesizer, Biolytic China. pEasy-Blunt zero cloning vector (DNA concentration of 10 ng / μL) and Trans1-T1 competent cells are components of the kit with catalog number CB501-01 from Beijing Quanshijin Biotechnology Co., Ltd. Trans5α competent cells: Beijing Quanshijin Biotechnology Co., Ltd., product catalog number CD201-01. Trans BL21 (DE3) competent cells: Beijing Quanshijin Biotechnology Co., Ltd., product catalog number CD601-02. The dNTP solution used in PCR, namely the dNTP mix (10 mM each, dATP, dTTP, dCTP, and dGTP), was provided by Thermo Fisher Scientific (China) Co., Ltd., catalog number R0194. Q5 DNA polymerase and 5× Q5 DNA polymerase reaction buffer were provided by New England Biotechnology (Beijing) Co., Ltd., catalog number M0491S. 6× DNA loading buffer was provided by Thermo Fisher Scientific (China) Co., Ltd., catalog number R1151. DNA-binding chromogenic dye was provided by Beijing Solebo Technology Co., Ltd., catalog number G5560. DNA recovery kit was provided by Sangon Biotech (Shanghai) Co., Ltd., catalog number B511139. DNA seamless cloning reagent was provided by Beijing Biomed Gene Technology Co., Ltd., catalog number CL116-01.

[0075] Example 1. Establishment of the method

[0076] The present invention establishes a method for constructing a mutant library of DNA molecules. This method utilizes in vitro DNA synthesis to construct a mutant library, characterized by employing suboptimal conditions during in vitro DNA synthesis to introduce mutations. This method creatively replaces the high-fidelity conditions of in vitro DNA synthesis with suboptimal conditions to introduce mutations. This allows the mutations generated by in vitro DNA synthesis to be used, for the first time, to construct a mutant library, which can then be used for non-rational directed evolution. The target of directed evolution is a DNA molecule, which can be a gene encoding a functional protein or functional DNA (e.g., a promoter, riboswitch, etc.).

[0077] Specifically, the present invention uses a DNA synthesizer to synthesize DNA in vitro using a chemical method.

[0078] An exemplary method is as follows:

[0079] 1. Obtain the nucleotide sequence of the DNA molecule being targeted for directed evolution, i.e., the original sequence, from a database (e.g., NCBI) or reference literature. If necessary, codon-optimize the original sequence for the host cell to produce an artificial sequence. Based on the target sequence (original or artificial), design N oligonucleotide single-stranded DNA sequences (N is a natural number greater than 2) for full-length synthesis of the target sequence. When the target sequence is less than 120 bp, N = 2, i.e., one oligonucleotide single-stranded DNA sequence is the positive strand of the target sequence, and the other oligonucleotide single-stranded DNA sequence is the negative strand of the target sequence. When the target sequence is ≥120 bp, N > 2, and the N oligonucleotide single-stranded DNA sequences correspond to the positive strand or negative strand of the target sequence, respectively, and overlap to cover the full-length target sequence through end-to-end overlap (designing N oligonucleotide single-stranded DNA sequences based on the target sequence can be performed using existing analysis software; software generally recommends an oligonucleotide single-stranded DNA sequence length of 50-69 nt, with the overlap region of adjacent oligonucleotide single-stranded DNA sequences being 25%-35% of the oligonucleotide single-stranded DNA sequence length).

[0080] 2. Input the sequence information of N oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0081] DNA was synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0082] Non-optimal conditions are used during DNA synthesis; the non-optimal conditions may be: P1, P2, P3, P4 or P5; the non-optimal conditions may also be: a combination of any two, three or four of P1, P2, P3, P4 and P5; the non-optimal conditions may also be: P1, P2, P3, P4 and P5; based on the research idea of ​​performing DNA synthesis under non-optimal conditions, those skilled in the art can perform DNA synthesis by analogy and enumeration of a series of other non-optimal conditions, including but not limited to using dNTP monomer solutions with different ratios, adjusting the reaction procedure, solvents, etc.

[0083] Aside from the suboptimal conditions mentioned above, all other settings and parameters remained unchanged, following the standard operating procedures in the DNA synthesizer's instructions. After synthesis, the products were deprotected, eluted, and absorbance measured. The products were then aliquoted into 1.5 mL EP tubes and dried by vacuum centrifugation for later use.

[0084] N oligonucleotide single-stranded DNA sequences are simultaneously synthesized in vitro using N channels, and one tube of synthesis product is obtained for each oligonucleotide single-stranded DNA sequence, for a total of N tubes of synthesis products.

[0085] P1: Adjust the duration of the coupling reaction step in the synthesis program to 50% of the default setting value.

[0086] P2: Adjust the duration of the coupling reaction step in the synthesis program to 75% of the default setting value.

[0087] P3: Use a DNA synthesis solvent with a water content of 20ppm-900ppm.

[0088] P4: Omit the washing operation (Hi Drain) after the coupling reaction (Couple reaction).

[0089] P5: Replace the four dNTP monomer solutions with the four Mix dNTP solutions.

[0090] The DNA synthesis solvent was used to prepare four dNTP monomer solutions and four mixed dNTP solutions. The DNA synthesis solvent used in the subsequent examples was a commercially available DNA synthesis solvent (product information: acetonitrile, water content ≤10 ppm; Hebei Dina Xingke Biotechnology Co., Ltd., catalog number R1012-4). After opening, the solvent was sealed and stored in a dark, cool place for 2-4 weeks. The water content was determined to be 20 ppm to 900 ppm.

[0091] Four dNTP monomers, namely dATP monomer (powder), dTTP monomer (powder), dCTP monomer (powder) and dGTP monomer (powder), were purchased from Sigmaaldrich Company, USA, with product catalog numbers of A111000-6X10G, T111000-6X10G, C111040-6X10G and G111000-6X10G, respectively.

[0092] Four dNTP monomer solutions, namely dATP monomer solution, dTTP monomer solution, dCTP monomer solution and dGTP monomer solution, are obtained by dissolving the four dNTP monomers in DNA synthesis solvent respectively, and the concentration of each is about 30 mmol / L (prepared before use).

[0093] Four Mix dNTP solutions are available: Mix dATP solution, Mix dTTP solution, Mix dCTP solution, and Mix dGTP solution. Mix dATP solution: consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and a DNA synthesis solvent; the concentration of dATP monomer is 25.7 mmol / L, the concentration of dTTP monomer is 0.1 mmol / L, the concentration of dCTP monomer is 0.1 mmol / L, and the concentration of dGTP monomer is 0.1 mmol / L. Mix dTTP solution: consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and a DNA synthesis solvent; the concentration of dTTP is 29.7 mmol / L, the concentration of dATP is 0.1 mmol / L, the concentration of dCTP is 0.1 mmol / L, and the concentration of dGTP is 0.1 mmol / L. Mix dCTP Solution: Consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and DNA synthesis solvent. The concentrations of dCTP are 28.7 mmol / L, dATP are 0.1 mmol / L, dTTP are 0.1 mmol / L, and dGTP are 0.1 mmol / L. Mix dGTP Solution: Consists of dATP monomer, dTTP monomer, dCTP monomer, dGTP monomer, and DNA synthesis solvent. The concentrations of dGTP are 26.7 mmol / L, dATP are 0.1 mmol / L, dTTP are 0.1 mmol / L, and dCTP are 0.1 mmol / L. Prepare all solutions immediately before use.

[0094] 3. When the object of directed evolution is a gene encoding a functional protein, the synthetic product of step 2 is subjected to step 3.

[0095] The N-tube synthesis products are subjected to fusion PCR. The target fragment (i.e., a DNA fragment of the same size as the target sequence, the same below) is then recovered by electrophoresis and cloned into an expression vector. This yields a variety of recombinant expression vectors containing the target fragment in various sequence forms, forming a mutant library. The mutant library is then introduced into an expression system (which can be a cellular expression system, i.e., a host cell, or a cell-free expression system). Mutants are screened based on the target of directed evolution, and relevant sequence information is obtained for the mutants, ultimately achieving the goal of directed evolution.

[0096] 4. When the object of directed evolution is functional DNA, the synthetic product of step 2 is subjected to step 4.

[0097] 1. Prepare mutant library using N-tube synthesis products.

[0098] The mutant library is a variety of recombinant expression vectors containing target fragments in various sequence forms. In the recombinant expression vectors, the target fragments serve as regulatory elements of the marker protein encoding gene.

[0099] The mutant library can be prepared by inserting the target fragment obtained by annealing and / or fusion PCR of the N-tube synthesis products into an expression vector to obtain the mutant library. Alternatively, the mutant library can be prepared by ligating the target fragment obtained by annealing and / or fusion PCR of the N-tube synthesis products with a marker protein encoding gene, and then inserting the resultant fragment into an expression vector to obtain the mutant library.

[0100] 2. Introduce the mutant library into an expression system (the expression system can be a cell expression system, i.e., a host cell; the expression system can also be a cell-free expression system), screen the mutants according to the goal of directed evolution, obtain relevant sequence information of the mutants, and ultimately achieve the purpose of directed evolution.

[0101] Example 2: Phenotypic transformation of green fluorescent protein (EmGFP) using the method of the present invention

[0102] In this embodiment, the DNA molecule used as the target of directed evolution is the EmGFP gene.

[0103] 1. Obtaining the target gene sequence and designing gene synthesis primers

[0104] 1. Obtain the nucleotide sequence of the EmGFP gene from the NCBI database (NCBI sequence number: AB758275.1), which is the original sequence.

[0105] 2. The original sequence was codon-optimized for E. coli to obtain an artificial sequence (as shown in SEQ ID NO: 1, 720 bp).

[0106] 3. Based on the artificial sequence, 18 oligonucleotide single-stranded DNA sequences were designed. The 18 oligonucleotide single-stranded DNA sequences correspond to SEQ ID Positions 1-59 (positive chain), 42-100 (reverse chain), 78-136 (positive chain), 119-177 (reverse chain), 164-222 (positive chain), 205-263 (reverse chain), 244-302 (positive chain), 283-341 (reverse chain), 321-379 (positive chain), 360-418 (reverse chain), 402-460 (positive chain), 438-496 (reverse chain), 472-530 (positive chain), 513-571 (reverse chain), 558-616 (positive chain), 599-657 (reverse chain), 639-697 (positive chain), 682-720 (reverse chain) in NO:1.

[0107] 2. Input the sequence information of 18 oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0108] DNA was synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0109] The non-optimal conditions used during DNA synthesis were P3 (described in step 2 of Example 1, where the water content of the DNA synthesis solvent was 100 ppm-300 ppm).

[0110] Aside from the suboptimal conditions mentioned above, all other settings and parameters remained unchanged, following the standard operating procedures in the DNA synthesizer's instructions. After synthesis, the products were deprotected, eluted, and absorbance measured. The products were then aliquoted into 1.5 mL EP tubes and dried by vacuum centrifugation for later use. 18 single-stranded oligonucleotide sequences were synthesized simultaneously in vitro using 18 channels, yielding one tube of product for each sequence, for a total of 18 tubes.

[0111] Third, perform fusion PCR on the 18 tubes of synthesized products. Then, recover the target fragments by electrophoresis and clone them into expression vectors. This yields a variety of recombinant expression vectors containing target fragments in various sequence forms, which form the mutant library. The mutant library is then introduced into the expression system and evaluated.

[0112] 1. Fusion PCR

[0113] Fusion PCR reaction system: 1 μL of each of the 18 synthetic product solutions, 10 μL of 5×Q5 DNA polymerase reaction buffer, 2 μL of dNTPs solution, 1 μL of Q5 DNA polymerase, and the volume was made up to 50 μL with ultrapure water.

[0114] Synthetic product solution: The synthetic product prepared in step 2 (5 nmol, based on the molecular weight of the artificial sequence) was dissolved in 500 μL of ultrapure water to obtain a synthetic product solution.

[0115] The reaction process consists of two stages in sequence;

[0116] The first stage reaction procedure was: 98°C for 2 min; 98°C for 30 sec, annealing for 30 sec (the annealing temperature of the first cycle was 67°C, and each cycle was lowered by 1°C than the previous cycle), 72°C for 30 sec, for 8 cycles.

[0117] The second stage reaction procedure: 98°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 25 cycles; 72°C for 5 min.

[0118] 2. Recover target fragments by electrophoresis

[0119] Add 10 μL of 6× DNA loading buffer to the system completed in step 1 and mix well. Load the entire sample onto a 1.0% agarose gel containing 0.01% (volume ratio) DNA-binding color dye for electrophoresis. Observe and cut the target band using a gel image analyzer. Use a DNA recovery kit to recover the target fragment to obtain a DNA solution.

[0120] 3. Pipette 2 μL of the DNA solution obtained in step 2 (DNA concentration is 50 ng / μL), mix it with 1 μL of pEasy-Blunt zeroCloning Vector, react at room temperature for 10 minutes, and then transform all of it into 50 μL of Trans1-T1 competent cells thawed on ice. Place it on ice for 30 minutes, then heat shock at 42°C for 90 seconds, and then place it on ice for another 10 minutes. Then add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm with shaking for 1 hour, and then centrifuge at 6000 rpm for 3 minutes. Discard 600 μL of supernatant, resuspend the remaining portion, and spread it on LB solid medium plates containing 50 μg / L carbenicillin. Culture at 37°C until monoclonal colonies grow.

[0121] 4. After completing step 3, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid medium containing 50 μg / L carbenicillin and 1 mM IPTG to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0122] 5. After completing step 4, take a 96-well plate with a clear bottom and black wall, add 50 μL of the bacterial solution obtained in step 4 and 150 μL of LB liquid medium to each well, and then measure the cell concentration (OD 600nm ) and green fluorescence intensity (Ex: 488nm, Em: 512nm), and the relative fluorescence intensity value of each monoclonal well was obtained by normalizing the bacterial cell amount. Figure 1 a.

[0123] 6. After completing step 4, the cells were collected and the plasmid was extracted and sequenced to obtain the nucleotide sequence of the target region. The mutation rate of the single clone was 31%.

[0124] The desired target monoclonal clone can be further screened for subsequent work based on the research purpose.

[0125] Example 3: Phenotypic modification of red fluorescent protein (mCherry) using the method of the present invention

[0126] In this embodiment, the DNA molecule used as the target of directed evolution is the mCherry gene.

[0127] 1. Obtaining the target gene sequence and designing gene synthesis primers

[0128] 1. The nucleotide sequence of the mCherry gene was obtained from the NCBI database, which is the original sequence (as shown in SEQ ID NO: 2, 711 bp).

[0129] 2. Based on the original sequence, 18 oligonucleotide single-stranded DNA sequences were designed. The 18 oligonucleotide single-stranded DNA sequences correspond to positions 1-59 (forward strand), 34-92 (reverse strand), 75-133 (forward strand), 119-177 (reverse strand), 162-220 (forward strand), 200-258 (reverse strand), 243-301 (forward strand), 284-342 (reverse strand), 325-383 (forward strand), 360-418 (reverse strand), 405-463 (forward strand), 448-506 (reverse strand), 489-547 (forward strand), 528-586 (reverse strand), 572-630 (forward strand), 610-668 (reverse strand), 649-707 (forward strand), and 687-711 (reverse strand) in SEQ ID NO: 2, respectively.

[0130] 2. Input the sequence information of 18 oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0131] Same as step 2 of Example 2.

[0132] Third, perform fusion PCR on the 18 tubes of synthesized products. Then, recover the target fragments by electrophoresis and clone them into expression vectors. This yields a variety of recombinant expression vectors containing target fragments of varying sequences, representing the mutant library. The mutant library is then introduced into the expression system and evaluated.

[0133] 1. Same as step 1 of step 3 in Example 2.

[0134] 2. Same as step 2 of step 3 in Example 2.

[0135] 3. Same as step 3 of Example 2.

[0136] 4. Same as step 4 of step 3 in Example 2.

[0137] 5. After completing step 4, take a 96-well plate with a clear bottom and black wall, add 50 μL of the bacterial solution obtained in step 4 and 150 μL of LB liquid medium to each well, and then measure the cell concentration (OD 600nm ) and red fluorescence intensity (Ex: 587nm, Em: 610nm), and the relative fluorescence intensity value of each monoclonal clone was obtained by normalizing the bacterial cell amount. The exemplary results of a single experiment are shown in Figure 1 b.

[0138] 6. After completing step 4, the cells were collected and the plasmids were extracted and sequenced to obtain the nucleotide sequence of the target region. The mutation rate of the single clone was 44%.

[0139] The desired target clones can be further screened for subsequent work based on the research purpose.

[0140] Example 4: Phenotypic transformation of yellow fluorescent protein (mBanana) using the method of the present invention

[0141] In this embodiment, the DNA molecule used as the target of directed evolution is the mBanana gene.

[0142] 1. Obtaining the target gene sequence and designing gene synthesis primers

[0143] 1. The nucleotide sequence of the mBanana gene was obtained from the NCBI database, which is the original sequence (as shown in SEQ ID NO: 3, 711 bp).

[0144] 2. Based on the original sequence, 18 oligonucleotide single-stranded DNA sequences were designed. The 18 oligonucleotide single-stranded DNA sequences correspond to positions 1-59 (positive chain), 34-92 (reverse chain), 75-133 (positive chain), 119-177 (reverse chain), 162-220 (positive chain), 201-259 (reverse chain), 241-299 (positive chain), 282-340 (reverse chain), 324-382 (positive chain), 360-418 (reverse chain), 405-463 (positive chain), 448-506 (reverse chain), 484-542 (positive chain), 526-584 (reverse chain), 567-625 (positive chain), 604-662 (reverse chain), 639-697 (positive chain), and 683-711 (reverse chain) in SEQ ID NO.3.

[0145] 2. Input the sequence information of 18 oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0146] Same as step 2 of Example 2.

[0147] Third, perform fusion PCR on the 18 tubes of synthesized products. Then, recover the target fragments by electrophoresis and clone them into expression vectors. This yields a variety of recombinant expression vectors containing target fragments of varying sequences, representing the mutant library. The mutant library is then introduced into the expression system and evaluated.

[0148] 1. Same as step 1 of step 3 in Example 2.

[0149] 2. Same as step 2 of step 3 in Example 2.

[0150] 3. Same as step 3 of Example 2.

[0151] 4. Same as step 4 of step 3 in Example 2.

[0152] 5. After completing step 4, take a 96-well plate with a clear bottom and black wall, add 50 μL of the bacterial solution obtained in step 4 and 150 μL of LB liquid medium to each well, and then measure the cell concentration (OD 600nm ) and yellow fluorescence intensity (Ex: 540nm, Em: 553nm), and the relative fluorescence intensity value of each monoclonal clone was obtained by normalizing the bacterial cell amount. The exemplary results of a single experiment are shown in Figure 1 c.

[0153] 6. After completing step 4, the cells were collected and the plasmid was extracted and sequenced to obtain the nucleotide sequence of the target region. The mutation rate of the single clone was 71%.

[0154] The desired target clones can be further screened for subsequent work based on the research purpose.

[0155] Example 5: Application of the method of the present invention to gene expression regulatory element-P trc Modification of promoter regulatory strength

[0156] In this embodiment, the DNA molecule used as the target of directed evolution is P trc Promoter.

[0157] 1. Obtaining the target gene sequence and designing gene synthesis primers

[0158] Obtain P from the NCBI database trc The nucleotide sequence of the promoter, which is the original sequence (shown in SEQ ID NO: 4, 87 bp), was used to design two oligonucleotide single-stranded DNA sequences (one shown in SEQ ID NO: 4 and the other shown as the reverse complement of SEQ ID NO: 4).

[0159] 2. Input the sequence information of the two oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0160] DNA was synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0161] The non-optimal conditions used for DNA synthesis are P1, P3 and P4 (described in step 2 of Example 1, the water content of the DNA synthesis solvent is 100 ppm-300 ppm).

[0162] Aside from the suboptimal conditions mentioned above, all other settings and parameters remained unchanged, following the standard operating procedures in the DNA synthesizer's instructions. After synthesis, the products were deprotected, eluted, and absorbance measured. The products were then aliquoted into 1.5 mL EP tubes and dried by vacuum centrifugation for later use. Two single-stranded oligonucleotide DNA sequences were synthesized simultaneously in vitro using two channels, yielding one tube of product for each oligonucleotide sequence, for a total of two tubes.

[0163] 3. Add the template plasmid (i.e., the recombinant plasmid obtained by inserting the double-stranded DNA molecule shown in SEQ ID NO: 3 into the pEasy-Blunt zero Cloning Vector), the two synthetic product solutions, primer mBananaBlock-P3, primer P5-R1Up, and primer P5-R1 to the same reaction system and carry out the reaction (fusion PCR and ligation of the fusion PCR amplification product with the annealed products of the two synthetic products are carried out in the same system).

[0164] mBanana Block-P3:ATTTCACACAGGAAACAGaaggagatataccATGGTGAGCAAGGGCGAGGAGAATAACA;

[0165] P5-R1Up:GAGCTGTACAAGTAAataaaacgaaaggctcagtcgaaagactgggcctttcgttttat;

[0166] P5-R1: GAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTataaaacgaaaggcccagtctttcgact.

[0167] Synthetic product solution: The synthetic product prepared in step 2 (5 nmol, based on the molecular weight of the original sequence) was dissolved in 500 μL of ultrapure water to obtain a synthetic product solution.

[0168] Reaction system: 1 μL of template plasmid (50 ng / μL), 2 μL of each of the two synthetic product solutions, 2 μL of each of the three primers, 10 μL of 5×Q5 DNA polymerase reaction buffer, 2 μL of dNTP solution, 1 μL of Q5 DNA polymerase, and add water to 50 μL.

[0169] PCR reaction program: 98°C for 2 min; 98°C for 30 sec, 58°C for 30 sec, 72°C for 45 sec, 30 cycles; 72°C for 5 min.

[0170] 4. Using the P6 vector as a template, a primer pair consisting of primers P5-F2 and P5-R2 was used for PCR amplification to recover the linear vector (6951 bp). The P6 vector is a circular double-stranded DNA molecule, as shown in SEQ ID NO: 5. The functional regions are as follows: EmGFP Ecopt gene (1004-1723), mCherry gene (68-778), P trc Promoter (7576-7662), mBanana gene (6865-7575). The gene circuit diagram of P6 vector is shown in Figure 2 , see the schematic diagram of the components Figure 3 .

[0171] P5-F2: agtcgaaagactgggcctttcgttttatACTTGCCAGCGCCCTAGCGCCCGCTCCTTTC;

[0172] P5-R2: TACGAGCCGGATGATTAATTGTCAACAGGTAGCGGTCACGCTGCGCGTAACCACCACAC.

[0173] 5. Mix 3 μL of the product solution obtained in step 3 (DNA content is 50 ng / μL), 3 μL of the linear vector obtained in step 4 (DNA content is 50 ng / μL) and 5 μL of DNA seamless cloning reagent, react at 50°C for 15 minutes, and then transform into 50 μL of Trans5α competent cells thawed on ice. Place on ice for 30 minutes, then heat shock at 42°C for 90 seconds, and then place on ice for another 10 minutes. Then add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm for 1 hour, and then centrifuge at 6000 rpm for 3 minutes. Discard 600 μl of supernatant, resuspend the remaining part and spread it on LB solid culture medium plate containing 50 μg / L carbenicillin, and culture at 37°C until monoclonal colonies grow.

[0174] 6. After completing step 5, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid culture medium containing 50 μg / L carbenicillin to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0175] 7. After completing step 6, collect the bacteria and extract the plasmid. Sequence the target region to obtain the nucleotide sequence of the inserted target region. The obtained mutant bacteria are frozen and stored for future use.

[0176] 8. The frozen tube of mutant bacteria obtained by sequencing screening in step 7 was streaked and inoculated onto an LB solid culture medium plate containing 50μg / L carbenicillin, and cultured at 37°C until a monoclonal colony grew. Then, a single clone was picked from the plate and inoculated into a 48-well deep-well plate (each well was filled with 3ml of LB liquid culture medium containing 50μg / L carbenicillin and 1mM IPTG inducer), and cultured at 37°C and 250rpm for 12-16h. Two monoclones were inoculated for each mutant. The bacteria in which the P6 vector was introduced into the Trans5α competent cells were set as control bacteria, and two monoclones were inoculated.

[0177] 9. Take a 96-well plate with a clear bottom and black wall, add 50 μL of the bacterial solution obtained in step 8 and 150 μL of LB liquid medium to each well, and then measure the cell concentration (OD 600nm ) and perform fluorescence spectrum scanning (Ex: 488nm, Em: 350-750nm), and obtain the fluorescence spectrum scanning intensity value of each monoclonal clone after normalization of the bacterial amount.

[0178] The exemplary results of relative fluorescence intensity values ​​of some monoclonal clones are shown in Figure 4 . Figure 4 In the figure, E7 and E8 represent control bacteria single clones (two replicates), A7 and A8, B7 and B8, C7 and C8, D7 and D8, F7 and F8, and G7 and G8 are mutant bacteria single clones (two replicates each).

[0179] The above exemplary optimization of the promoter of the mBanana gene can be used to optimize the regulatory elements of the mCherry gene and the regulatory elements of the EmGFP gene in accordance with the above steps to improve the entire gene circuit.

[0180] Example 6: Application of the method of the present invention to modify the regulatory strength of the gene expression regulatory element - Trp riboswitch

[0181] In this example, the DNA molecule used as the target of directed evolution is Trp riboswitch Blc3 or Trp riboswitch Blc4.

[0182] 1. The DNA molecule targeted by directed evolution is the Trp riboswitch Blc3

[0183] 1. Obtaining target gene sequences and designing gene synthesis primers

[0184] The nucleotide sequence of the Trp riboswitch Blc3 was obtained from the NCBI database. This sequence is the original sequence (shown in SEQ ID NO: 6, 128 bp, TrpApt727-N10-RBS-ATG). Based on the original sequence, four oligonucleotide single-stranded DNA sequences were designed. The four oligonucleotide single-stranded DNA sequences correspond to positions 1-32 (positive strand), positions 18-67 (reverse strand), positions 51-100 (positive strand), and positions 84-128 (reverse strand) in SEQ ID NO: 6, respectively.

[0185] 2. Input the sequence information of the four oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0186] DNA was synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0187] The non-optimal conditions used for DNA synthesis are P1, P3 and P4 (described in step 2 of Example 1, the water content of the DNA synthesis solvent is 100 ppm-300 ppm).

[0188] Aside from the suboptimal conditions mentioned above, all other settings and parameters remained unchanged, following the standard operating procedures in the DNA synthesizer's instructions. After synthesis, the products were deprotected, eluted, and absorbance measured. The products were then aliquoted into 1.5 mL EP tubes and dried by vacuum centrifugation for later use. Four single-stranded oligonucleotide sequences were synthesized simultaneously in vitro using four channels, yielding one tube of product for each sequence, for a total of four tubes.

[0189] 3. Mix the four tubes of synthetic products and anneal them.

[0190] Synthetic product solution: The synthetic product prepared in step 2 (5 nmol, based on the molecular weight of the artificial sequence) was dissolved in 500 μL of ultrapure water to obtain a synthetic product solution.

[0191] Annealing reaction system: 10 μL of each of the four synthetic product solutions, supplemented with ultrapure water to 50 μL.

[0192] The annealing reaction procedure was: 98°C for 15 min, then the PCR power was turned off and the reaction mixture was cooled naturally to room temperature.

[0193] 4. Using the P3M vector as a template, perform PCR amplification using the primer pair consisting of primers pG-mC block3-P5 and primers pG-mC block3-R1, and then recover the linear vector (6937 bp). The P3M vector is a circular double-stranded DNA molecule, as shown in SEQ ID NO: 7. Among them, the functional regions are as follows: EmGFP Ecopt gene (1116-1835), Blc3 (776-903), mCherry gene (68-778). The gene circuit diagram of the P3M vector is shown in Figure 5 The left figure of the components is shown in Figure 6 .

[0194] pG-mC block3-P5: cgatTATATGGGATaaggagcatctATGTTGAGCAAGGGCGAGGAGGATAACATGGC;

[0195] pG-mC block3-R1:CGTCGTCCAGccgatagagcttaggatcccCTGTTTCCTGTGTGAAATTGTTATCCGCT.

[0196] 5. Mix 3 μL of the annealed product from step 3 (DNA content is 8 μM), 3 μL of the linear vector obtained in step 4 (DNA content is 50 ng / μL), and 5 μL of DNA seamless cloning reagent. React at 50°C for 15 min, then transform into 50 μL of Trans5α competent cells thawed on ice. Place on ice for 30 min, then heat shock at 42°C for 90 sec, and then place on ice for another 10 min. Then add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm with shaking for 1 h, then centrifuge at 6000 rpm for 3 min, discard 600 μL of supernatant, resuspend the remaining portion, and spread it on an LB solid culture medium plate containing 50 μg / L carbenicillin. Culture at 37°C until monoclonal colonies grow.

[0197] 6. After completing step 5, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid medium containing 50 μg / L carbenicillin to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0198] 7. After completing step 6, collect the bacteria and extract the plasmid. Sequence the target region to obtain the nucleotide sequence of the inserted target region. The obtained mutant plasmid and strain are frozen and stored for future use.

[0199] 8. The mutant plasmid obtained by sequencing screening in step 7 was transformed into Trans BL21 (DE3) competent cells and coated with LB solid culture medium plates containing 50 μg / L carbenicillin, and cultured at 37 ° C until monoclonal colonies grew. Then, single clones were picked from the plates and inoculated into experimental group test tubes and control group test tubes (each with three replicates). Each experimental group test tube was filled with 3 ml of M9 liquid culture medium containing 50 μg / L carbenicillin, 1mM IPTG inducer and 1mM tryptophan. Each control group test tube was filled with 3 ml of M9 liquid culture medium containing 50 μg / L carbenicillin and 1mM IPTG inducer. Then, culture at 37 ° C, 250 rpm and shaking for 12-16 hours.

[0200] 9. Take a 96-well plate with a clear bottom and black wall, add 50 μL of the bacterial solution obtained in step 8 and 150 μL of LB liquid medium to each well, and then measure the cell concentration (OD 600nm ) and fluorescence intensity (Ex: 587 nm, Em: 610 nm), and the relative fluorescence intensity value of each monoclonal clone (the multiple of the experimental group compared with the control group) was obtained by normalizing the bacterial amount.

[0201] Example results are shown in Figure 7 Left picture.

[0202] 2. The DNA molecule targeted for directed evolution is the Trp riboswitch Blc4.

[0203] The only differences from step 1 are steps 1 and 4. Only the differences are described.

[0204] 1. The nucleotide sequence of the Trp riboswitch Blc4 was obtained from the NCBI database. This sequence is the original sequence (shown in SEQ ID NO: 8, 133 bp, TrpApt585-N10-RBS-ATG mut). Based on the original sequence, four single-stranded DNA oligonucleotide sequences were designed. These four single-stranded DNA oligonucleotide sequences correspond to positions 1-46 (positive strand), 27-76 (reverse strand), 55-104 (positive strand), and 88-133 (reverse strand) in SEQ ID NO: 8, respectively.

[0205] 4. Using the P4M vector as a template, perform PCR amplification using the primer pair consisting of primers pG-mC block4-P5 and primers pG-mC block4-R1, and then recover the linear vector. The P4M vector is a circular double-stranded DNA molecule. Compared to the P3M vector, the only difference between the P4M vector and the P3M vector is that the double-stranded DNA molecule shown in SEQ ID NO: 8 replaces the double-stranded DNA molecule shown in SEQ ID NO: 6. The gene circuit diagram of the P4M vector is shown in Figure 5 Right picture.

[0206] pG-mC block4-P5: tcgatGTGTATTTAGaaggagcatctATGTTGAGCAAGGGCGAGGAGGATAACATGGC;

[0207] pG-mC block4-R1: GTCGCCCAAccgatagagcttaggatcccCTGTTTCCTGTGTGAAATTGTTATCCGC.

[0208] Example results are shown in Figure 7 Right picture.

[0209] Example 7: Application of the method of the present invention to phenotypic diversity modification of polygenic genetic circuits (P5, P6)

[0210] 1. Application of the method of the present invention to phenotypic diversity modification of the polygenic genetic circuit P6

[0211] In this step, the DNA molecules used as the target of directed evolution are the EmGFP gene, the mCherry gene, and the mBanana gene.

[0212] (I) Preparation of P6M-R1 mutant library

[0213] 1. Using the P6 vector as a template, PCR amplification was performed using a primer pair consisting of primers P56-V6.0-F2 and P56-V6.0-R6, and then the linear vector (7063 bp) was recovered.

[0214] P56-V6.0-F2:gtatggacgaactgtacaaatagCTCGAGCACCACCACCACCACCACTGAGATCCGGCT;

[0215] P56-V6.0-R6:agttcttcacctttagaaaccatGGATCCGCGACCCATTTGCTGTCCACCAGTCATGCT.

[0216] 2. Take 3 μL of the DNA solution obtained in step 3 of Example 2 (DNA content is 50 ng / μL), 3 μL of the linear vector obtained in step 1 (DNA content is 50 ng / μL) and 5 μL of DNA seamless cloning reagent, react at 50°C for 15 min, and then transform all of them into 50 μL of Trans5α competent cells thawed on ice, place on ice for 30 min, then heat shock at 42°C for 90 sec, and then place on ice for another 10 min, then add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm for 1 h, then centrifuge at 6000 rpm for 3 min, discard 600 μL of supernatant, resuspend the remaining part and apply it to LB solid medium plate containing 50 μg / L carbenicillin, and culture at 37°C until monoclonal colonies grow.

[0217] 3. After completing step 2, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid medium containing 50 μg / L carbenicillin to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0218] 4. After completing step 3, extract the plasmids of all monoclonal cultures and mix them evenly to obtain the P6M-R1 mutant library.

[0219] (2) Preparation of P6M-R13 mutant library.

[0220] 1. Using the P6M-R1 mutant library as a template, PCR amplification was performed using a primer pair consisting of primers P6-V6.0-F6 and P6-V6.0-R4, and then the linear vector (7086 bp) was recovered.

[0221] P6-V6.0-F6: ACCGGCGGCATGGACGAGCTGTACAAGTAAataaaacgaaaggctcagtcgaaagactg;

[0222] P6-V6.0-R4: CATGTTATTCTCCTCGCCCTTGCTCACCATggtatatctccttCTGTTTCCTGTGTGAA.

[0223] 2. Take 3 μL of the DNA solution obtained in step 3 of Example 4 (DNA content is 50 ng / μL), 3 μL of the linear vector obtained in step 1 (DNA content is 50 ng / μL) and 5 μL of DNA seamless cloning reagent, react at 50°C for 15 min, and then transform all of them into 50 μL of Trans5α competent cells thawed on ice, place on ice for 30 min, then heat shock at 42°C for 90 sec, and then place on ice for another 10 min. Then, add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm for 1 h, and then centrifuge at 6000 rpm for 3 min. Discard 600 μL of supernatant, resuspend the remaining part and apply it to LB solid medium plate containing 50 μg / L carbenicillin, and culture at 37°C until monoclonal colonies grow.

[0224] 3. After completing step 2, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid medium containing 50 μg / L carbenicillin to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0225] 4. After completing step 3, extract the plasmids of all monoclonal cultures and mix them evenly to obtain the P6M-R13 mutant library.

[0226] (III) Preparation of P6M6 mutant library

[0227] 1. Using the P6M-R13 mutant library as a template, PCR amplification was performed using a primer pair consisting of primers P56-V6.0-F4 and P56-V6.0-R2, and then the linear vector (7087 bp) was recovered.

[0228] P56-V6.0-F4: ACCGGCGGCATGGACGAGCTGTACAAGTAAataaccccttggggcctctaaacgggtct;

[0229] P56-V6.0-R2: CCATGTTATCCTCCTCCGCCCTTGCTCAACATggtatatctccttCTGTTTCCTGTGTGA.

[0230] 2. Take 3 μL of the DNA solution obtained in step 3 of Example 3 (DNA content is 50 ng / μL), 3 μL of the linear vector obtained in step 1 (DNA content is 50 ng / μL) and 5 μL of DNA seamless cloning reagent, react at 50°C for 15 min, and then transform all of them into 50 μL of Trans5α competent cells thawed on ice, place on ice for 30 min, then heat shock at 42°C for 90 sec, and then place on ice for another 10 min, then add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm for 1 h, then centrifuge at 6000 rpm for 3 min, discard 600 μL of supernatant, resuspend the remaining part and spread it on LB solid medium plate containing 50 μg / L carbenicillin), and culture at 37°C until monoclonal colonies grow.

[0231] 3. After completing step 2, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid medium containing 50 μg / L carbenicillin to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0232] 4. After completing step 3, extract the plasmids of all monoclonal cultures and mix them evenly to obtain the P6M6 mutant library.

[0233] (IV) Take a 96-well plate with a clear bottom and black wall, add 50 μL of the bacterial solution obtained in step (III) 3 and 150 μL of LB liquid medium to each well, and then measure the cell concentration (OD 600nm ) and the fluorescence intensity of the three fluorescent proteins were normalized to the bacterial amount to obtain the relative fluorescence intensity value of each monoclonal clone.

[0234] Genetic circuit Figure 8 The results are shown in the right figure. Figure 9 Right picture.

[0235] 2. Application of the Method of the Present Invention to Phenotypic Diversity Transformation of the Multigene Genetic Circuit P5

[0236] In this step, the DNA molecules used as the target of directed evolution are the EmGFP gene, the mCherry gene, and the SBFP2 gene.

[0237] (I) Preparation of P6M-R1 mutant library

[0238] Same as step 1 (a).

[0239] (2) Preparation of P6M-R14 mutant library.

[0240] 1. The nucleotide sequence of the SBFP2 gene was obtained from the NCBI database. This sequence is the original sequence (as shown in SEQ ID NO: 9, 720 bp).

[0241] 2. Based on the artificial sequence, 22 oligonucleotide single-stranded DNA sequences were designed. The 22 oligonucleotide single-stranded DNA sequences correspond to positions 1-33 (positive chain), 18-67 (reverse chain), 53-102 (positive chain), 88-137 (reverse chain), 120-169 (positive chain), 155-204 (reverse chain), 190-239 (positive chain), 221-270 (reverse chain), 255-304 (positive chain), 286-335 (reverse chain), 321-370 (positive chain), Positions 354-403 (reverse chain), positions 384-433 (forward chain), positions 416-465 (reverse chain), positions 446-495 (forward chain), positions 479-528 (reverse chain), positions 514-563 (forward chain), positions 545-594 (reverse chain), positions 580-629 (forward chain), positions 612-661 (reverse chain), positions 645-694 (forward chain), positions 679-720 (reverse chain).

[0242] 3. Input the sequence information of 22 oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0243] DNA was synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0244] The non-optimal conditions used during DNA synthesis were P3 (described in step 2 of Example 1, where the water content of the DNA synthesis solvent was 100 ppm-300 ppm).

[0245] Aside from the suboptimal conditions mentioned above, all other settings and parameters remained unchanged, following the standard operating procedures in the DNA synthesizer's instructions. After synthesis, the products were deprotected, eluted, and absorbance measured. The products were then aliquoted into 1.5 mL EP tubes and dried by vacuum centrifugation for later use. Twenty-two oligonucleotide single-stranded DNA sequences were simultaneously synthesized in vitro using 22 channels, yielding one tube of product for each oligonucleotide single-stranded DNA sequence, for a total of 22 tubes of product.

[0246] 4. Perform fusion PCR on the 22 synthetic products. Then, recover the target fragments by electrophoresis and clone them into expression vectors. This yields a library of recombinant expression vectors containing target fragments in various sequence forms. This library is then introduced into the expression system and evaluated.

[0247] (1) Fusion PCR

[0248] Fusion PCR reaction system: 1 μL of each of the 22 synthetic product solutions, 10 μL of 5×Q5 DNA polymerase reaction buffer, 2 μL of dNTPs solution, 1 μL of Q5 DNA polymerase, and the volume was made up to 50 μL with ultrapure water.

[0249] Synthetic product solution: The synthetic product prepared in step 3 (5 nmol, based on the molecular weight of the artificial sequence) was dissolved in 500 μL of ultrapure water to obtain a synthetic product solution.

[0250] The reaction process consists of two stages in sequence;

[0251] The first stage reaction procedure was: 98°C for 2 min; 98°C for 30 sec, annealing for 30 sec (the annealing temperature of the first cycle was 67°C, and each cycle was lowered by 1°C than the previous cycle), 72°C for 30 sec, for 8 cycles.

[0252] The second stage reaction procedure: 98°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 25 cycles; 72°C for 5 min.

[0253] (2) Electrophoresis to recover target fragments

[0254] Add 10 μL of 6× DNA loading buffer to the system completed in step 1 and mix well. Load the entire sample onto a 1.0% agarose gel containing 0.01% (volume ratio) DNA-binding color dye for electrophoresis. Observe and cut the target band using a gel image analyzer. Use a DNA recovery kit to recover the target fragment to obtain a DNA solution.

[0255] 5. Using the P6M-R1 mutant library as a template, PCR amplification was performed using a primer pair consisting of primers P5-V6.0-F6 and primers P56-V6.0-R2N, and then the linear vector (7056 bp) was recovered.

[0256] P5-V6.0-F6: ACTCTCGGCATGGACGAGCTGTACAAGTAAataaaacgaaaggctcagtcgaaagactg;

[0257] P56-V6.0-R2N: ggtatatctccttCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGA.

[0258] 6. Take 3 μL of the DNA solution obtained in step 4 (DNA content is 50 ng / μL), 3 μL of the linear vector obtained in step 5 (DNA content is 50 ng / μL) and 5 μL of DNA seamless cloning reagent, mix them, react at 50°C for 15 min, and then transform them all into 50 μL of Trans5α competent cells thawed on ice, place on ice for 30 min, then heat shock at 42°C for 90 sec, and then place on ice for another 10 min, then add 800 μL of SOC recovery medium, culture at 37°C and 100 rpm for 1 h, then centrifuge at 6000 rpm for 3 min, discard 600 μL of supernatant, resuspend the remaining part and spread it on LB solid medium plate containing 50 μg / L carbenicillin, and culture at 37°C until monoclonal colonies grow.

[0259] 7. After completing step 6, pick the positive clones growing on the plate and perform the following operations: Take a 48-well plate, add 3 ml of LB liquid medium containing 50 μg / L carbenicillin to each well, then inoculate a single clone (inoculate one well for each single clone), and then culture at 37°C and 250 rpm for 12-16 hours.

[0260] 8. After completing step 7, extract the plasmids of all monoclonal cultures and mix them evenly to obtain the P6M-R14 mutant library.

[0261] (III) Preparation of P5M6 mutant library

[0262] The P6M-R13 mutant library was replaced by the P6M-R14 mutant library, and the rest was the same as step 1 (3) to obtain the P5M6 mutant library.

[0263] (4) Same as step 1 (4).

[0264] Schematic diagram of the gene circuit Figure 8 Left picture.

[0265] Example results are shown in Figure 9 Left picture.

[0266] Example 8: Combining the method provided by the present invention with laboratory adaptive evolution (in vivo evolution) to improve carbenicillin resistance in microbial cells

[0267] In this example, the DNA molecule used as the target of directed evolution is the carbenicillin resistance gene (Bla gene).

[0268] 1. Obtaining the target gene sequence and designing gene synthesis primers

[0269] 1. Obtain the nucleotide sequence of the Bla gene (encoding beta-lactamase enzyme protein) from the NCBI database (the reverse complementary sequence at positions 6872-7832 in NCBI sequence number Z46234.1, AmpR gene site). This sequence is the original sequence.

[0270] 2. Ten random mutations (42DelT, C70G, G241C, T357A, 431InsA, 639DelA, C661T, 725InsG, G756A, 786DelG) were designed and added to the original sequence as internal markers to obtain an artificial sequence (as shown in SEQ ID NO: 10, 860 bp).

[0271] 3. Based on the artificial sequence, 30 oligonucleotide single-stranded DNA sequences were designed. The 30 oligonucleotide single-stranded DNA sequences correspond to positions 1-24 (positive chain), 1-50 (reverse chain), 30-79 (positive chain), 59-108 (reverse chain), 84-133 (positive chain), 115-164 (reverse chain), 144-193 (positive chain), 175-224 (reverse chain), 201-250 (positive chain), 231-280 (reverse chain), 264-313 (positive chain), 293-342 (reverse chain), 322-371 (positive chain), 352-401 (reverse chain), 383-432 (positive chain), 403-411 (reverse chain), 414-437 (reverse chain), 420-438 (reverse chain), 439-441 (reverse chain), 441-450 (reverse chain), 461-470 (reverse chain), 477-481 (reverse chain), 480-491 (reverse chain), 491-503 (reverse chain), 501-514 (reverse chain), 515-526 (reverse chain), 520-537 (reverse chain), 539-541 (reverse chain), 541-553 (reverse chain), 553-561 (reverse chain), 561-571 (reverse chain), 571-581 (reverse chain), 581-591 (reverse chain), 591-5 414-463 (reverse chain), 444-493 (forward chain), 475-524 (reverse chain), 505-554 (forward chain), 538-587 (reverse chain), 566-615 (forward chain), 595-644 (reverse chain), 626-675 (forward chain), 660-709 (reverse chain), 690-739 (forward chain), 721-770 (reverse chain), 751-800 (forward chain), 784-833 (reverse chain), 810-859 (forward chain), 838-860 (reverse chain).

[0272] 2. Input the sequence information of 30 oligonucleotide single-stranded DNA into a DNA synthesizer and perform in vitro DNA synthesis.

[0273] DNA was synthesized in vitro using a Dr. oligo 192 DNA synthesizer.

[0274] The non-optimal conditions used for DNA synthesis are P1, P3, P4 and P5 (described in step 2 of Example 1, the water content of the DNA synthesis solvent is 100 ppm-300 ppm).

[0275] Aside from the suboptimal conditions mentioned above, all other settings and parameters remained unchanged, following the standard operating procedures in the DNA synthesizer's instructions. After synthesis, the products were deprotected, eluted, and absorbance measured. The products were then aliquoted into 1.5 mL EP tubes and dried by vacuum centrifugation for later use. Thirty oligonucleotide single-stranded DNA sequences were simultaneously synthesized in vitro using 30 channels, yielding one tube of product for each oligonucleotide single-stranded DNA sequence, for a total of 30 tubes.

[0276] 3. Perform fusion PCR on the 30 tubes of synthetic products, then recover the target fragments by electrophoresis and clone them into expression vectors to obtain multiple recombinant expression vectors with target fragments in various sequence forms, which is the mutant library.

[0277] 1. Fusion PCR

[0278] Fusion PCR reaction system: 1 μL of each of the 30 synthetic product solutions, 10 μL of 5×Q5 DNA polymerase reaction buffer, 2 μL of dNTPs solution, 1 μL of Q5 DNA polymerase, and the volume was made up to 50 μL with ultrapure water.

[0279] Synthetic product solution: The synthetic product prepared in step 2 (5 nmol, based on the molecular weight of the artificial sequence) was dissolved in 500 μL of ultrapure water to obtain a synthetic product solution.

[0280] The reaction process consists of two stages in sequence;

[0281] The first stage reaction procedure was: 98°C for 2 min; 98°C for 30 sec, annealing for 30 sec (the annealing temperature of the first cycle was 67°C, and each cycle was lowered by 1°C than the previous cycle), 72°C for 30 sec, for 8 cycles.

[0282] The second stage reaction procedure: 98°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 25 cycles; 72°C for 5 min.

[0283] 2. Same as step 2 of step 3 in Example 2.

[0284] 3. Using the p15C-M1-37-Kan plasmid as a template, PCR amplification was performed using a primer pair consisting of primers p15C-M1-37-Kan-F3 and p15C-M1-37-Kan-R3, and then the linear vector (4012 bp) was recovered. The p15C-M1-37-Kan plasmid is a circular double-stranded DNA molecule, as shown in SEQ ID NO: 11. A schematic diagram of the elements of the p15C-M1-37-Kan plasmid is shown in Figure 10 .

[0285] p15C-M1-37-Kan-F3:tgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatac;

[0286] p15C-M1-37-Kan-R3: gcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaag.

[0287] 4. Mix 3 μL of the DNA solution obtained in step 2 (DNA content: 50 ng / μL), 3 μL of the linearized vector obtained in step 3 (DNA content: 50 ng / μL), and 5 μL of DNA seamless cloning reagent. Incubate at 50°C for 15 min, then transform into Trans5α competent cells thawed on ice. Place on ice for 30 min, then heat shock at 42°C for 90 sec, then place on ice for another 10 min. Then, add 800 μL of SOC recovery medium and incubate at 37°C, shaking at 100 rpm for 1 h. Perform three parallel transformations.

[0288] 4. Laboratory Adaptive Evolution

[0289] 1. After completing step 3, inoculate the bacterial solution into 5 mL of LB liquid medium containing 25 μg / mL carbenicillin, mark it as AmpM6-R1 generation, and culture it at 37°C and 220 rpm with shaking for 12-16 hours.

[0290] 2. After completing step 1, inoculate 1 mL of bacterial solution into 5 mL of LB liquid medium containing 50 μg / ml carbenicillin, mark it as AmpM6-R2 generation, and culture at 37°C and 220 rpm for 12 h.

[0291] Refer to step 2 for continuous passage (the only difference is that the carbenicillin concentration is 75μg / ml, 100μg / ml, 200μg / ml, 250μg / ml, 500μg / ml, 1000μg / ml, 2500μg / ml, 5000μg / ml, 10000μg / ml, 20000μg / ml, 40000μg / ml, 50000μg / ml) and culture, and AmpM6-R3, AmpM6-R4, AmpM6-R5, AmpM6-R6, AmpM6-R7, AmpM6-R8, AmpM6-R9, AmpM6-R10, AmpM6-R11, AmpM6-R12, AmpM6-R13, AmpM6-R14, and AmpM6-R15 are obtained accordingly.

[0292] 5. Streak the AmpM6-R15 bacterial suspension onto an LB solid culture plate containing 50 μg / ml kanamycin and 5000 μg / ml carbenicillin (designated as plate 1), and culture at 37°C until a single colony grows.

[0293] 6. Spread the AmpM6-R15 bacterial solution onto an LB solid culture plate containing 50 μg / ml kanamycin and 10,000 μg / ml carbenicillin (designated as plate 2), and culture at 37°C until a single colony grows.

[0294] 7. Pick 24 single colonies from plate 1 completed in step 5, and pick 24 single colonies from plate 2 completed in step 6. Perform the following operations on each single colony: inoculate into a 48-well plate with 3 ml of LB liquid medium containing 10,000 μg / ml carbenicillin per well, and culture at 37°C and 250 rpm for 12-16 hours; then, take a 96-well plate with a clear bottom and black wall, add 50 μL of bacterial solution and 150 μL of LB liquid medium to each well, and measure the cell concentration (OD 600nm ). Select the bacterial solution with the highest concentration, about 30.

[0295] 8. The bacterial solution screened in step 7 was subjected to the following steps: 50 μL of bacterial solution was inoculated into a test tube containing 3 ml of LB liquid medium containing 50,000 μg / ml carbenicillin, and cultured at 37°C and 250 rpm. The bacterial concentration (OD 600nm The highest bacterial concentration was selected, and plasmids were extracted and sequenced. A C->T mutation was found at position 545 of the Bla gene, resulting in a mutation from Ala to Val in the encoded amino acid.

[0296] 9. Extract the plasmid from the bacterial solution screened in step 8, and transform the plasmid into Trans5α competent cells to obtain the recombinant bacteria AmpM6-R15 / DH5a. Transform the p15C-M1-37-Kan plasmid into Trans5α competent cells to obtain the recombinant bacteria AmpWT / DH5a. Perform the following parallel operations on the recombinant bacteria AmpM6-R15 / DH5a and the recombinant bacteria AmpWT / DH5a: inoculate into a test tube containing 3 ml of LB liquid culture medium containing carbenicillin (the concentration of carbenicillin is set to: 50, 500, 5000 or 50000 μg / ml), culture at 37°C and 250 rpm, and detect the bacterial concentration (OD) after 24 hours and 48 hours of culture, respectively. 600nm ).

[0297] See the results Figure 11 .

[0298] The results of this example show that the method of combining directed evolution based on error-prone DNA synthesis (in vitro evolution) with laboratory adaptive evolution (in vivo evolution) to improve the resistance of microbial cells to carbenicillin can also be expanded to the evolutionary modification of other enzyme genes or microbial cell phenotypes.

[0299] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A method for constructing a mutant library of DNA molecules, which is to construct the mutant library by synthesizing nucleic acid molecules in vitro, characterized in that: Mutations are introduced by using suboptimal conditions when synthesizing nucleic acid molecules in vitro.

2. The method according to claim 1, characterized in that: The non-optimal conditions include, but are not limited to: using a non-rigorous nucleic acid synthesis solvent and / or adjusting the reaction program settings of a nucleic acid synthesizer and / or replacing a dNTP monomer solution with a MixdNTP solution.

3. The method according to claim 1 or 2, characterized in that: The in vitro synthesis of nucleic acid molecules adopts chemical method or enzymatic method.

4. A method for irrational directed evolution of nucleic acid molecules, comprising the following steps: (1) constructing a mutant library of nucleic acid molecules using the method of claim 1; (2) Screen mutants from the mutant library and sequence them according to the goal of directed evolution.

5. The method according to claim 4, characterized in that: The non-optimal conditions include, but are not limited to: using a non-rigorous nucleic acid synthesis solvent and / or adjusting the reaction program settings of a nucleic acid synthesizer and / or replacing a dNTP monomer solution with a MixdNTP solution.

6. The method according to claim 4 or 5, characterized in that: The in vitro synthesis of nucleic acid molecules adopts chemical method or enzymatic method.

7. The use of the method according to any one of claims 1 to 6, wherein (a) and / or (b) and / or (c) (a) Protein directed evolution; (b) Directed evolution of gene expression regulatory elements; (c) Directed evolution of multi-gene genetic circuits.

8. Use of any one of the methods of claims 1 to 6 in directed modification of microorganisms.

9. Use of any one of the methods of claims 1 to 6 in combination with other methods in the directed modification of microorganisms.

10. The use according to claim 9, characterized in that: The other method is in vivo evolution of microorganisms.

Images