Anti-HBV agents

Abstract

An anti-HBV agent comprising a compound of formula (I) or a salt thereof. In the formula, R1 is phenyl substituted by a group represented by-CN or R3-NH-CO-and an alkyl group having 1-6 carbon atoms, R3 is an alkyl group having 1-10 carbon atoms or a group represented by a formula R4-(CH2) n1-, R4 is CH2 = CH-, phenyl, cyclohexyl or morpholinyl, n1 is an integer of 1-5, and R2 is phenyl substituted by halogen. ] # imgabs0 #

Description

Technical Field

[0001] The present invention relates to a novel anti-HBV agent. Background Art

[0002] Hepatitis B is said to occur when the hepatitis B virus (HBV) is infected through blood and body fluids, and about 10% of infected people become chronic. Chronic hepatitis B progresses to cirrhosis, liver failure, or hepatocellular carcinoma, which is a life-threatening disease for patients, but there is no radical treatment at present. There are only palliative treatments that prevent the generation of new HBV and the spread of infection, while waiting for the reduction or death of infected cells or the inactivation of HBV through immunity or metabolism.

[0003] The treatment of chronic hepatitis B currently uses interferon preparations that remove infected cells through natural immune action and nucleic acid analog preparations that inhibit the reverse transcription of HBV-DNA. In particular, nucleic acid analog preparations exert a high therapeutic effect by inhibiting the proliferation of HBV-DNA, but there is a situation where it is very difficult to judge the withdrawal period. HBV is a DNA virus that exists in the form of cccDNA (covalently closed circular DNA) in the nucleus of liver cells. When infecting liver cells, it invades the nucleus and produces pregenomic RNA, which synthesizes HBV-DNA and various antigenic proteins from this RNA, which becomes a template to form new virus particles and proliferate (refer to the process).

[0004] [Chemical formula 1]

[0005]

[0006] Currently, nucleic acid analogs such as entecavir (ETV) are widely used in the treatment of chronic hepatitis B. These drugs temporarily reduce the virus and have a certain effect in delaying the onset of cirrhosis and hepatocellular carcinoma. However, it is pointed out that persistently infected HBV is not completely eliminated from the body, and drug-resistant viruses appear due to long-term administration. Therefore, it is expected that new drugs with different mechanisms of action from nucleic acid analogs will be developed.

[0007] In recent years, it has been reported that capsid protein inhibitors are used as therapeutic drugs for viral infections such as HBV (Patent Document 1). In this invention, since the 149 amino acid residues at the N-terminus of the core protein diploidization motif and the assembly domain do not have human protein homologous sequences, capsid protein inhibitors are considered to be new targets for the development of anti-HBV drugs.

[0008] In addition, a therapeutic drug for treating a disease associated with pregenomic RNA capsid formation has been reported (Patent Document 2). In this invention, it is also pointed out that the disease associated with pregenomic RNA capsid formation is hepatitis B virus infection.

[0009] In addition, the synthesis and evaluation of N-phenyl-3-sulfamoylbenzamide derivatives as HBV capsid assembly regulators have been reported (Non-Patent Document 1).

[0010] Prior art literature

[0011] Patent Literature

[0012] Patent Document 1: International Publication No. 2019 / 20070 Pamphlet

[0013] Patent Document 2: International Publication No. 2014 / 106019 Pamphlet

[0014] Non-patent literature

[0015] Non-patent document 1: Vandyck, Koen et al., Journal of Medicinal Chemistry, 2018, 61(14), pp. 6247-6260 Summary of the invention

[0016] Problems to be solved by the invention

[0017] HBV core protein (HBc) is the main component of the nucleocapsid of viral particles and is also an important protein that plays an essential role in genome replication. The present inventors focused on the possibility of HBc as a drug development target, aiming to provide a new anti-HBV agent that inhibits normal nucleocapsid formation.

[0018] Means for solving problems

[0019] The present inventors have discovered compounds that inhibit normal nucleocapsid formation. It has also been found that various derivatives based on the compound have the activity of inhibiting HBV replication. It has also been found that some of the compounds have the effect of not only inhibiting HBV DNA but also inhibiting cccDNA, HBsAg, and HBeAg. For hepatitis B, even if it is treated with nucleic acid analog preparations, cccDNA cannot be eliminated, and reactivation becomes a problem. Compounds that have the effect of inhibiting cccDNA can inhibit the reactivation and are therefore preferred. In addition, interferon preparations act on the host's cells to exert antiviral activity, but some compounds act directly on HBc of HBV, so it is expected that side effects will be reduced. Based on the above insights, the present inventors have discovered a new type of anti-HBV agent that inhibits normal nucleocapsid formation, thereby completing the present invention.

[0020] The present invention relates to an anti-HBV agent comprising a compound of formula (I) or a salt thereof.

[0021] [Chemical formula 2]

[0022]

[0023] In the formula, R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0024] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0025] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0026] n1 is an integer from 1 to 5,

[0027] R 2 It is phenyl substituted by halogen.

[0028] Effects of the Invention

[0029] The present invention provides a novel anti-HBV agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 represents the results of mouse PET imaging.

[0031] Figure 2 The results show the inhibitory effects of HBsAg, HBeAg, and pgRNA.

[0032] Figure 3 The results show the inhibitory effects of cccDNA and pgRNA.

[0033] Figure 4 The figures show the results of an experiment to measure the anti-HBV activity of compound CBT-209 using human hepatocyte chimeric mice infected with hepatitis B virus.

[0034] Figure 5 The results of electron microscopic analysis of the capsid formation inhibition mechanism are shown. DETAILED DESCRIPTION

[0035] The present invention relates to an anti-HBV agent, which comprises the compound of the above formula (I) or a salt thereof.

[0036] [Chemical formula 3]

[0037]

[0038] In the formula, R 1 For -CN or R 3A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0039] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0040] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0041] n1 is an integer from 1 to 5,

[0042] R 2 It is phenyl substituted by halogen.

[0043] Furthermore, the present invention relates to a compound of formula (I) or a salt thereof.

[0044] [Chemical formula 4]

[0045]

[0046] In the formula, R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0047] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0048] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0049] n1 is an integer from 1 to 5,

[0050] R 2 It is phenyl substituted by halogen.

[0051] Furthermore, the present invention relates to a compound of formula (II) or a salt thereof.

[0052] [Chemical formula 5]

[0053]

[0054] In the formula, R 5 For R 6 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0055] The R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R7 -(CH2) n2 - the group shown,

[0056] The R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0057] n2 is an integer from 1 to 5.

[0058] Furthermore, the present invention relates to a compound of formula (III) or a salt thereof.

[0059] [Chemical formula 6]

[0060]

[0061] In the formula, R 15 For R 16 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0062] The R 16 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 17 -(CH2) n3 - the group shown,

[0063] The R 17 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0064] n3 is an integer from 1 to 5.

[0065] The compound of formula (III) is used 11 C, or, if containing fluorine atoms, 18 F mark.

[0066] In addition, the present invention relates to an inhibitor of HBV capsid formation, which comprises the compound of formula (I) or a salt thereof, or the compound of formula (II) or a salt thereof.

[0067] In addition, the present invention also relates to a PET probe for imaging, which targets the hepatitis B antigen protein comprising the compound of formula (III) or a salt thereof.

[0068] <Definition>

[0069] In the present invention, the "halogen" includes fluorine, chlorine, bromine or iodine, preferably fluorine, chlorine or bromine, and more preferably fluorine.

[0070] In the present invention, the "alkyl group having 1 to 6 carbon atoms" includes methyl, ethyl, n-propyl, isopropyl, 2-methylpropyl, n-butyl, tert-butyl, pentyl, hexyl, etc. The "alkyl group having 1 to 6 carbon atoms" is preferably an alkyl group having 1 to 5 carbon atoms, more preferably an alkyl group having 1 to 4 carbon atoms, and further preferably an alkyl group having 1 to 3 carbon atoms.

[0071] In the present invention, the "alkyl group having 1 to 10 carbon atoms" includes methyl, ethyl, n-propyl, isopropyl, 2-methylpropyl, n-butyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc. The "alkyl group having 1 to 10 carbon atoms" is preferably an alkyl group having 2 to 10 carbon atoms, and more preferably an alkyl group having 1 to 8 carbon atoms.

[0072] In the present invention, the "alkyl group having 1 to 3 carbon atoms" includes methyl, ethyl, n-propyl, isopropyl, etc. The "alkyl group having 1 to 3 carbon atoms" is preferably an alkyl group having 1 to 2 carbon atoms, and more preferably an alkyl group having 2 carbon atoms.

[0073] In the present invention, the salts are non-toxic and pharmaceutically acceptable conventional salts, for example, salts with alkali metals such as sodium and potassium, salts with alkaline earth metals such as calcium and magnesium, salts with inorganic bases such as ammonium, and salts with organic amines such as triethylamine, pyridine, picoline, ethanolamine, triethanolamine, dicyclohexylamine, N,N'-dibenzylethylenediamine, and salts with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid, and salts with organic carboxylic acids such as formic acid, acetic acid, trifluoroacetic acid, maleic acid, and tartaric acid, and salts with sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid, and salts with bases such as basic or acidic amino acids such as arginine, aspartic acid, and glutamic acid, or salts with acids.

[0074] <Anti-HBV Agents>

[0075] The compound of formula (I) has higher anti-HBV activity than existing compounds. In particular, compared with existing compounds, the anti-HBV activity in HBV-infected human hepatocyte chimeric mice is increased. In addition, the compound of formula (I) has a cccDNA inhibitory effect and exerts an effect that can inhibit the reactivation of hepatitis B.

[0076] In the anti-HBV agent of the present invention, the compound of formula (I) is preferably:

[0077] In the formula,

[0078] R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted with an alkyl group having 1 to 3 carbon atoms,

[0079] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R4 -(CH2) n1 - the group shown,

[0080] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0081] n1 is an integer from 1 to 3,

[0082] R 2 It is phenyl substituted by halogen.

[0083] In the anti-HBV agent of the present invention, the compound of formula (I) is more preferably:

[0084] In the formula,

[0085] R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 carbon atom,

[0086] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0087] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0088] n1 is an integer of 2,

[0089] R 2 It is a phenyl group substituted by fluorine.

[0090] In the anti-HBV agent of the present invention, the compound of formula (I) is preferably a compound shown in the following Table 1.

[0091] [Table 1]

[0092]

[0093]

[0094]

[0095] In the anti-HBV agent of the present invention, the compound of formula (I) is preferably a compound of the following formula (II).

[0096] [Chemical formula 7]

[0097]

[0098] In the formula,

[0099] R5 For R 6 -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, wherein R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown, the R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0100] n2 is an integer from 1 to 5.

[0101] In the anti-HBV agent of the present invention, the compound of formula (II) is preferably:

[0102] In the formula,

[0103] R 5 For R 6 A group represented by -NH-CO- and a phenyl group substituted with an alkyl group having 1 to 3 carbon atoms,

[0104] The R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown,

[0105] The R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0106] n2 is an integer from 1 to 3.

[0107] In the anti-HBV agent of the present invention, the compound of formula (II) is more preferably:

[0108] In the formula,

[0109] R 5 For R 6 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 carbon atom,

[0110] The R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown,

[0111] The R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0112] n2 is an integer of 2.

[0113] In the anti-HBV agent of the present invention, the compound of formula (II) is preferably a compound shown in Table 2 below.

[0114] [Table 2]

[0115]

[0116]

[0117] <Compound>

[0118] The present invention also relates to compounds of formula (I) or salts thereof.

[0119] [Chemical formula 8]

[0120]

[0121] In the formula,

[0122] R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0123] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0124] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0125] n1 is an integer from 1 to 5,

[0126] R 2 It is phenyl substituted by halogen.

[0127] The compound of formula (I) is, for example, the compound listed in Table 1.

[0128] The compound of formula (I) is preferably:

[0129] In the formula,

[0130] R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted with an alkyl group having 1 to 3 carbon atoms,

[0131] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0132] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0133] n1 is an integer from 1 to 3,

[0134] R 2 It is phenyl substituted by halogen.

[0135] The compound of formula (I) is more preferably:

[0136] In the formula,

[0137] R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 carbon atom,

[0138] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0139] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0140] n1 is an integer of 2,

[0141] R 2 It is a phenyl group substituted by fluorine.

[0142] Furthermore, the present invention relates to a compound of formula (II) or a salt thereof.

[0143] [Chemical formula 9]

[0144]

[0145] In the formula,

[0146] R 5 For R 6 -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, wherein R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown, the R 7 It is CH2=CH-, phenyl, cyclohexyl or morpholinyl, and n2 is an integer of 1-5.

[0147] The compound of formula (II) is, for example, the compound listed in Table 2.

[0148] The compound of formula (II) is preferably:

[0149] In the formula,

[0150] R 5 For R 6-NH-CO- and a phenyl group substituted by an alkyl group having 1 to 3 carbon atoms, wherein R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown, the R 7 It is CH2=CH-, phenyl, cyclohexyl or morpholinyl, and n2 is an integer of 1 to 3.

[0151] The compound of formula (II) is more preferably:

[0152] In the formula,

[0153] R 5 For R 6 -NH-CO- and a phenyl group substituted by an alkyl group having 1 carbon atom, wherein R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown, the R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl, and n2 is an integer of 2.

[0154] <Method for producing compound>

[0155] The method for producing the compound of formula (I) of the present invention is as follows.

[0156] [Chemical formula 10]

[0157]

[0158] In the formula,

[0159] R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0160] The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown,

[0161] The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0162] n1 is an integer from 1 to 5,

[0163] R 2 It is phenyl substituted by halogen.

[0164] R 21 For R 3A group represented by -NH-CO- and a phenyl group substituted with an alkyl group having 1 to 6 carbon atoms.

[0165] The compound of formula (I) can be prepared, for example, by reacting a compound of formula (X) with R 1 Alternatively, the compound of formula (I) can also be obtained by condensing the compound of formula (X) with R 11 -NH2 condensation to obtain a compound of formula (XI), which is then reacted with R 3 -NH2 condensation to obtain.

[0166] The condensation process can be carried out using a conventionally known condensation agent. As condensation agents, for example, carbodiimide-based, imidazole-based, triazine-based, phosphonium-based, urea-based, and halonium-based agents are known. As carbodiimide-based condensates, 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (EDCI), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI·HCl), N,N'-dicyclohexylcarbodiimide (DCC), N,N'-diisopropylcarbodiimide (DIC), etc. can be cited. As the imidazole-based condensation agent, N,N'-carbonyldiimidazole (CDI), 1,1'-carbonylbis(1,2,4-triazole) (CDT), etc. can be cited. Examples of the triazine condensate include 4-(4,6-dimethoxy-1,3,5-triazine-2-yl)-4-methylmorpholinium chloride n-hydrate (DMT-MM). Examples of the phosphonium condensation agent include 1H-benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP), 1H-benzotriazol-1-yloxytripyrrolidinium hexafluorophosphate (Py BOP), etc. Examples of the uronium condensation agent include {{[(1-cyano-2-ethoxy-2-oxyethylidene)amino]oxy}-4-morpholinylmethylene}dimethylammonium hexane fluorophosphate (COMU), etc. Examples of the halogenium condensation agent include 2-chloro-1,3-dimethylimidazolium hexafluorophosphate (CIP).

[0167] The compound represented by the formula (X) can be produced according to known documents, such as WO2020 / 255425 and Japanese Patent No. 7072213, or can be obtained commercially.

[0168] The present invention also relates to a compound of formula (III) or a salt thereof.

[0169] [Chemical formula 11]

[0170]

[0171] In the formula,

[0172] R 15 For R 16A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms,

[0173] The R 16 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 17 -(CH2) n3 - the group shown,

[0174] The R 17 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0175] n3 is an integer from 1 to 5.

[0176] The compound of formula (III) is used 11 C, or, if containing fluorine atoms, 18 F mark.

[0177] The compound of formula (III) is preferably:

[0178] In the formula,

[0179] R 15 For R 16 A group represented by -NH-CO- and a phenyl group substituted with an alkyl group having 1 to 3 carbon atoms,

[0180] The R 16 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 17 -(CH2) n3 - the group shown,

[0181] The R 17 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0182] n3 is an integer from 1 to 3.

[0183] The compound of formula (III) is more preferably:

[0184] In the formula,

[0185] R 15 For R 16 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 carbon atom,

[0186] The R 16 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 17 -(CH2) n3 - the group shown,

[0187] The R 17 is CH2=CH-, phenyl, cyclohexyl or morpholinyl,

[0188] n3 is an integer of 2.

[0189] In the present invention, "the compound of formula (III) is used 11 C, or, if containing fluorine atoms, 18 "F Mark" means any of the following:

[0190] [Chemical formula 12]

[0191]

[0192] (a) any one of the carbon atoms in the formula (III) is used 11 C mark,

[0193] (b) The fluorine (F) in the formula (III) is 18 F mark.

[0194] In the present invention, the compound of formula (III) is used 11 C, or, if containing fluorine atoms, 18 Examples of "F-labeled" include the following compounds.

[0195] [Chemical formula 13]

[0196]

[0197] The present invention's " 11 The compound labeled with C can be combined with a conventionally known high-speed 11 C-methylation reaction (Chem. Rec. 2014, 14, 516-541.). In addition, the present invention "in the case of containing fluorine atoms" 18 The compound labeled with F can be combined with conventionally known 18 It was produced by F-labeling method (Org. Lett. 2015, 17, 5780-5783; Chem. Commun. 2016, 52, 8361-8364).

[0198] In addition, the present invention relates to a PET probe for imaging, which targets hepatitis B antigen protein comprising a compound of formula (III) or a salt thereof.

[0199] The imaging PET probe of the present invention can be prepared into an appropriate dosage form such as an injection by a conventionally known method. As an injection, for example, an injection for intravenous administration, a medium, a pH adjuster, a buffer, a suspending agent, a solubilizing agent, an antioxidant, a preservative, etc. can be added to the compound represented by the general formula (III) or its salt as needed, and processed by conventional methods to prepare a preparation.

[0200] [abbreviation]

[0201] In this specification, the following abbreviations are sometimes used.

[0202] THF: Tetrahydrofuran

[0203] <Production Example 1>

[0204] Synthesis of compounds of formula (S2)

[0205] [Chemical formula 14]

[0206]

[0207] The compound of formula (S1) is produced according to the method for producing 2-fluoro-3-((4-fluorophenyl)carbamoyl)benzoic acid (4) described in JP-A-2019-112326.

[0208] Thionyl chloride (3.65 mL, 7.5 mmol, 20 equiv) was added to a THF solution (25 mL) of the compound of formula (S1) (1.39 g, 5.0 mmol, 1 equiv), and the resulting mixture was heated to 80°C and stirred for 2 hours. The mixture was cooled to room temperature, and the solvent was removed from the mixture under reduced pressure. THF (25 mL), 3-methyl-4-aminobenzoic acid (0.89 mL, 5.0 mmol, 2.0 equiv), and N,N-diisopropylethylamine (0.89 mL, 5.0 mmol, 1.0 equiv) were added to the resulting residue, and the mixture was stirred at room temperature for 19 hours. Hydrochloric acid solution (1 mol / L, 20 mL) was added to the mixture and stirred, and then extracted three times with ethyl acetate. The combined organic phase was washed with saturated brine and dehydrated with anhydrous sodium sulfate. After the solvent was distilled off from the organic phase under reduced pressure, acetone was added to the solid of the residue, and heated to 70°C to dissolve it in acetone. After cooling, a small amount of hexane was added to the acetone solution to precipitate a solid. The precipitated solid was collected by filtration to obtain a compound of formula (S2) (1.31 g, 3.20 mmol, yield: 64.0%).

[0209] 1 H NMR(DMSO-d6)δ2.34(s,3H),7.22(dd,J=8.8,8.8Hz,2H),7.45(dd,J=7.2,8.0Hz,1H),7.72-7.89(m,7H),10.13(s,1H),10.67(d,J=3.6Hz,1H);

[0210] 19 F NMR(DMSO-d6)δ-116.6(1F),-119.8(1F);

[0211] HRMS(ESI - )m / z 409.0996 (calculated to be C 22 H 15 F2N2O4, 405.1005, [M] - ).

[0212] [General Method for Producing Compounds Described in Examples]

[0213] Thionyl chloride (20 equivalents) is added to a tetrahydrofuran (THF) solution of a carboxylic acid (a compound of formula (S1) or a compound of formula (S2), 1 equivalent), and the resulting mixture is heated to 80°C and stirred for 2 hours. The mixture is cooled to room temperature, and the solvent is removed from the mixture under reduced pressure. THF, an amine compound (2.0 equivalents), and N,N-diisopropylethylamine (1.0 equivalents) are added to the resulting residue, and the mixture is stirred at room temperature for 20 hours. A hydrochloric acid solution (1 mol / L) is added to the mixture and stirred, and then extracted three times with ethyl acetate. The combined organic phases are washed with saturated brine and dehydrated with anhydrous sodium sulfate. After distilling off the solvent from the organic phase under reduced pressure, the solid of the residue is purified by recrystallization (using acetone and hexane) or silica gel column chromatography to obtain a CBT compound.

[0214] [Example 1]

[0215] Preparation of Compound CBT-209

[0216] [Chemical formula 15]

[0217]

[0218] The compound of formula (S1) (2.77 g, 10.0 mmol) was used as the carboxylic acid, and 2-methyl-4-cyanoaniline (1.98 g, 15 mmol, 1.5 equivalents) was used as the amine compound, and the product was prepared according to the conventional production method (2.99 g, 7.6 mmol, yield 76.3%). Purification was performed by silica gel column chromatography (hexane / ethyl acetate = 9 / 1 to 1 / 1).

[0219] 1 H NMR(acetone-d6)δ2.46(s,3H),7.16(dd,J=8.8,9.2Hz,2H),7.49(dd,J=8.0,7.6Hz,1H),7.66-7.70(m,2H), 7.83-7.86(m,2H),7.96(dd,J=7.6,7.2Hz,1H),8.04(dd,J=7.2,7.6Hz,1H),9.23(s,1H),9.65(s,1H);

[0220] 19 F NMR(DMSO-d6)δ-116.6(1F),-119.6(1F);

[0221] HRMS(ESI + )m / z 392.1208 (calculated as C 22 H 16 F2N3O2 + 、3992.1205、[M+H] + ).

[0222] [Example 2]

[0223] Preparation of compound CBT-289

[0224] [Chemical formula 16]

[0225]

[0226] The compound of formula (S2) (205 mg, 0.5 mmol) was used as the carboxylic acid and n-butylamine (100 μL, 1.0 mmol, 2.0 equivalents) was used as the amine compound to produce (127 mg, 0.27 mmol, yield 54.3%) according to the conventional production method. Purification was performed by recrystallization.

[0227] 1 H NMR(acetone-d6)δ0.93(t,J=7.2Hz,3H),1.32-1.42(m,2H),1.55-1.62(m,2H),2.41 (s,3H),1.55-1.62(td,J=7.2,7.2Hz,2H),7.17(dd,J=7.2,8.8Hz,2H),7.48(d d,J=8.0,7.6Hz,1H),7.68(br,1H),7.76-7.80(m,2H),7.84-7.86(m,2H),7.93 (dd,J=6.4,6.0Hz,1H),8.01-8.03(m,2H),9.16(d,J=4.4Hz,1H),9.74(s,1H);

[0228] 19 F NMR (acetone-d6) δ -116.5 (1F), -119.8 (1F);

[0229] HRMS(ESI + )m / z 466.1938 (calculated to be C 26 H 26 F2N3O3 +、466.1937、[M+H] + ).

[0230] [Example 3]

[0231] Preparation of compound CBT-383

[0232] [Chemical formula 17]

[0233]

[0234] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid and n-propylamine (100 μL, 1.0 mmol, 2.0 equivalents) was used as the amine compound to produce (26.9 mg, 61.5 μmol, yield 61.5%) according to the conventional production method. Purification was performed by recrystallization.

[0235] 1 H NMR(DMSO-d6)δ0.89(t,J=7.6Hz,3H),1.51-1.56(m,2H),2.33(s,3H),3.21(dt,J=6.4,6.4Hz,2H),7.22(dd,J=7. 6,8.8Hz,2H),7.45(dd,J=7.2,8.0Hz,1H),7.61-7.87(m,7H),8.42(t,J=5.2Hz,1H),10.06(s,1H),10.62(s,1H);

[0236] 19 F NMR(DMSO-d6)δ-116.6(1F),-118.3(1F);

[0237] HRMS (ESI+) m / z 452.1780 (calculated as C 25 H 23 F2N3O3 + 、452.1780、[M+H] + ).

[0238] [Example 4]

[0239] Preparation of Compound CBT-384

[0240] [Chemical formula 18]

[0241]

[0242] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid and an aqueous solution of ethylamine (10 mol / L, 20 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound to produce (37.2 mg, 85.0 μmol, 85.0%) according to the conventional production method. Purification was performed by recrystallization.

[0243] 1 H NMR(DMSO-d6)δ1.08(t,J=7.2Hz,3H),2.28(s,3H),3.24(dq,J=6.8,6.8Hz,2H),7.17(dd,J=7.6,6.8Hz, 2H),7.41(dd,J=7.6,8.0Hz,1H),7.57-7.85(m,7H),8.39(t,J=5.2Hz,1H),10.02(s,1H),10.58(s,1H);

[0244] 19 F NMR(DMSO-d6)δ-116.6(1F),-118.3(1F);

[0245] HRMS(ESI + )m / z 438.1623 (calculated to be C 24 H 21 F2N3O3 + 、438.1624、[M+H] + ).

[0246] [Example 5]

[0247] Preparation of Compound CBT-385

[0248] [Chemical formula 19]

[0249]

[0250] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid and 2-amino-2-methylpropane (21 μL, 0.2 mmol, 2.0 equivalents) was used as the amine compound to produce (36.0 mg, 77.2 μmol, yield 77.2%) according to the conventional production method. Purification was performed by recrystallization.

[0251] 1H NMR (acetone-d6) δ1.45 (s, 9H), 2.39 (s, 3H), 7.08 (s, 1H), 7.16 (dd, J = 8.8, 8.8 Hz, 2H), 7.47 (dd, J = 8.0, 8.0 Hz, 1H), 7.69-7.74 (m, 2H), 7.83-7.87 (m, 2H), 7.91-8.02 (m, 3H), 9.10 (d, J = 2.0 Hz, 1H), 9.68 (s, 1H);

[0252] 19 F NMR (acetone-d6) δ -116.8 (1F), -119.8 (1F);

[0253] HRMS(ESI + )m / z 466.1935 (calculated to be C 26 H 26 F2N3O3 + 、466.1937、[M+H] + ).

[0254] [Example 6]

[0255] Preparation of Compound CBT-387

[0256] [Chemical formula 20]

[0257]

[0258] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid and 3-butene-1-amine hydrochloride (21 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound to produce (14.7 mg, 31.7 μmol, yield 31.7%) according to the conventional production method. Purification was performed by recrystallization.

[0259] 1 H NMR (acetone-d6) δ2.33-2.41(m,5H),3.50(td,J=6.0,7.2Hz,1H),4.99-5.11(m,2H),5.81-5.92(m,1H),7.16(dd,J=9.2,7.2Hz,2H),7.47(dd,J=7.2 ,8.0Hz,1H),7.69(br,1H),7.74-7.79(m,2H),7.83-7.86(m,2H),7.93(dd,J=7.2,7.2Hz,1H),8.02(m,2H),9.12(d,J=6.0Hz,1H),9.68(s,1H);

[0260] 19 F NMR (acetone-d6) δ -116.7 (1F), -119.8 (1F);

[0261] HRMS (ESI+) m / z 464.1780 (calculated as C 26 H 24 F2N3O3 + 、464.1780、[M+H] + ).

[0262] [Example 7]

[0263] Preparation of Compound CBT-388

[0264] [Chemical formula 21]

[0265]

[0266] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, n-hexylamine (26 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (21.0 mg, 42.5 μmol, yield 42.5%). Purification was performed by recrystallization.

[0267] 1 H NMR (acetone-d6) δ0.89(m,3H),1.32-1.40(m,6H),1.59-1.62(m,2H),2.41(s,3H),3.38-3.39(m,2H),7.17(dd,J=8.4,6.8Hz,2H),7.48(dd,J=7. 6,6.6Hz,1H),7.68(br,1H),7.75-7.80(m,2H),7.84-7.86(m,2H),7.93(dd,J=7.2,7.2Hz,1H),8.00-8.02(m,2H),9.14(s,1H),9.71(s,1H);

[0268] 19 F NMR (acetone-d6) δ -116.7 (1F), -119.8 (1F);

[0269] HRMS (ESI+) m / z 494.2248 (calculated as C 28 H 30 F2N3O3 + 、494.2250、[M+H] +).

[0270] [Example 8]

[0271] Preparation of compound CBT-389

[0272] [Chemical formula 22]

[0273]

[0274] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, 1-aminodecane (39 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (11.4 mg, 19.2 mmol, yield 19.2%). Purification was carried out by recrystallization (THF / hexane).

[0275] 1 H NMR (acetone-d6) δ0.87 (t, J = 7.2 Hz, 3H), 1.29-1.41 (m, 14H), 1.59-1.63 (m, 2H), 2. 41(s,3H),3.39(dt,J=7.2,6.4Hz,2H),7.16(dd,J=9.2,8.4Hz,2H),7.47(dd, J=8.0,7.6Hz,1H),7.64(br,1H),7.76-7.80(m,2H),7.84-7.87(m,2H),7.93( dd,J=6.8,6.0Hz,1H),8.01-8.03(m,2H),9.13(d,J=6.8Hz,1H),9.70(s,1H);

[0276] 19 F NMR (acetone-d6) δ -116.7 (1F), -119.8 (1F);

[0277] HRMS(ESI + )m / z 550.2876 (calculated as C 32 H 38 F2N3O3 + 、550.2876、[M+H] + ).

[0278] [Example 9]

[0279] Preparation of compound CBT-390

[0280] [Chemical formula 23]

[0281]

[0282] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, 3-methyl-1-butylamine (23 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was prepared according to the conventional manufacturing method (9.2 mg, 18 μmol, yield 18%). Purification was carried out by recrystallization (THF / hexane).

[0283] 1 H NMR (acetone-d6) δ 0.93 (s, 3H), 0.95 (s, 3H), 1.52 (dt, J = 6.8, 7.2 Hz, 2H), 1.66-1.71 (m, 1H), 2.41 (s, 3H), 3.42 (dt, J = 6.0, 8.4 Hz, 2H), 7.08 (s, 1H), 7.17 (dd, J = 8.8, 8.8 Hz, 2 H),7.48(dd,J=8.0,8.0Hz,1H),7.64(br,1H),7.76-7.80(m,2H),7.84-7.87(m,2H) ,7.94(dd,J=6.8,7.6Hz,1H),8.01-8.03(m,2H),9.12(d,J=6.0Hz,1H),9.68(s,1H);

[0284] 19 F NMR (acetone-d6) δ -116.7 (1F), -119.8 (1F);

[0285] HRMS(ESI + )m / z 480.2093 (calculated as C 27 H 28 F2N3O3 + 、480.2093、[M+H] + ).

[0286] [Example 10]

[0287] Preparation of compound CBT-391

[0288] [Chemical formula 24]

[0289]

[0290] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, (S)-1-methyl-1-butylamine (23 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (34.1 mg, 71.1 μmol, yield 71.1%). Purification was carried out by recrystallization (THF / hexane).

[0291] 1 H NMR (acetone-d6) δ 0.90-0.94 (m, 6H), 1.15-1.22 (m, 1H), 1.46-1.52 (m, 1H), 1.68-1.73 (m, 1H), 2.42 (s, 3H), 3.17-3.24 (m, 1H), 3.31-3.37 (m, 1H), 7.16 (dd, J = 9.2, 8.8 Hz, 2H ),7.47(dd,J=7.6,8.0Hz,1H),7.67(br,1H),7.76-7.81(m,2H),7.84-7.87(m,2H), 7.93(dd,J=6.8,6.4Hz,1H),8.01-8.03(m,2H),9.14(d,J=6.4Hz,1H),9.70(s,1H);

[0292] 19 F NMR (acetone-d6) δ -116.7 (1F), -119.8 (1F);

[0293] HRMS(ESI + )m / z 480.2093 (calculated to be C 27 H 28 F2N3O3 + 、480.2093、[M+H] + ).

[0294] [Example 11]

[0295] Preparation of Compound CBT-400

[0296] [Chemical formula 25]

[0297]

[0298] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, 2-phenylethylamine (25 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (45.1 mg, 87.8 μmol, yield 87.8%). Purification was carried out by silica gel column chromatography (hexane / ethyl acetate = 7 / 3-3 / 7).

[0299] 1 H NMR (acetone-d6) δ2.41(s,3H),2.93(t,J=6.4Hz,2H),3.63(dt,J=6.4,6.8Hz,2H),7.15-7.22(m,3H),7.28-7.32(m,4H),7.48(dd,J= 5.6,7.6Hz,1H),7.74-7.79(m,3H),7.84-7.87(m,2H),7.94(dd,J=6.8,7.2Hz,1H),8.03-8.04(m,2H),9.13(s,1H),9.70(s,1H);

[0300] 19 F NMR (acetone-d6) δ -116.8 (1F), -119.7 (1F);

[0301] HRMS(ESI + )m / z 514.1942 (calculated to be C 30 H 26 F2N3O3 + 、514.1937、[M+H] + ).

[0302] [Example 12]

[0303] Preparation of Compound CBT-401

[0304] [Chemical formula 26]

[0305]

[0306] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, 2-cyclohexylethane-1-amine (29 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (21.2 mg, 40.8 μmol, yield 40.8%). Purification was carried out by recrystallization (chloroform / ethyl acetate).

[0307] 1 H NMR(DMSO-d6)δ0.90(tt,J=10.4,11.6Hz,2H),1.08-1.30(m,4H),1.40-1.43(m,2H),1.60-1.74(m,5H),2.33(s,3H),3.2 7-3.28(m,2H),7.22(dd,J=8.8,8.8Hz,2H),7.45(dd,J=7.6,7.6Hz,1H),7.61-7.87(m,7H),10.08(s,1H),10.64(s,1H);

[0308] 19 F NMR(DMSO-d6)δ-116.4(1F),-118.3(1F);

[0309] HRMS(ESI + )m / z 520.2407 (calculated as C 30 H 32 F2N3O3 + 、520.2406、[M+H] + ).

[0310] [Example 13]

[0311] Preparation of Compound CBT-402

[0312] [Chemical formula 27]

[0313]

[0314] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, n-pentylamine (23 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (35.5 mg, 74.0 mmol, yield of 74.0%). Purification was carried out by recrystallization (ethyl acetate).

[0315] 1 H NMR(DMSO-d6)δ0.88(t,J=6.8Hz,3H),1.15-1.19(m,1H),1.30-1.31(m,3H),1.50- 1.54(m,1H),2.32(s,3H),3.24(dt,J=6.8,6.4Hz,2H),7.22(dd,J=9.2,8.8Hz,2H) ,7.45(dd,J=7.6,7.6Hz,1H),7.62(d,J=8.0Hz,1H),7.70(d,J=8.8Hz,1H),7.74-7 .77(m,3H),7.80-7.89(m,2H),8.39(t,J=6.0Hz,1H),10.05(s,1H),10.60(s,1H);

[0316] 19 F NMR(DMSO-d6)δ-116.6(1F),-118.3(1F);

[0317] HRMS(ESI + )m / z 486.2093 (calculated to be C 27 H 28 F2N3O3 + 、486.2093、[M+H] + ).

[0318] [Example 14]

[0319] Preparation of Compound CBT-403

[0320] [Chemical formula 28]

[0321]

[0322] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, 3-(morpholino)propylamine (29 μL, 0.20 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (25.4 mg, 47.3 μmol, yield 47.3%). Purification was carried out by recrystallization (ethyl acetate).

[0323] 1 H NMR(CDCl3)δ1.77(m,2H),2.25(s,3H),2.61(m,6H),3.35(m,2H),3.76(m,4H),7.03(dd,J=7. 6,6.8Hz,2H),7.33(dd,J=7.6,5.2Hz,1H),7.62-7.68(m,4H),7.95-8.20(m,5H),8.96(s,1H);

[0324] 19 F NMR(CDCl3)δ-116.0(1F),-116.9(1F);

[0325] HRMS(ESI + )m / z 537.2309 (calculated as C 29 H 31 F2N3O3 + 、537.2308、[M+H] + ).

[0326] [Example 15]

[0327] Preparation of Compound CBT-404

[0328] [Chemical formula 29]

[0329]

[0330] The compound of formula (S2) (41.1 mg, 0.100 mmol) was used as the carboxylic acid, 2-(morpholino)ethylamine (26.8 mg, 0.206 mmol, 2.0 equivalents) was used as the amine compound, and N,N-diisopropylethylamine (35 μL, 0.20 mmol, 2.0 equivalents) was used instead of N,N-diisopropylethylamine (1.0 equivalents), and the product was produced according to the conventional production method (49.2 mg, 94.2 μmol, yield 94.2%). Purification was carried out by recrystallization (chloroform / hexane).

[0331] 1 H NMR(CDCl3)δ2.26(s,3H),2.50-2.55(m,6H),3.40-3.41(m,2H),3.71(m,4H),6.86(br,1H),7.04(dd,J=8.8,8. 8Hz,2H),7.32(dd,J=7.6,7.6Hz,1H),7.50-7.55(m,2H),7.96(m,1H),8.10-8.21(m,3H),8.96(d,J=5.6Hz,1H);

[0332] 19 F NMR(CDCl3)δ-116.2(1F),-116.8(1F);

[0333] HRMS(ESI + )m / z 523.2151 (calculated as C 28 H 29 F2N3O3 + 、523.2155、[M+H] + ).

[0334] <Anti-HBV activity assay using hepatitis B virus-producing cultured cells>

[0335] Hep2.2.15.7 cells were cultured at 1×10 5Cells were seeded at a density of 100 cells / well on a 96-well plate (manufactured by TPP) and cultured at 37°C and 5% CO2 using a culture medium containing 10% fetal bovine serum, 100 U / ml penicillin, 100 μg / ml streptomycin (manufactured by Thermo Fisher Scientific Inc.), and 5 μg / ml insulin (manufactured by Wako Pure Chemical Industries, Ltd.). Test compounds were added and 3 wells of cells were cultured per condition. The culture medium containing the test compound was replaced after 3 days. After 6 days, the absorbance of mitochondrial activity in the cells at 490 nm was quantified using a cell proliferation kit II (XTT) (manufactured by Roche) and an enzyme reader EnSight (manufactured by Perkin Elmer) to determine the cell survival rate. At the same time, HBV-derived DNA was extracted and purified from the cell culture medium using Agencourt Genfind v2 (manufactured by Beckman Coulter), and the DNA solution (2 μL) was mixed with Probe qPCR Mix (manufactured by TAKARA) (5 μL), 100 μM primers (0.02 μL) (HBV DNA Fr: ACTCACCAACCTCCTGTCCT (sequence number 1), HBV DNA Rv: GACAAACGGGCAACATACCT (sequence number 2), 100 μM probe (0.01 μL), HBV DNA: [FAM]TATCGCTGGATGTGTCTGCGGCGT[TAM] (sequence number 3)), and qPCR reaction was performed at 95°C for 1 minute, followed by 50 cycles of "95°C for 10 seconds, followed by 60°C for 30 seconds", and the signal was detected using the CFX96 Touch Real-Time PCR Detection System (manufactured by Bio-rad) to quantify the HBV DNA amount (HBV gene copy number).

[0336] <Anti-HBV activity assay using primary cultured human hepatocytes infected with hepatitis B virus>

[0337] Fresh human hepatocytes derived from PXB mice (PXB cells; manufactured by Phoenixbio) were cultured at 0.7×10 5 Cells were seeded on a collagen-coated 96-well plate (manufactured by FALCON) at a density of 10 cells / well and cultured in dHCGM medium (homemade) at 37°C and 5% CO2 for 7 days. Genotype C HBV (manufactured by Phoenixbio) was added at a final density of 3×10 5 The number of copies / well or genotype D HBV (homemade from Hep2.2.15.7 cells) was finally reached to 3×107 The copies / well method was used to add the cells to the culture medium together with 4% PEG8000. The culture medium was replaced after 1 day and every 3 or 4 days thereafter. The test compound was added after 28 days and 3 wells of cells were cultured for each condition. Thereafter, the medium containing the test compound was replaced after 3 or 4 days. After 7 days, total RNA was extracted and purified from the cells using Agencourt RNAdvance (manufactured by Beckman Coulter), and reverse transcribed using PrimeScript RT ragent kit (Perfect Real Time). The cDNA solution (2 μL) was mixed with TB Green Premix Ex Taq II (TIi RNaseH Plus) (manufactured by TAKARA) (5 μL), and 100 μM primers (0.02 μL) (pg RNA Fr: CT CAATCTCGGGAATCTCAATGT (SEQ ID NO: 4), pgRNA Rv: GGATAGAA CCTAGCAGGCATAAT (SEQ ID NO: 5)), and qPCR was performed at 95°C for 1 minute, followed by 50 cycles of "95°C for 10 seconds, followed by 60°C for 30 seconds". The signal was detected using CFX96 Touch Real-Time PCR Detection System (manufactured by Bio-rad), and the pgRNA amount (pgR NA copy number) was quantified.

[0338] The results of the anti-HBV activity of the compounds measured using PXB cells or Hep2.2.15.7 cells are summarized in the following Table 3. The anti-HBV activity was calculated based on the number of HBV gene copies in cells or culture medium after DMSO treatment, and 0 copy number was calculated as 100% inhibition to obtain the IC 50 .

[0339] [Table 3]

[0340]

[0341]

[0342]

[0343] [Chemical formula 30]

[0344]

[0345] As shown in the table above, the compound of formula (I) shows HBV inhibitory activity. In detail, the previous capsid formation inhibitor CBT-078 did not inhibit the effect of pgRNA and cccDNA in primary cultured human hepatocytes infected with hepatitis B virus, but the compound of formula (I) confirmed the effect of inhibiting pgRNA and cccDNA. In previous nucleic acid analog preparations, cccDNA cannot be excluded and hepatitis B is difficult to cure, but the compound of formula (I) has a cccDNA inhibitory effect, and it is expected that the therapeutic effect of hepatitis B will be improved.

[0346] <Mouse blood drug concentration measurement experiment>

[0347] The compound was dissolved in a mixture of ethanol and polysorbate 80 (1:1) to prepare a 10 mg / mL solution, which was diluted to 1 mg / mL with physiological saline and orally administered to mice (ICR strain, male, 6-10 weeks old) using a probe. Blood was collected from the tail vein at 0.25, 0.5, 1, 2, 4, and 7 hours after administration to obtain plasma. An internal standard (ritonavir) was added to 10 μL of plasma, and the sample after protein removal was used for measurement. The measurement was performed according to liquid chromatography-tandem mass spectrometry using a Shimadzu LCMS8050 system. The analysis conditions are as follows. The column used was COSMOSIL 3C18-MS-II (2.0 ID×50 mm; manufactured by Nacalai Tesque). The column temperature was 40°C, and the autosampler temperature was 4°C. The mobile phase was phase A: water / acetonitrile = 9 / 1 (v / v), phase B: acetonitrile, and the flow rate was 0.6 mL / min. 2 μL of sample was injected. The gradient elution conditions were: 0-0.9 min 5% B; 0.9-2.1 min, 5-95% B; 2.1-5.5 min 95% B; 5.5-5.51 min, 95-5% B; 5.51-6.0 min, 5% B. The cleaning solution used was a 1 / 1 / 1 / 1 (v / v / v / v, %) solution of isopropanol / methanol / acetonitrile / water containing 0.1% formic acid. The ionization method was ESI, and the collected data were processed using LabSolutions software (Version 5.97 SP1, Shimadzu Corporation).

[0348] The mouse blood concentrations of the compounds are summarized in Table 4 below.

[0349] [Table 4]

[0350]

[0351] As shown in the above table, it was confirmed that the compound of formula (I) has a slow absorption rate and a slow disappearance rate.

[0352] [Example 16]

[0353] use 18F-labeled compound CBT-209 (compound [ 18 Manufacturing of CBT-209

[0354] According to the following scheme, compound CBT-398 was first synthesized. The reagents used were purchased directly. The synthesis method of monomethyl 2-fluoroisophthalic acid (S3) was described in the paper (J. Med. Chem. 2009, 52, 1518-1521).

[0355] [Chemical formula 31]

[0356]

[0357] (1) Production of the compound of formula (S4)

[0358] 4-iodoaniline (1.00 g, 4.57 mmol, 1.5 equivalents) was added to a dichloromethane solution (30 mL) of the compound of formula (S3) (594 mg, 3.00 mmol, 1 equivalent), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI-HCl, 867 mg, 4.52 mmol, 1.5 equivalents) and 4-dimethylaminopyridine (DMAP, 370 mg, 3.03 mmol, 1 equivalent), and the mixture was stirred at room temperature for 20 hours. Hydrochloric acid solution (1 mol / L, 20 mL) was added to the mixture and stirred, and then extracted twice with chloroform. The combined organic phase was washed with hydrochloric acid solution and saturated brine, and then dehydrated with anhydrous sodium sulfate. After the solvent was distilled off from the organic phase under reduced pressure, acetone was added to the solid residue and heated to 70° C. to dissolve it. The acetone solution was cooled and then purified by silica gel column chromatography (n-hexane / EtOAc=9 / 1 to 6 / 4) to obtain a compound of formula (S4) (1.09 g, 2.74 mmol, yield: 91.2%).

[0359] 1 H NMR(CDCl3)δ3.98(s,3H),7.40(dd,J H-H =8.0,8.0Hz,1H),7.44-7.47(AA'BB',2H),7.68-7.70(AA'BB',2H),8.12(ddd,J H-H =8.0,2.0Hz,J H-F =8.0Hz 1H),8.34(ddd,J H-H =8.0,2.0Hz,J H-F =8.0Hz 1H),8.41(d,J H-F =15.0Hz,1H);

[0360] 19 F NMR (CDCl3) δ-112.7 (d, JF-H=15.0Hz, 1F);

[0361] HRMS(ESI + )m / z 399.9839 (calculated to be C 10 H 10 FO4 + 、399.9840、[M+H] + ).

[0362] (2) Production of the compound of formula (S5)

[0363] The compound of formula (S4) (1.09 g, 2.73 mmol, 1 equivalent) was dissolved in a mixed solvent of dichloromethane (20 mL), methanol (5 mL) and water (5 mL). Sodium hydroxide (3.28 g, 8.21 mmol, 30 equivalents) was added to the solution, and the resulting mixture was stirred at room temperature for 23 hours. Hydrochloric acid solution (1 mol / L, 100 mL) was added to the mixture, and the resulting white solid was recovered by reduced pressure filtration to obtain a compound of formula (S5) (980 mg, 2.54 mmol, yield 93.2%).

[0364] 1 H NMR (acetone-d6) δ7.44 (dd, J H-H =8.0,8.0Hz,1H),7.66-7.74(m,4H),7.96-8.00(m,1H),8.07-8.11(m,1H),9.70(s,1H);

[0365] 19 F NMR (acetone-d6) δ-113.2 (1F);

[0366] HRMS(ESI - )m / z 383.9540 (calculated as C 14 H8FINO3 - 、383.9538、[MH] - )

[0367] (3) Production of the compound of formula (S6)

[0368] To a THF solution (10 mL) of the compound of formula (S5) (790 mg, 2.05 mmol, 1 equivalent) was added thionyl chloride (1.45 mL, 20.0 mmol, 20 equivalents), and the resulting mixture was heated to 80°C and stirred for 2 hours. After cooling to room temperature, the mixture was dried under reduced pressure. THF (10 mL), 3-methyl-4-aminobenzonitrile (397 mg, 3.00 mmol, 1.5 equivalents) and N,N-diisopropylethylamine (0.696 mL, 4.00 mmol, 2 equivalents) were added to the resulting residue, and the resulting mixture was stirred at room temperature for 20 hours. Hydrochloric acid solution (1 mol / L, 10 mL) was added to the mixture and stirred, and then extracted 3 times with ethyl acetate. The combined organic phase was washed with hydrochloric acid solution, sodium bicarbonate aqueous solution and saturated brine in sequence, and then dehydrated with anhydrous sodium sulfate. After the solvent was distilled off from the organic phase under reduced pressure, acetone was added to the solid residue and heated to 70°C to dissolve it. After the acetone solution was cooled, a small amount of hexane was added to precipitate a solid. The solid was filtered to obtain a compound of formula (S6) (647 mg, 1.30 mmol, yield 64.8%).

[0369] 1 H NMR (acetone-d6) δ 2.45 (s, 3H), 7.49 (dd, J H-H =8.0,8.0Hz,2H),7.66-7.70(m,4H),7.72-7.75(m,2H),7.92-7.96(m,1H),8.01-8.06(m,1H),8.24(d,J H-H =8.8Hz,1H),9.33(s,1H),9.86(s,1H);

[0370] 19 F NMR (acetone-d6) δ-116.5 (1F);

[0371] HRMS(ESI - )m / z 498.0122 (calculated as C 22 H 14 FIN3O2 - 、498.0120、[MH] - )

[0372] (4) Preparation of compound CBT-398

[0373] Hexa-n-butyltin (1.14 mL, 2.24 mmol, 2.5 equiv) was added to a toluene solution (9 mL) of the compound of formula (S6) (449 mg, 0.90 mmol, 1 equiv), palladium (II) acetate (12.5 mg, 55.7 μmol, 0.05 equiv) and tricyclohexylphosphine (25.3 mg, 90.2 μmol, 0.1 equiv), and the resulting mixture was heated to 110° C. and stirred for 24 hours. The mixture was cooled to room temperature, added with water (5 mL) and stirred, and then extracted with ethyl acetate three times. The combined organic phase was washed with saturated brine and dehydrated with anhydrous sodium sulfate. After the solvent was distilled off from the organic phase under reduced pressure, the residue was purified by silica gel column chromatography (n-hexane / EtOAc=9 / 1 to 7 / 3) to obtain compound CBT-398 (442 mg, 0.667 mmol, yield of 74.1%).

[0374] 1 H NMR (acetone-d6) δ 0.89 (t, J H-H =7.6Hz,9H),1.03-1.20(m,6H),1.31-1.40(m,6H),1.59-1.68(m,6H),2.46(s,3H),7.47-7.52(m ,3H),7.67-7.70(m,2H),7.78-7.80(AA'BB',2H),7.93-7.97(m,1H),8.02-8.28(m,1H),8.29(d,J H-H =8.4Hz,1H),9.25(d,J H-F =4.8Hz,1H),9.57(s,1H);

[0375] 19 F NMR (acetone-d6) δ-116.6 (1F);

[0376] HRMS(ESI - )m / z 662.2208 (calculated to be C 34 H 41 FIN3O2Sn - 、662.2210、[MH] - )

[0377] (5) Compound [ 18 F] Manufacturing of CBT-209

[0378] [Chemical formula 32]

[0379]

[0380] A sealed vial and a V-shaped bottle for reaction were prepared. The reaction was carried out using an oven-dried apparatus, and before the start of the reaction, the reaction container was heated at 150° C. while repeatedly reducing pressure and increasing pressure with helium to dry the flow path.

[0381] exist[ 18 F] Ten minutes before the completion of the production of fluoride ions, a solution of compound CBT-398 (5.3 mg, 8.0 μmol) in N,N-dimethylacetamide (300 μL) and a solution of copper (II) trifluoromethanesulfonate (8.7 mg, 24 μmol) and pyridine (9.7 μL, 120 μmol) in N,N-dimethylacetamide (300 μL) were prepared.

[0382] right[ 18 O]H2O (2 mL, 18 O:>98atom%Taiyo Nippon Sanso Corp., F03-0027) was irradiated with proton laser (35μA) for 40 minutes using a cyclotron (CYPRIS HN-12S) manufactured by Sumitomo Heavy Industries, Ltd., to synthesize [ 18 F] fluoride ion (about 40 GBq). 18 F] fluoride ions were transferred to a sealed vial set inside the labeling synthesis device. After confirming that the value of the RI detector adjacent to the sealed vial showed a maximum value, the sealed vial was pressurized with nitrogen at a flow rate of 500 mL / min, thereby transferring the [ 18 F]fluoride ion 18 O]H2O transfer, passing it through an ion exchange resin (Waters, 186004540), 18 After confirming that the value of the RI detector adjacent to the ion exchange resin shows the maximum value, the pressurization by nitrogen gas is stopped and the [ 18 The fluoride ions were eluted with a mixed solvent containing potassium trifluoromethanesulfonate (5 mg), potassium carbonate (50 μg) in an aqueous solution (500 μL) and acetonitrile (1 mL) and transferred to a V-shaped flask for reaction. 18 F] Potassium fluoride solution was decompressed at 130°C for 5 minutes to distill off water. Acetonitrile (600 μL) was added to the small amount of solution remaining, and the decompression was reduced at 150°C for 5 minutes to azeotropize the water. This was repeated once more to prepare anhydrous [ 18 F] Potassium fluoride.

[0383] Into the reaction V-shaped flask, introduce the N,N-dimethylacetamide solution (300 μL) of the compound CBT-398 (5.3 mg, 8.0 μmol), followed by the N,N-dimethylacetamide solution (300 μL) of copper (II) trifluoromethanesulfonate (8.7 mg, 24 μmol) and pyridine (9.7 μL, 120 μmol), and heat at 140°C for 30 minutes. After the V-shaped flask was cooled to room temperature, a mixed solvent of acetonitrile (500 μL) and water (500 μL) was introduced into the V-shaped flask, and the obtained mixture was filtered with a membrane filter (PVDF, 0.2 μm, diameter 13 mm, GE Helthcare Life Science, 6779-1302), and then introduced into semi-preparative HPLC. Referring to the UV sensor and RI detector attached to the HPLC, the samples containing the compound [ 18 F]CBT-209 fraction. The fraction was transferred to a flask placed on an evaporator set in a heat unit, heated under reduced pressure and removed by reduced pressure distillation for 3 minutes. After the flask reached normal temperature and pressure, the diluent solution for administration (physiological saline: propylene glycol: Tween80 = 100:10:1, 0.7 mL) was introduced into the flask and rotated and stirred for 40 seconds. The obtained solution was passed through a membrane filter (PVDF, 0.45 μm, diameter 33 mm, Merck, SLHV033NB) and transferred to a dosing bottle, thereby obtaining compound [ 18 F] Solution of CBT-209.

[0384] The obtained compound [ 18 The total radiation energy of the solution of F]CBT-209 was measured using a radiation dose calibrator (CAPINTEC, Inc., 5130-3235). In addition, the purity test was performed using HPLC equipped with a UV detector and an RI detector. In addition, the density of the obtained solution was recorded as 1 g / mL, and the compound [ 18 The concentration of F]CBT-209 was calculated by UV absorption, and the ratio to the total radiation energy was calculated to calculate the non-radiation energy. The following shows an example of detailed analysis conditions and results of HPLC in semi-preparative and purity testing.

[0385] [Conditions for semi-preparative HPLC]

[0386] Column: COSMOSIL 5C18-MS-II (Nacalai Tesque) 10×20 mm and 10×250 mm were connected and used;

[0387] Flow rate: 5 mL / min; mobile phase: acetonitrile / H2O=48:52;

[0388] UV detection wavelength: 254nm; retention time: 24.9 minutes

[0389] [Analytical HPLC conditions]

[0390] Column: COSMOSIL 5C18-MS-II (Nacalai Tesque) 4.6×150mm;

[0391] Flow rate: 1 mL / min; mobile phase: acetonitrile / H2O=50:50

[0392] UV detection wavelength: 254nm; retention time: 7.3 minutes

[0393] [[ 18 F]Analysis results of CBT-209 solution ([ 18 F] Data after 89 minutes of fluoride ion synthesis)

[0394] Total radiation energy: 2190MB1; Specific radiation energy: 50.0GBq / μmol; Volume of solution: 3.8mL;

[0395] [ 18 F] Weight concentration of CBT-209: 4.50 μg / mL; Chemical purity: >99.9%; Radiochemical purity: >99.9%

[0396] <Mouse PET imaging>

[0397] As a model animal without HBV infectivity, a capsid forced expression model mouse was prepared for the experiment. 40 μg of plasmid pCI-HBc encoding only the capsid protein HBcAg was dissolved in 1 / 10 of the body weight of each mouse + 100 μL of PBS solution (for example, if the mouse weighs 20 g, the total is 2.1 mL), and administered to 6-week-old male BALB / c mice by hydrodynamic injection, thereby preparing a capsid forced expression model mouse. About 24 hours after the administration of the PBS solution, the mice were kept on the imaging bed of a small animal PET device (Siemens, microPET Focus 220) under isoflurane 1.5% inhalation anesthesia, and the compound [ 18 F] CBT-078 was prepared into 50MBq / 0.03nmol / 100μL physiological saline (containing 1% Tween80), or the compound [ 18F] CBT-209 was prepared into 20MBq / 0.01nmol / PBS 100μL physiological saline (containing 1% Tween80) and administered through the tail vein. Imaging started at the same time as the administration, and after 90 minutes of data collection, the subject was temporarily awakened, and PET imaging was performed again under isoflurane 1.5% inhalation anesthesia 30 minutes after 3 hours of administration. After converting the collected data into a dynamic sinusoidal graph, it was reconstructed into a three-dimensional dynamic image by the filtered back projection method using the ramp filter cutoff frequency at the Nyquist frequency. The data for every 30 minutes is displayed in the results as an integrated maximum intensity projection image (MIP image). The obtained results are shown in Figure 1 .

[0398] Depend on Figure 1 It was confirmed that the compound [ 18 F]CBT-078 is visible based on F - The bone accumulation of the compound [ 18 F]CBT-209 significantly decreased, and the retention of liver accumulation was improved. On the other hand, in the case of compound [ 18 In the case of CBT-209, the compound [ 18 Compared with F]CBT-078, changes in the distribution of fat tissue and other organs throughout the body were also confirmed, suggesting that fat accumulation and the body dynamics are improved through the elimination effect.

[0399] The metabolic stability test of compound CBT-078 and compound CBT-209 was performed using liver microsomes. The operation was as follows.

[0400] 10 μL of 50 μM CBT-078 or CBT-209 was added to a microsome reaction solution consisting of 422.5 μL of 100 mM phosphate buffer (pH 7.4), 5 μL of 300 mM magnesium chloride solution, and 12.5 μL of 20 mg / mL liver microsomes (human, mouse, rat, all manufactured by Zeno Tech) and pre-incubated for 15 minutes. 50 μL of NADPH regeneration system (85 mM D-glucose-6-phosphate, 10 mM β-nicotinamide adenine dinucleotide oxidized form, 10∪ / mL glucose-6-phosphate dehydrogenase, all manufactured by Oriental Yeast Industries) was added thereto and mixed, and incubation was started. The incubation start time point was recorded as reaction 0 minutes, and 50 μL of the reaction solution after 0, 30, and 60 minutes of reaction was aliquoted into 200 μL of ice-cooled 0.5 μM propranolol / acetonitrile solution to stop the reaction. The obtained fraction was transferred to a protein removal plate (manufactured by Phenomenex), and after suction filtration using a 96-well plate manifold, the filtrate was recovered in a 96-well plate for recovery. 100 μL of the recovered filtrate was transferred to a 96-well plate and dried using a nitrogen blow high-speed concentrator (Turbo Vap96, manufactured by Biotage). After the dried sample was dissolved by adding the initial mobile phase, the target compound was quantified by liquid chromatography-tandem mass spectrometry (LC-MS / MS). The peak area ratio of CBT-078 or CBT-209 to propranolol (internal standard) in the sample was calculated, and the metabolic stability was evaluated by "residual rate (%) = (peak area ratio of incubation for 30 minutes or 60 minutes / peak area ratio of incubation for 0 minutes) × 100". As a counting replicate (Technical Replicate), the residual rate was calculated in two independent series for each animal species and each evaluation compound.

[0401] The LC-MS / MS consists of the following. High performance liquid chromatography: Nexera X2 UPLC system (manufactured by Shimadzu Corporation), column: ACQUITY UPLC BEH C18 Column, 130A, 1.7μm, 2.1××50mm (manufactured by Waters Corporation), guard column: ACQUITY UPLC BEH C18 VanGuard Column, 130A, 1.7μm, 2.1××50mm (manufactured by Waters Corporation), mobile phase A: 0.1% formic acid aqueous solution / acetonitrile (9:1, v / v), mobile phase B: 0.1% formic acid aqueous solution / acetonitrile (1:9, v / v), gradient conditions 0 - 1 minute; 30% B, 1 - 1.5 minutes; 30 - 100% B, 1.5 - 3.5 minutes; 100% B, 3.5 - 5 minutes; 30% B, mass spectrometer: QTRAP4500 (manufactured by AB Sciex Corporation). The compound to be measured is ionized by the ESI method, and the target ions are measured by the multiple reaction monitoring technique. The results obtained are shown in Table 5.

[0402] [Table 5]

[0403]

[0404] It was confirmed from Table 5 that the metabolic stability after hepatic accumulation was improved in the case of compound CBT-209 compared with compound CBT-078.

[0405] <Inhibitory effects on HBsAg, HBeAg, and pgRNA>

[0406] Primary cultured human hepatocytes infected with HBV were treated with 0.01 - 100 mM of compound CBT-289 or entecavir (ETV), and the amounts of HBsAg, HBeAg in the culture medium and the amount of pgRNA in the cells were measured. The results are shown in Figure 2 .

[0407] As Figure 2 shown, compound CBT-289 inhibited HBsAg, HBeAg, and pgRNA in a concentration-dependent manner. On the other hand, ETV did not inhibit.

[0408] <Inhibitory effects on cccDNA and pgRNA>

[0409] cccDNA inhibitory effect assay

[0410] At 0.7×10 5Cell / well density Fresh human hepatocytes derived from PXB mice (PXB cells; Phoenixbio) were spread on a collagen-coated 96-well plate (FALCON) and cultured for 7 days at 37°C and 5% CO2 using dHCGM medium (homemade). Genotype C HBV (Phoenixbio) was added to the culture solution together with 4% PEG8000 to a final density of 3.5×10 5 The culture medium was replaced after 1 day and every 3 or 4 days thereafter. The test compound was added after 28 days and 3 wells of cells were cultured for each condition. The culture medium containing the test compound was then replaced after 3 or 4 days. After 7 days, DNA was extracted and purified from the cells using Agencourt DNAdvance (manufactured by Beckman-Coulter), mixed with DNA solution (2 μL) and Probe qPCR (manufactured by TAKARA) (5 μL), 100 μM primers (0.02 μL) (ccc DNA Fr: GTGGCTATCCTGCCTTAAT (sequence number 9), cccDNA Rv: CAGAGCTGAGGCGGTGTC (sequence number 10)), 100 μM probe (0.01 μL) (ccc DNA: [FAM]AGTTGGCGAGAAAGTGAAAGCCTGC[TAM] (sequence number 11)), and qPCR reaction was carried out at 95°C for 1 minute, followed by 50 cycles of "95°C for 10 seconds, followed by 60°C for 30 seconds", and the signal was detected using CFX96 Touch Real-Time PCR Detection System (manufactured by Bio-rad) for HBV. The amount of DNA (HBV gene copy number) was quantified.

[0411] Assay for the inhibitory effect of pgRNA

[0412] 0.7×10 5 Cell / well density Fresh human hepatocytes derived from PXB mice (PXB cells; manufactured by Phoenixbio) were spread on a collagen-coated 96-well plate (manufactured by FALCON) and cultured for 7 days at 37°C and 5% CO2 using dHCGM medium (homemade). Genotype D HBV (homemade from Hep2.2.15.7 cells) was added to the culture solution together with 4% PEG8000 to a final density of 3×10 7The culture medium was replaced after 1 day and every 3 or 4 days thereafter. The test compound was added after 28 days and 3 wells of cells were cultured for each condition. The medium containing the test compound was then replaced after 3 or 4 days. After 7 days, total RNA was extracted and purified from the cells using Agencourt RNAdvance (Beckman-Coulter), reverse transcribed using PrimeScript RT ragent kit (PerfectReal Time), mixed with cDNA solution (2 μL) and TB Green Premix Ex Taq II (TIi RNaseHPlus) (TAKARA) (5 μL), 100 μM primer (0.02 μL) (pg RNA Fr: CT CAATCTCGGGAATCTCAATGT (SEQ ID NO: 4), pg RNA Rv: GGATAGA ACCTAGCAGGCATAAT (SEQ ID NO: 5)), and qPCR reaction was carried out at 95°C for 1 minute, followed by 50 cycles of "95°C for 10 seconds, followed by 60°C for 30 seconds", and the signal was detected using CFX96 Touch Real-Time PCR Detection System (Bio-rad), and the pgRNA amount (pg The results are shown in Figure 3 .

[0413] like Figure 3 As shown, compound CBT-289 inhibited cccDNA and pgRNA in a concentration-dependent manner.

[0414] <Anti-HBV activity assay of compound CBT-209 using human hepatocyte chimeric mice infected with hepatitis B virus>

[0415] Human hepatocyte transplantation chimeric mice (PXB mice)<http: / / phoenixbio.co.jp / pxb / pxb-mouse.html> ; Phoenixbio) 1×10 7 The number of copies of genotype C HBV (Phoenixbio) was sufficient to allow the virus to grow to 1×10 8 After the number of copies / ml serum was measured, 10 mg / kg of compound CBT-209 (solvent: corn oil) was orally administered twice a day for 21 days (5 mice per group). Blood was collected from mice on days 0, 7, 14, and 21 after administration, and the amount of HBV DNA in serum was measured.

[0416] The serum and HBV DNA in the serum were mixed with HBV pretreatment solution, and heat-treated at 98°C for 5 minutes to inactivate HBV and expose HBV DNA. PCR reaction and analysis were performed using KUBIX HBV qPCR Kit (KUBIX Co., Ltd.) and CFX96 Touch (registered trademark) real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). 10 μL of HBV 2×PCR solution (forward primer: CACATCAGGAT TCCTAGGACC (sequence number 6), reverse primer: AGGTTGGTGAGTGATTGGAG (sequence number 7), probe: CAGAGTCTAGACTCGTGGTGGACTTC (sequence number 8)) was mixed with 10 μL of heat-treated standard or test sample. The PCR reaction was performed at 95°C for 2 minutes, followed by 45 cycles of "95°C for 5 seconds, followed by 54°C for 30 seconds". The HBV DNA concentration in the blood was calculated by averaging the values ​​of the two wells. Statistical calculations were performed using Excel under the conditions of a two-tailed t-test. As a control, GLS4 or a vehicle was administered instead of compound CBT-209. The results obtained are shown in Figure 4 .

[0417] like Figure 4 As shown, it was confirmed that the amount of HBV DNA in human hepatocyte chimeric mice infected with hepatitis B virus to which the compound CBT-209 was administered was statistically significantly reduced compared with GLS4 or the vector.

[0418] <Inhibitory effect on the existing capsid formation inhibitor system mutant HBc T33N>

[0419] The HBV replication inhibitory activity of the compound was evaluated using the evaluation method described in WO2018 / 30534 "Hepatitis B therapeutic composition and method for evaluating the replication activity of hepatitis B virus" and "HBV replication analysis". The expression plasmids reporting pgRNA, HBc, HBV-pol and HBx were introduced into HeLa cells by electroporation using Nepa21 manufactured by Nepagene. In addition to the wild-type (WT) HBc expression plasmid, HBc P25G and HBc T33N expression plasmids that introduced mutations that show resistance to existing capsid inhibitors were used. Cells were added to a plate to which the compound had been diluted in stages and cultured. After 24 hours of culture, the cells were treated with a low-pressure solution, the DNA in the cytoplasm was extracted, and HBV replication was measured by qPCR using specific primers. The obtained HBV replication analysis results (IC 50 ) are shown in Table 6. The results of WST-8 analysis (IC25 ) are shown in Table 7.

[0420] [Table 6]

[0421] WT HBc P25 HBc T33N CBT-209 0.051 0.433 8.961 CBT-078 0.076 0.530 12.707 GLS4 0.121 0.963 13.179

[0422] [Table 7]

[0423] WT HBc P25 HBc T33N CBT-209 ＞20.000 ＞20.000 ＞20.000 CBT-078 ＞20.000 ＞20.000 ＞20.000 GLS4 ＞20.000 ＞20.000 ＞20.000

[0424] As shown in Table 6, it was confirmed that compound CBT-209 showed stronger inhibitory activity than conventional GLS4 and compound CBT-078. In addition, as shown in Table 7, it was confirmed that compound CBT-209 showed no toxicity, similar to conventional GLS4 and compound CBT-078.

[0425] <Analysis of the mechanism of capsid formation inhibition using electron microscopy>

[0426] An expression plasmid was prepared in which the ubiquitin-like protein SUMO was fused as a tag to the sequence of the binding region (1-149) of HBc of genotype C, and introduced into the Escherichia coli KRX strain to express and purify the recombinant protein. After the tag was removed by cleaving the recombinant HBc (1-149) with SUMO protease, the diploid peak was separated by gel filtration for subsequent analysis. 11μM HBc (1-149) and 15μM CBT compound were mixed in 20mM Tris-HCl (pH 7.5) and 100mM NaCl solution, incubated overnight at 4°C, and then the binding state was studied by gel filtration using Superose6 10 / 30GL. The results are shown in Figure 5 .

[0427] In the state where no compound was added, HBc (1-149) eluted at a position corresponding to the diploid, but when compound CBT-209 or compound CBT-213 was added, the elution peak shifted to a position corresponding to the capsid. This is the same behavior as compound CBT-078. In addition, when the incubation time with the compound was extended to 7 days, in the case where compound CBT-209 or compound CBT-213 was added, the elution peak was observed only at the capsid position, as in the case of overnight incubation. The elution peak at the position corresponding to the capsid was separated and negatively stained images were taken with an electron microscope. As a result, when either compound CBT-209 or compound CBT-213 was added, an image close to the particle size of a complete capsid formed when the HBc concentration or salt concentration was increased without adding the compound was observed. That is, the capsid formed by compound CBT-209 and compound CBT-213 is stable even after 7 days of incubation.

[0428] Depend on Figure 5It is known that compound CBT-209 and compound CBT-213 bind to the binding surface of HBc to promote the binding of HBc and form a hollow capsid in a stable state. In addition, it was confirmed that compound CBT-209 and compound CBT-213 also exert antiviral activity against viruses having a conventional capsid formation inhibitor resistance mutation, namely, HBc T33N mutation.

Claims

1. An anti-HBV agent comprising a compound of formula (I) or a salt thereof, In the formula, R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown, The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl, n1 is an integer from 1 to 5, R 2 It is phenyl substituted by halogen.

2. The anti-HBV agent according to claim 1, wherein The compound of formula (I) is a compound of formula (II) below, In the formula, R 5 For R 6 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, The R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown, The R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl, n2 is an integer from 1 to 5.

3. A compound of formula (I) or a salt thereof, In the formula, R 1 For -CN or R 3 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, The R 3 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 4 -(CH2) n1 - the group shown, The R 4 is CH2=CH-, phenyl, cyclohexyl or morpholinyl, n1 is an integer from 1 to 5, R 2 It is phenyl substituted by halogen.

4. A compound of formula (II) or a salt thereof, In the formula, R 5 For R 6 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, The R 6 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 7 -(CH2) n2 - the group shown, The R 7 is CH2=CH-, phenyl, cyclohexyl or morpholinyl, n2 is an integer from 1 to 5.

5. A HBV capsid formation inhibitor, comprising the compound of formula (I) or a salt thereof according to claim 3, or the compound of formula (II) or a salt thereof according to claim 4.

6. A compound of formula (III) or a salt thereof, In the formula, R 15 For R 16 A group represented by -NH-CO- and a phenyl group substituted by an alkyl group having 1 to 6 carbon atoms, The R 16 is an alkyl group having 1 to 10 carbon atoms or a group of formula R 17 -(CH2) n3 - the group shown, The R 17 is CH2=CH-, phenyl, cyclohexyl or morpholinyl, n3 is an integer from 1 to 5. The compound of formula (III) is used 11 C, or, if containing fluorine atoms, 18 F mark. 7 . A PET probe for imaging, which targets hepatitis B antigen protein comprising the compound of formula (III) or a salt thereof according to claim 6 .

Images