Dendrimer-mediated targeted intracellular CRISPR / CAS system delivery and gene editing

Abstract

A dendrimer-conjugated genome editing composition has been established for safe and efficient cellular targeting and intracellular delivery of genome editing systems. Compositions and methods for genome editing and gene regulation in one or more diseases and disorders are described. Compositions include dendrimers conjugated to a gene editing system, preferably a CRISPR / Cas system. In a preferred embodiment, the dendrimer is covalently conjugated to a Cas9 nuclease, which is further complexed with a unidirectional guide RNA that specifically targets a genomic fragment of a target cell.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit and priority of USSN 63 / 391,598, filed on July 22, 2022, the entire contents of which are incorporated herein in their entirety.

[0003] Sequence Listing References

[0004] Pursuant to 37 C.FR §1.834(c)(1), the sequence listing submitted on July 24, 2023 is incorporated herein by reference as a text file named “JHU_C_17439_ST26.xml” created on July 24, 2023, with a size of 6,335 bytes. Field of the Invention

[0005] The present invention is generally in the field of selectively targeted genetic modification using CRISPR-CAS based genome editing systems conjugated to dendrimers. Background of the Invention

[0007] Clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas9 ribonucleoprotein (RNP) has been used as an effective tool for targeted genome editing with a wide range of applications including gene disruption, correction, transcription and translation in various systems including human cells (Jinek, M. et al., Science 337, 816-821, (2012); Liu, et al., J Control Release 266, 17-26, (2017); Suresh, et al., Methods Mol Biol 1507, 81-94, (2017); Liang, X. et al., Journal of Biotechnology 208, 44-53, (2015); Mout, et al., Bioconjug Chem 28, 880-884, (2017)). The CRISPR / Cas9 system includes the Streptococcus pyogenes Cas9 nuclease and a single guide RNA (sgRNA): the nuclease protein Cas9 cuts specific double-stranded DNA, while the sgRNA recognizes a specific target genomic region and translocates the sgRNA / Cas9 complex to the target DNA sequence in the cell (Sander, et al. Nat Biotechnol 32, 347-355, (2014); Jinek, M. et al., Science 343, 1247997, (2014)). The targeting RNA consists of a sequence of about 20 nt complementary to the target DNA (protospacer sequence) and has a sequence requirement of a protospacer adjacent motif (PAM) (5'-NGG) (Jinek, M. et al., Science 337, 816-821, (2012); van der Oost et al., Nat Rev Microbiol 12, 479-492, (2014)). As the CRISPR / Cas9 system advances toward clinical translational research, issues such as targeted delivery, cytotoxicity, serum stability, off-target mutations, safe nuclear entry, and immunogenicity must be addressed.

[0008] Efficient delivery of Cas9 RNP is essential for effective genome editing (Zhang, et al., Theranostics 11, 614-648, (2021); Glass, et al., Trends in biotechnology 36, 173-185, (2018)). Direct delivery of Cas9-RNP can significantly reduce off-target mutations, achieve efficient gene editing, and reduce off-target effects, toxicity, and immune responses. RNP delivery can even provide genome editing efficacy in embryonic stem cells, induced pluripotent stem cells, and tissue stem cells (D'Astolfo, DS et al., Cell 161, 674-690, (2015)). However, due to the size and charge characteristics of the RNP complex and the binding properties of proteins and nucleic acids, specific measures must be considered when designing the delivery system of RNP. Several studies have reported the delivery of Cas9 RNPs by rigorous physical methods, including microinjection (Chang, N. et al., Cell Research 23, 465-472, (2013); Yan, Q. et al., Cell Regeneration 3, 3:12, (2014); Al-Dosari, MS, Knapp, JE & Liu, D. in Advances in Genetics Vol. 54, 65-82 (Academic Press, 2005)), hydrodynamic injection (Yin, H. et al., Nat Biotechnol 32, 551-553, (2014)), electroporation (Wang, L. et al., Cell Res 30, 276-278, (2020)), acoustic-assisted transfection, chemical transfection or the use of modified DNA nanoparticles (Sun, W. et al., Angewandte Chemie International Edition 54, 12029-12033, (2015)). Liposome and polymer-based delivery have been found to be the most successful in Cas9-RNP delivery and have been successfully used in oncology applications (Yu, X. et al., Biotechnol Lett 38, 919-929, (2016); Kang, YK et al., Bioconjugate Chemistry 28, 957-967, (2017)). Viral vectors are very effective in CRISPR-Cas9 delivery, but there are problems with immunogenicity, carcinogenicity and limited DNA packaging capacity. For example, gene delivery with adeno-associated viruses (AAVs) is currently one of the most advanced technologies for in vivo delivery of Cas9 ( S.Molecular Therapy 20, 1831-1832, (2012)). However, a large proportion of the population has pre-existing immune concerns about AAV, which limits the development of AAV-based Cas9 therapy. In addition, AAV-based Cas9 delivery is susceptible to off-target genomic damage and limited packaging capacity. Therefore, the development of a stable, non-immunogenic, cell-targeted delivery method is crucial to advance the clinical translation of the CRISPR / Cas9 system. Improved scalable methods for cell targeting and intracellular delivery of CRISPR / Cas constructs will accelerate clinical translation.

[0009] Therefore, an object of the present invention is to provide compositions and methods for preparing and using the compositions for safe and effective cell targeting and intracellular delivery of CRISPR / Cas constructs.

[0010] It is also an object of the present invention to provide compositions and methods for genome editing and gene regulation for one or more diseases and disorders. SUMMARY OF THE INVENTION

[0012] A genome editing composition for genome modification of cells has been developed. The genome editing composition includes a dendrimer and a gene editing system. Typically, the dendrimer is covalently conjugated to the gene editing system, optionally through a linker. Exemplary gene editing systems include CRISPR systems, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs). In a preferred embodiment, the gene editing system is a CRISPR system, which includes a Cas nuclease and a single guide RNA (sgRNA). In a further preferred embodiment, the Cas nuclease includes one or more nuclear localization signals. Exemplary Cas nucleases include Cas9, CasX, Cas7-11, CasFx, Cas12a, and Cas13. In a preferred embodiment, the dendrimer is covalently conjugated to the Cas9 nuclease, optionally covalently conjugated to the sgRNA. In a further preferred embodiment, the Cas9 nuclease is a Streptococcus pyogenes Cas9 nuclease. Typically, the Cas9 nuclease is conjugated to the dendrimer at a ratio of 1:1 to 4:1 protein to dendrimer.

[0013] The dendrimer can be covalently conjugated to the gene editing system via one or more of a disulfide bond, an ester bond, an ether bond, or an amide bond, and optionally a hydrocarbon chain or an oligoethylene glycol chain. In some embodiments, the dendrimer is covalently conjugated to the gene editing system via a releasable bond. To improve intracellular delivery of the composition, the linker preferably includes a glutathione-sensitive disulfide bond, such as a γ-aminobutyric acid linker.

[0014] Dendrimers of different generations are suitable for use in genome editing compositions. In some embodiments, the dendrimer is a 1, 2, 3, 4, 5, 6, 7, 8, or 9 generation dendrimer. In some embodiments, the dendrimer is a poly(amidoamine) (PAMAM) dendrimer, such as a hydroxyl, amine, carboxylic acid, acetamide terminated PAMAM dendrimer. In a preferred embodiment, the dendrimer is a hydroxyl terminated PAMAM dendrimer, such as a 4, 5, or 6 generation hydroxyl terminated PAMAM dendrimer. In some embodiments, the dendrimer is a glucose dendrimer comprising a central core of dipentaerythritol and one or more branching units of a monosaccharide glucose molecule, optionally with a linker conjugated thereto. In some embodiments, the glucose dendrimer is a 1 generation dendrimer having the following structure:

[0015]

[0016] In another embodiment, the glucose dendrimer is a generation 2 dendrimer having the following structure:

[0017]

[0018] In some embodiments, the dendrimer is further conjugated to one or more therapeutic, prophylactic, or diagnostic agents, such as small molecules, antibodies or antigen-binding fragments thereof, nucleic acids, and polypeptides. Exemplary therapeutic agents include anti-inflammatory agents, antioxidants, and immunomodulators. Exemplary diagnostic agents include fluorescent dyes, near-infrared dyes, SPECT imaging agents, PET imaging agents, and radioisotopes.

[0019] Also provided are pharmaceutical preparations comprising a genome editing composition and one or more pharmaceutically acceptable excipients. The pharmaceutical composition is formulated for systemic administration, such as parenteral or enteral administration, or topical administration. Exemplary parenteral administration includes intramuscular injection, intraperitoneal injection, intravenous injection, or subcutaneous injection. In some cases, the preparation is formulated for intranasal administration.

[0020] Example of G2 glucose dendrimer (GD2)Cas9 conjugation for targeted neuronal delivery of CRISPR-Cas9 ribonucleoprotein.

[0021] The method for changing, adding and / or deleting a genomic fragment in a target cell of a subject in need comprises administering to the subject an effective amount of a dendrimer-gene editing composition or a pharmaceutical preparation thereof. Preferably, the composition or pharmaceutical preparation is administered parenterally or enterally, such as by intramuscular injection, intraperitoneal injection, intravenous injection or subcutaneous injection. In some embodiments, the genome editing composition comprises a Cas9 nuclease and an sgRNA specific for a genomic fragment in a cell. In some embodiments, an effective amount of the pharmaceutical preparation is administered to treat monogenic and polygenic diseases, such as cystic fibrosis, hemophilia, hemoglobinopathies (such as sickle cell anemia and β-thalassemia), xeroderma pigmentosum, and lysosomal storage diseases. In a preferred embodiment, the pharmaceutical preparation is administered in an effective amount to treat genetic diseases, such as eye diseases, neurological and / or neurodegenerative diseases, neurodevelopmental diseases, and cancer.

[0022] Exemplary eye diseases treated with pharmaceutical preparations include age-related macular degeneration, choroidal neovascularization, retinitis pigmentosa, Stargardt disease, and Leber congenital amaurosis. In the case of AMD, sgRNA specific to vascular endothelial growth factor (VEGF) can be used, and the preparation is administered in an effective amount to induce a decrease in the expression, translation, or activity of VEGF in retinal cells by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, until 100%.

[0023] Exemplary neurological and / or neurodegenerative diseases suitable for pharmaceutical preparations include Huntington's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, childhood cerebral adrenoleukodystrophy (ccALD), muscular dystrophy, Friedreich's ataxia, spinocerebellar ataxia, Duchenne muscular dystrophy and spinal muscular dystrophy. Exemplary neurodevelopmental diseases include cerebral palsy, fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease and sphingolipid storage diseases.

[0024] Exemplary cancers to be treated include bone cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer and uterine cancer. Typically, the pharmaceutical preparation is administered in an effective amount to induce a decrease in the expression, translation or activity of one or more oncogenes in the cancer by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100%. In other embodiments, the pharmaceutical preparation is administered in an effective amount to induce a decrease in the expression, translation or activity of one or more immunomodulatory factors such as PD-1 or PD-L1 by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100%. In a preferred embodiment, the method comprises changing, adding and / or deleting at least one nucleotide in the target cell genome fragment.

[0025] The method may also include the step of selecting a subject who may benefit from treatment with the dendrimer-gene editing agent composition. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is a schematic diagram showing the stepwise synthesis of first generation (G1) glucose dendrimers.

[0028] Figure 2 is a schematic diagram showing the stepwise synthesis of second generation (G2) glucose dendrimers.

[0029] Figures 3A-3C is a schematic diagram showing the stepwise synthesis of G2-glucose-PEG4-TCO (3A), and shows the Figure 4 and Figure 5 Chemical structures of intermediates TCO-PEG4-NHS ester (3B) and Cy5 (3B) used in the synthesis shown. Subscript numbers in the formulas indicate the number of attachments per dendrimer.

[0030] Figure 4 is a schematic diagram showing the stepwise synthesis of Cy5-G2-glucose-Cas9(2NLS).

[0031] Figure 5 yes Figure 4 MALDI-TOF of Cy5-GD2-Cas9.

[0032] Figure 6Schematic diagram showing the synthesis of functionalized Cy5-D-PEG4-TCO and synthetic intermediates. Hydroxyl PAMAM dendrimer 6 generation (PAMAM-G6-OH) was treated with a Boc-protected GABA linker and the resulting product was deprotected with TFA. The product was labeled with a Cy5 fluorophore and the resulting intermediate was conjugated with trans-cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO.

[0033] Figure 7 Schematic diagram showing the reaction of Me-Tz-attached Cas9 nuclease 2NLS (Streptococcus pyogenes) and TCO-attached hydroxyPAMAM dendrimer under physiological conditions to form Cy5-D-Cas9(2NLS) conjugates, which were prepared using a click chemistry strategy and trans-cyclooctene-tetrazine (TCO-Tz) chemistry.

[0034] Figure 8 is a graph showing the percentage of cell viability measured by CCK-8 assay in control cells or cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs. Data are presented as mean ± SD (n = 3).

[0035] Fig. 9 Schematic diagram showing the route of Cy5-D-Cas9(2NLS)12 entering the cell nucleus 10. When the dendrimer Cas9 conjugate 14 is effectively delivered to the cytosol 16 of the cell 18, Cy5-D-Cas9-2NLS12 is reduced by intracellular glutathione to release Cas9(2NLS)20, and finally Cas9(2NLS)20 is localized in the cell nucleus 10 or the Cy5-D-Cas9(2NLS) conjugate 14 is delivered to the cell nucleus through the nuclear pore complex 22.

[0036] Fig. 10A is a bar graph showing the percentage of GFP-positive cells in cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to HEK293T cells (GFP-negative) and HEK 293 cells expressing GFP (GFP-positive) based on FACS analysis. Fig. 10B is a bar graph showing the percentage of GFP-positive cells in cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to HEK293T cells (GFP-negative) and HEK 293 cells expressing GFP (GFP-positive) based on GFP expression. Fig. 10CIt is a bar graph showing the percentage of gene-edited cells (GFP-negative cells) in cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to HEK 293 cells expressing GFP (GFP-positive). The data area is expressed as mean ± standard deviation (n = 3). Fig. 10D is a bar graph showing the percentage of gene-edited cells (GFP-negative cells) in HEK293T cells treated with different formulations of Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs.

[0037] Fig.11 is a schematic diagram showing the predicted cleavage site of the GFP target sequence, indicated by the dotted line.

[0038] Fig. 12A and 12B is a bar graph showing the expression of VEGF antibody-treated (VEGF + ) and untreated (VEGF - ) The percentage of gene-edited cells (VEGF-negative cells) in ARPE-19 cells treated with Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to ARPE-19 cells. The data area is expressed as mean ± SD (n = 3). Fig. 12B is a magnified bar graph showing the percentage of gene-edited cells (i.e., VEGF-negative cells) in ARPE-19 cells treated with Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs. Fig. 12C is a bar graph showing the percentage of gene-edited cells (i.e., VEGF-negative cells) in ARPE-19 cells treated with different doses of Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs.

[0039] Fig.13A is a bar graph showing the percentage of VEGF-positive cells in ARPE-19 cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs (VEGFA guide RNA2) compared with VEGF antibody-treated and untreated cells using flow cytometry. Fig. 13B and 13CIt is a bar graph showing the percentage of gene-edited cells (VEGF-negative cells) in ARPE-19 cells treated with D-Cas9 / sgRNA RNPs with VEGF sgRNA-1 or VEGF sgRNA-2, compared with VEGF antibody-treated (VEGF+) and untreated (VEGF-) ARPE-19 cells based on FACS analysis at different scales. The data area is expressed as mean ± standard deviation (n = 3). DETAILED DESCRIPTION OF THE INVENTION

[0041] I. Definitions

[0042] The terms "target gene", "target genome" or "target element" refer to a gene or genomic component within a recipient cell that has been selected for modification by a dendrimer-conjugated CRISPR-Cas system.

[0043] The terms "gene editing", "genome modification" and "genetic manipulation" are used interchangeably and refer to the selective and specific changes to one or more target genes in a recipient cell through the programming of an intracellular CRISPR-Cas system. Editing or altering a target gene or target genome can include one or more deletions, knock-ins, point mutations, or any combination thereof in one or more genes of the recipient cell. Therefore, the result of gene editing can be downregulation or upregulation of one or more genes or expressed gene products compared to control cells without CRISPR-Cas-based gene editing. The extent of change in the presence or activity of a gene or expressed gene product can be all (i.e., 100%) or part (i.e., 1-99.9%) of the level in the control cell.

[0044] In the context of inhibition, the term "inhibit" or "reduce" refers to reducing or decreasing activity and quantity. This can be complete inhibition or reduction of activity or quantity, or partial inhibition or reduction. Inhibition or reduction can be compared to a control or standard level. Inhibition can be measured with a % value, for example, from 1% to 100%, such as 5%, 10%, 25%, 50%, 75%, 80%, 85%, 90%, 95%, 99% or 100%. For example, gene inhibition or deletion can inhibit or reduce the activity and / or expression of one or more target genes, or the activity or quantity of one or more expressed gene products, compared to the activity and / or quantity of the same gene or gene product in a control cell without CRISPR-Cas gene editing, by about 10%, 20%, 30%, 40%, 50%, 75%, 85%, 90%, 95% or 100%. In some embodiments, inhibition and reduction are compared according to the level of mRNA or protein corresponding to the targeted genetic element in the cell.

[0045] The terms "individual," "subject," and "patient" are used interchangeably and refer to mammals, including, but not limited to, rodents, simians, humans, mammalian farm animals, mammalian sports animals, and mammalian pets.

[0046] The terms "active agent" or "bioactive agent" are used interchangeably and refer to chemical or biological compounds that induce a desired pharmacological and / or physiological effect, which may be prophylactic, therapeutic or diagnostic. These may be nucleic acids, nucleic acid analogs, small molecules with a molecular weight of less than 2 kD (more usually less than 1 kD), peptidomimetics, proteins or peptides, carbohydrates or sugars, lipids or combinations thereof. The term also includes pharmaceutically acceptable pharmacologically active derivatives of drugs, including but not limited to salts, esters, amides, prodrugs, active metabolites and analogs. The term "therapeutic agent" refers to an agent that can be administered to treat one or more symptoms of a disease or disorder. The term "diagnostic agent" generally refers to a localizing agent that can be administered to reveal, precisely locate and define a pathological process. Diagnostic agents can label target cells, thereby allowing subsequent detection or imaging of these labeled target cells. In some embodiments, diagnostic agents can selectively target neurons, particularly neurons within pathological sites in the eye, brain or CNS, through dendrimers. The term "prophylactic agent" generally refers to an agent that can be administered to prevent a disease or prevent certain conditions.

[0047] The term "therapeutically effective amount" refers to an amount of a therapeutic agent that, when added to and / or attached to a dendrimer, produces a desired effect at a reasonable benefit / risk ratio applicable to any medical treatment. The effective amount may vary depending on factors such as the disease or condition being treated, the specific targeting construct being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular compound without undue experimentation. In certain embodiments, the term "effective amount" refers to an amount of a therapeutic or prophylactic agent that reduces or eliminates one or more symptoms of an ocular or neurological disease.

[0048] The terms "treat" or "prevent" refer to ameliorating, alleviating or otherwise preventing a disease, disorder or condition from occurring or developing in an animal that may be susceptible to the disease, disorder and / or condition but has not yet been diagnosed as having the disease, disorder or condition; inhibiting a disease, disorder or condition, such as preventing its development; and relieving a disease, disorder or condition, such as causing regression of the disease, disorder and / or condition. Treating a disease or condition includes ameliorating at least one symptom of a particular disease or condition, even if the underlying pathophysiology is not affected, such as treating pain in a subject by administering an analgesic, even if the analgesic does not treat the cause of the pain. Desirable therapeutic effects include reducing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis. For example, if one or more symptoms associated with Alzheimer's disease are alleviated or eliminated, the individual is successfully "treated", including but not limited to, reducing the rate of neuronal loss, reducing symptoms caused by the disease, improving the patient's quality of life, reducing the dose of other drugs required to treat the disease, delaying the progression of the disease, and / or prolonging the individual's survival time.

[0049] The phrases "pharmaceutically acceptable" or "biocompatible" refer to compositions, polymers and other materials and / or dosage forms that are suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problems or complications, and commensurate with a reasonable benefit / risk ratio, within the scope of sound medical judgment. The phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, diluent, solvent or encapsulating material, for carrying or transporting any subject composition from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable", i.e., compatible with the other ingredients of the subject composition and not harmful to the patient.

[0050] The term "biodegradable" generally refers to a material that will degrade or erode under physiological conditions into smaller units or chemicals that can be metabolized, eliminated, or excreted in the body. Degradation time depends on composition and morphology.

[0051] The term "dendrimer" includes, but is not limited to, a molecular structure having an inner core, inner layers or "generations" of repeating units regularly attached to the initiator core, and an outer surface of terminal groups attached to the outermost generations.

[0052] The term "functionalization" refers to modifying a compound or molecule in a manner that results in the attachment of a functional group or moiety. For example, a molecule can be functionalized by introducing a molecule that makes it a strong nucleophile or a strong electrophile.

[0053] The term "targeting moiety" is a moiety that is designated to be located at a specific location or away from a specific location. The moiety can be, for example, a protein, a nucleic acid, a nucleic acid analog, a carbohydrate or a small molecule. The entity can be, for example, a therapeutic compound such as a small molecule, or a diagnostic entity such as a detectable marker. The location can be a tissue, a specific cell type or a subcellular compartment. In one embodiment, the targeting moiety directs the localization of the drug. In a preferred embodiment, the dendrimer composition can selectively target neurons, particularly damaged / overactive neurons, without additional targeting moieties.

[0054] The term "extended residence time" refers to an increase in the time required for a drug to be cleared from a patient's body or an organ or tissue of a patient. In certain embodiments, "extended residence time" refers to an agent whose elimination half-life is 10%, 20%, 50%, or 75% longer than a comparison standard (e.g., a comparable agent not conjugated to a delivery vehicle such as a dendrimer). In certain embodiments, "extended residence time" refers to an agent whose elimination half-life is 2, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 times longer than a comparison standard (e.g., a comparable agent not containing a dendrimer targeting a specific cell type).

[0055] The terms "binding" and "encapsulation" refer to binding, formulating or otherwise including an agent into and / or onto a composition to allow release of the agent in a desired application, such as sustained release. The agent or other material can be incorporated into the dendrimer by binding to one or more surface functional groups of such dendrimer (through covalent, ionic or other binding interactions), by physical mixing, by encapsulating the agent within the dendritic structure, and / or by encapsulating the agent within the dendritic structure.

[0056] II. Composition

[0057] A dendrimer-based genome editing system has been developed for delivering gene editing agents (e.g., Cas9 ribonucleoproteins (RNPs)) into the cytoplasm and then into the nucleus. As shown in the Examples, Streptococcus pyogenes Cas9-2NLS endonuclease can be covalently conjugated to hydroxy PAMAM dendrimers (D-Cas9 (2NLS)) via a glutathione-sensitive disulfide linker via a highly specific reverse Diels-Alder click reaction (IEDDA), and guide RNA (sgRNA) complexed with the Cas9-dendrimer nanoconstruct. D-Cas9 RNPs produce robust genomic deletions in vitro in human embryonic 293 cell lines (HEK 293) (~100%) and human pigment epithelial cell lines (ARPE-19) (20%).

[0058] Compositions of dendrimers complexed or covalently conjugated with one or more gene editing agents are described. Exemplary dendrimers include 4th, 5th, 6th, 7th, or 8th generation PAMAN and glucose dendrimers.

[0059] In a preferred embodiment, the dendrimer is a glucose dendrimer. The glucose dendrimer comprises (a) a central core, (b) one or more branching units, wherein the branching units are monosaccharide glucosyl branching units, optionally with linkers conjugated thereto. In some embodiments, the glucose dendrimer is a 1st, 2nd, 3rd, 4th, 5th or 6th generation dendrimer.

[0060] In some embodiments, the dendrimer is a poly(amidoamine) (PAMAM) dendrimer, such as a hydroxyl terminated PAMAM dendrimer, preferably a 4th, 5th, or 6th generation hydroxyl terminated PAMAM dendrimer.

[0061] In some embodiments, the dendrimer is covalently conjugated to one or more Cas9 proteins, optionally via a linker or spacer moiety. In a preferred embodiment, the dendrimer is covalently conjugated to one or more Cas9 proteins with one or more nuclear localization signals (NLS), more preferably to a Cas9 protein with two NLSs.

[0062] Dendrimer conjugation improves formulation properties, such as improved plasma stability, storage stability, and sustained release capability, compared to gene editing compositions not bound or conjugated to dendrimers.

[0063] A. Dendrimers

[0064] Dendrimers are three-dimensional, hyperbranched, monodisperse, globular and multivalent macromolecules that include surface end groups (Tomalia, DA, et al., Biochemical Society Transactions, 35, 61 (2007); and Sharma, A., et al., ACS Macro Letters, 3, 1079 (2014)). Due to their unique structural and physical characteristics, dendrimers have shown unprecedented potential as nanocarriers in various biomedical applications, including targeted drug / gene delivery, imaging, and diagnosis (Sharma, A., et al., RSC Advances, 4, 19242 (2014); Caminade, A.-M., et al., Journal of Materials Chemistry B, 2, 4055 (2014); Esfand, R., et al., Drug Discovery Today, 6, 427 (2001); and Kannan, RM, et al., Journal of Internal Medicine, 276, 579 (2014)).

[0065] The term "dendrimer" includes, but is not limited to, a molecular structure having an inner core ("GO") and layers of repeating units (or "generations") attached to and extending from the inner core, each layer having one or more branch points, and terminal groups attached to the outer surface of the outermost generation. In some embodiments, the dendrimer has a regular branch-like or "star-shaped" molecular structure.

[0066] Dendrimers can be used for a variety of biomedical applications, including drug / gene delivery, targeting, imaging, and diagnostics (Soliman, GM et al., Chem. Commun. 2011, 47, 9572; and Tomalia, DA et al., Biochem. Soc. Trans. 2007, 35, 61). Among the several different types of dendrimers, polyamidoamine (PAMAM) dendrimers are widely used for drug delivery applications due to their commercial availability, water solubility, and biocompatibility (Tomalia, DA et al., Polym J 1985, 17, 117). The small size and the presence of multiple easily regulated surface groups make these nanoparticles excellent carriers for transporting drugs to the CNS. Early studies have shown that non-cytotoxic, hydroxyl-terminated 4th generation PAMAM dendrimers (~4 nm in size without any targeting ligands) can cross the damaged BBB and target activated microglia at the site of brain injury, several times more than healthy controls (Lesniak, WG et al., MolPharm 2013, 10). These dendrimers are non-toxic even at intravenous doses >500 mg / kg and are cleared intact by the kidneys. These findings have been validated in various small and large animal models (Kannan, S et al., Sci. Transl. Med. 2012, 4, 130ra46; Kambhampati, SP et al., Invest Ophthalmol Vis Sci 2015, 56; Nance, E et al., J. Control. Release 2015, 214, 112; Mishra, MK et al., ACS Nano 2014, 8, 2134; and Nanomedicine 2010, 5, 1317). The selective uptake and localization of these neutral dendrimers in activated microglia may be attributed to their ability to cross the damaged BBB and diffuse rapidly in the brain parenchyma, followed by uptake by the continuously phagocytic activated glial cells.

[0067] The surface groups of dendrimers have a significant impact on their biodistribution (Nance, E., et al., Biomaterials, 101, 96 (2016)). After systemic administration in a rabbit model of cerebral palsy (CP), hydroxyl-terminated 4th generation PAMAM dendrimers (about 4 nm in size) without any targeting ligands crossed the damaged BBB significantly more (>20 times) than healthy controls, and selectively targeted activated microglia and astrocytes (Lesniak, WG, et al., Mol Pharm, 10 (2013)).

[0068] Typically, the diameter of the dendrimer is between about 1 nm and about 50 nm, more preferably between about 1 nm and about 20 nm, between about 1 nm and about 10 nm, or between about 1 nm and about 5 nm. The conjugate is generally in the same size range, although large proteins such as Cas9 proteins may increase the size to about 10-20 nm or 10-15 nm. Generally, large proteins such as Cas9 proteins are conjugated at a ratio of 1:1 to 4:1 protein to dendrimer, i.e., 4 or higher for larger generations of dendrimers. In preferred embodiments, the dendrimer has a diameter that can effectively penetrate brain tissue and remain in target cells for intracellular delivery of an agent conjugated thereto.

[0069] In some embodiments, the molecular weight of the dendrimer is between about 500 Daltons and about 100,000 Daltons, inclusive, preferably between about 500 Daltons and about 50,000 Daltons, inclusive, and most preferably between about 1,000 Daltons and about 20,000 Daltons, inclusive.

[0070] Suitable dendrimer scaffolds that may be used include poly(amidoamine), also known as PAMAM or STARBURST TM Dendrimers; polypropylamine (POPAM), polyethyleneimine, polylysine, polyester, iptycene, aliphatic polyether and / or aromatic polyether dendrimers. The dendrimers may have carboxyl, amine and / or hydroxyl termini. In a preferred embodiment, the dendrimers have hydroxyl termini. Each dendrimer of the dendrimer complex may have the same or similar chemical properties as the other dendrimers, or may have different chemical properties (e.g., a first dendrimer may include a PAMAM dendrimer, while a second dendrimer may be a POPAM dendrimer).

[0071] The term "PAMAM dendrimer" refers to a poly(amidoamine) dendrimer that may contain different cores with amidoamine building blocks and may have carboxyl, amine and hydroxyl termini of any generation, including but not limited to 1st generation PAMAM dendrimers, 2nd generation PAMAM dendrimers, 3rd generation PAMAM dendrimers, 4th generation PAMAM dendrimers, 5th generation PAMAM dendrimers, 6th generation PAMAM dendrimers, 7th generation PAMAM dendrimers, 8th generation PAMAM dendrimers, 9th generation PAMAM dendrimers or 10th generation PAMAM dendrimers. In preferred embodiments, the dendrimer is soluble in the formulation and is a 4th, 5th or 6th generation ("G") dendrimer. The dendrimer may have hydroxyl groups attached to its functional surface groups.

[0072] 1. Hydroxyl-terminated dendrimers

[0073] In some embodiments, the dendrimer includes a plurality of hydroxyl groups. Some exemplary high-density hydroxyl-containing dendrimers include commercially available polyester dendrimers, such as hyperbranched 2,2-bis(hydroxy-methyl)propionic acid polyester polymers (e.g., hyperbranched bis-MPA polyester-64-hydroxy, 4 generations), dendritic polyglycerols.

[0074] In some embodiments, the dendrimer containing high density of hydroxyl groups is an oligoethylene glycol (OEG)-like dendrimer. For example, the second generation OEG dendrimer (D2-OH-60) can be synthesized by efficient, robust and atom-economic chemical reactions, such as Cu (I)-catalyzed alkyne-azide click and photocatalyzed thiol-ene click chemistry. For example, as described in WO2019094952, by using orthogonal supermonomers and supercore strategies, high-density polyol dendrimers can be obtained with very low generations in a minimum of reaction steps. In some embodiments, the dendrimer backbone has unbreakable polyether bonds throughout the structure to avoid decomposition of the dendrimer in vivo and allow such dendrimers to be eliminated from the body as a single entity (non-biodegradable).

[0075] In a preferred embodiment, the dendrimer has a plurality of hydroxyl groups (-OH) at its periphery. The preferred surface density of hydroxyl groups (-OH) is at least 1 OH group / nm 2 (Number of hydroxyl surface groups / nm 2 In some embodiments, the surface density of hydroxyl groups is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10; preferably at least 10, 15, 20, 25, 30, 35, 40, 45, 50 or greater than 50. In further embodiments, the surface density of hydroxyl (-OH) groups is from about 1 to about 50, preferably 5-20 OH groups / nm 2 (Number of hydroxyl surface groups / nm 2 of surface area), and has a molecular weight of about 500 Da to about 10 kDa.

[0076] In some embodiments, the dendrimer may have a portion of the hydroxyl groups exposed on the outer surface, while other hydroxyl groups are in the inner core of the dendrimer. In preferred embodiments, the volume density of the hydroxyl (-OH) groups of the dendrimer is at least 1 OH group / nm 3 (Number of hydroxyl groups / nm 3Volume). For example, in some embodiments, the volume density of hydroxyl groups is 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10, 15, 20, 25, 30, 35, 40, 45, and 50. In some embodiments, the volume density of hydroxyl groups is between about 4 and about 50 groups / nm. 3 Between, preferably between about 5 and about 30 groups / nm 3 between about 10 and about 20 groups / nm 3 between.

[0077] In some embodiments, upon administration into the body, the dendrimer specifically targets a particular tissue region and / or cell type. In preferred embodiments, the dendrimer specifically targets a particular tissue region and / or cell type in the absence of a targeting moiety.

[0078] 2. Glucose-based dendrimers

[0079] In some embodiments, the dendrimer has a supercore (e.g., dipentaerythritol) and one or more monosaccharide branching units. In some embodiments, the monosaccharide branching units are conjugated to the core or the previous layer of monomers via a linker such as a polyethylene glycol chain. In a preferred embodiment, the supercore is dipentaerythritol and the monosaccharide branching units are glucose-based branching units.

[0080] In a further embodiment, the spacer molecule may also be an alkyl group (CH2) n - Hydrocarbon units. Branching units are PEG or alkyl chain linkers between different dendrimer generations, for example, glucose layers are connected via PEG linkers and triazole rings.

[0081] Dendrimers synthesized using glucose building blocks, whose surfaces are primarily composed of glucose moieties, are capable of specific targeted gene editing in cells, including damaged neurons, ganglion cells, and other neuronal cells in the brain and eyes.

[0082] In one embodiment, the glucose-based dendrimers are selectively targeted or enriched in neurons, particularly in the nuclei of neurons. In a preferred embodiment, the glucose-based dendrimers are selectively targeted or enriched in injured, diseased and / or overactive neurons.

[0083] In a preferred embodiment, the dendrimer includes an effective number of terminal glucose and / or hydroxyl groups for targeting one or more neurons of the central nervous system or eye. The hydroxyl groups on the surface of the dendrimer are part of a glucose molecule. There are no additional hydroxyl groups other than the glucose molecules on the surface. The number of surface sugar molecules is determined by the number of generations. It is expected that all generations will target neurons.

[0084] In some embodiments, the dendrimer is made of glucose and oligoethylene glycol building blocks. Exemplary glucose dendrimers are shown in the Examples. Some exemplary glucose dendrimers include a 1 generation glucose dendrimer with 24 hydroxyl (-OH) end groups, a 2 generation glucose dendrimer with 96 hydroxyl (-OH) end groups, a 3 generation glucose dendrimer with 396 hydroxyl (-OH) end groups, and a 4 generation glucose dendrimer with 1584 hydroxyl (-OH) end groups. In a preferred embodiment, the glucose dendrimer is a 2 generation glucosyl dendrimer with 24 glucose molecules on the periphery and 6 embedded glucose molecules in the main chain, which are bound together by PEG segments.

[0085] B. Gene Editing System

[0086] The dendrimer is complexed or covalently conjugated with one or more gene editing systems or at least one or more components thereof. Exemplary gene editing systems include, but are not limited to, triplex formation, pseudo-complementary oligonucleotides, CRISPR / Cas, zinc finger nucleases, and TALENs. In a preferred embodiment, the gene editing system is a CRISPR / Cas system. In some embodiments, the gene editing technology is a donor oligonucleotide, which can be used alone to modify a gene. Strategies include, but are not limited to, small fragment homologous replacement (e.g., polynucleotide small DNA fragments (SDFs)), single-stranded oligodeoxynucleotide-mediated gene modification (e.g., ssODN / SSOs), and Sargent, Oligonucleotides, 21 (2): 55-75 (2011)) and other literature. Other suitable gene editing technologies include, but are not limited to, intron-encoded giant nucleases that are engineered to change their target specificity. See, for example, Arnould, et al., Protein Eng. Des. Sel., 24 (1-2): 27-31 (2011)).

[0087] In a preferred embodiment, the gene editing system is a protein-guided gene editing system, such as the CRISPR system, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs).

[0088] 1. CRISPR / Cas

[0089] In some embodiments, the gene editing system that induces single-strand or double-strand breaks in the target cell genome is CRISPR / Cas, or a nucleic acid construct encoding a Cas nuclease.

[0090] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is an acronym for a DNA locus that contains multiple short, direct base sequence repeats. The prokaryotic CRISPR / Cas system has been modified for gene editing (silencing, enhancing, or changing specific genes) used in eukaryotic organisms (see, e.g., Cong, Science, 15:339(6121):819–823(2013) and Jinek, et al., Science, 337(6096):816-21(2012). By transfecting cells with the required elements including cas genes and specially designed CRISPRs, the genome of an organism can be cut and modified at any desired location. Methods for preparing compositions for genome editing using the CRISPR / Cas system are described in detail in WO2013 / 176772 and WO 2014 / 018423.

[0091] In general, "CRISPR system" refers to the collective term for transcripts and other elements that participate in the expression of CRISPR-associated ("Cas") genes or guide their activity, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., TRACRNA or active partial TRAC RNA), tracr-mate sequences (including "direct repeats" and partial direct repeats processed by TRACRNA in endogenous CRISPR systems), guide sequences (also called "spacers" in endogenous CRISPR systems) or other sequences and transcripts from CRISPR loci. One or more tracer pairing sequences (e.g., direct repeat-spacer-direct repeat) operably linked to a guide sequence may also be referred to as pre-processed pre-crRNA (pre-CRISPR RNA) or as crRNA after nuclease processing.

[0092] In some embodiments, tracrRNA and crRNA are connected and form a chimeric crRNA-tracrRNA hybrid, wherein the mature crRNA is fused to a portion of the tracrRNA via a synthetic stem loop to mimic a natural crRNA:TRAC RNA duplex, as described in Cong, Science, 15:339(6121):819–823(2013) and Jinek, et al., Science, 337(6096):816-21(2012)). A single fused crRNA-tracrRNA construct may also be referred to as a guide RNA or gRNA (or single guide RNA (sgRNA)). In sgRNA, the crRNA portion may be identified as a "target sequence", while the tracr RNA is often referred to as a "scaffold".

[0093] Once the desired DNA target sequence is identified, there are many resources available to help practitioners determine suitable target sites. For example, many public resources, including a bioinformatics-generated list of approximately 190,000 potential sgRNAs targeting more than 40% of human exons, can be used to help practitioners select a target site and design the associated sgRNA to affect a nick or double-strand break at that site. See also, crispr.u-psud.fr / , a tool designed to help scientists find CRISPR targeting sites in a wide range of species and generate appropriate crRNA sequences.

[0094] In some embodiments, the dendrimer is covalently conjugated to one or more CRISPR-associated enzyme (Cas) nucleases. Exemplary Cas nucleases suitable for conjugation with dendrimers as gene editing compositions include Cas9, CasX (also known as Cas12e), Cas7-11, CasFx, Cas12a, and Cas13.

[0095] In some embodiments, the dendrimer is covalently conjugated to one or more Cas nucleases, which are further complexed with one or single guide RNA (sgRNA) to form CRISPR / Cas ribonucleoproteins (RNPs). In some embodiments, the dendrimer is covalently conjugated to one or more Cas nucleases via one or more linking moieties. In some embodiments, the linking moiety is conjugated to one or more spacer moieties. The linking and / or spacer moieties may be cleavable, for example, by exposure to an intracellular compartment of a target cell in vivo. In a preferred embodiment, one or more spacers / linkers are added between the dendrimer and the gene editing system to achieve desired and effective release kinetics in vivo. These may be cleavable linkages such as disulfides and esters.

[0096] In some embodiments, the dendrimer is covalently conjugated to one or more Cas9 nucleases, preferably complexed with one or more single guide RNAs (sgRNAs) to form CRISPR / Cas ribonucleoproteins (RNPs). In other embodiments, the dendrimer is covalently conjugated to one or more Cas9 nucleases and / or one or more single guide RNAs (sgRNAs) via a releasable link so as to be released from the associated dendrimer within the cell. In a preferred embodiment, the dendrimer is covalently conjugated to one or more Cas9 nucleases before or after the Cas9 is complexed with the sgRNA. In a preferred embodiment, the Cas9 nuclease is modified with one or more nuclear localization signals (NLS), preferably two NLSs. In a further embodiment, the Cas9 nuclease is a Streptococcus pyogenes Cas9 nuclease or a variant thereof.

[0097] 2. Zinc Finger Nuclease

[0098] In some embodiments, the gene editing system that induces single-strand or double-strand breaks in the genome of the target cell is a zinc finger nuclease (ZFN), or a nucleic acid construct encoding a ZFN. ZFN is generally a fusion protein that includes a DNA binding domain derived from a zinc finger protein linked to a cleavage domain.

[0099] The most common cleavage domain is the type IIS enzyme Fok1. Fok1 catalyzes double-stranded cleavage of DNA, 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand. See, e.g., U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; and Li, et al., Proc., Natl. Acad. Sci. USA 89 (1992): 4275-4279; Li, et al., Proc. Natl. Acad. Sci. USA, 90: 2764-2768 (1993); Kim, et al., Proc. Natl. Acad. Sci. USA. 91: 883-887 (1994a); Kim, et al., J. Biol. Chem. 269: 31,978-31,982 (1994b). One or more of these enzymes (or enzymatically functional fragments thereof) can be used as a source of a cleavage domain.

[0100] In principle, DNA binding domains can be designed to target any genomic location of interest and can be tandem arrays of Cys2His2 zinc fingers, each of which typically recognizes three to four nucleotides in the target DNA sequence. The Cys2His2 domain has the general structure: Phe (sometimes Tyr)-Cys-(2 to 4 amino acids)-Cys-(3 amino acids)-Phe (sometimes Tyr)-(5 amino acids)-Leu-(2 amino acids)-His-(3 amino acids)-His. By linking multiple fingers together (variable numbers: in published studies, 3-6 zinc fingers per monomer were used), ZFN pairs can be designed to bind to genomic sequences 18-36 nucleotides long.

[0101] Engineering methods include, but are not limited to, rational design and various types of empirical selection methods. Rational design includes, for example, the use of a database comprising triplet (or quadruple) nucleotide sequences and single zinc finger amino acid sequences, wherein each triplet or quadruple nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruple sequence. See, for example, U.S. Patent Nos. 6,140,081; 6,453,242; 6,534,261; 6,610,512; 6,746,838; 6,866,997; 7,067,617; U.S. Published Application Nos. 2002 / 0165356; 2004 / 0197892; 2007 / 0154989; 2007 / 0213269; and International Patent Application Publication Nos. WO 98 / 53059 and WO 2003 / 016496.

[0102] 3. Transcription activator-like effector nuclease

[0103] In some embodiments, the gene editing system that induces single-strand or double-strand breaks in the genome of the target cell is a transcription activator-like effector nuclease (TALEN), or a nucleic acid construct encoding a TALEN. TALENs have an overall structure similar to ZFNs, with the main difference being that the DNA binding domain comes from the TAL effector protein, a transcription factor from a plant pathogenic bacterium. The DNA binding domain of TALEN is a tandem array of amino acid repeats, each approximately 34 residues long. The repeats are very similar to each other; typically, they differ primarily in two positions (amino acids 12 and 13, called repeat variable diresidues, or RVDs). Each RVD specifies a preference for binding to one of four possible nucleotides, meaning that each TALEN repeat binds to one base pair, although the NN RVD is known to bind to adenine in addition to guanine. Compared to zinc finger proteins, the mechanism of TAL effector DNA binding is unclear, but their seemingly simple code may prove to be very useful for engineering nuclease design. TALENs also cleave as dimers, have relatively long target sequences (the shortest sequence reported to date binds 13 nucleotides per monomer), and appear to have less stringent requirements on the length of the spacer between binding sites than ZFNs. Monomeric and dimeric TALENs can include more than 10, more than 14, more than 20, or more than 24 repeats.

[0104] Cermak et al. described a method of modifying TAL to bind to specific nucleic acids in Nucl. Acids Res. 1-11 (2011). U.S. Publication No. 2011 / 0145940 discloses TAL effectors and methods for modifying DNA. Miller et al. reported in Nature Biotechnol 29:143 (2011) that TALENs with site-specific nuclease structures were prepared by connecting TAL truncated variants to the catalytic domain of Fokl nuclease. The results showed that TALEN induced gene modification in immortalized human cells. General design principles for TALE binding domains can be found, for example, in WO 2011 / 072246.

[0105] C. Coupling Agents and Spacers

[0106] Dendrimer conjugates can be formed by one or more gene editing systems or one or more components thereof, which are conjugated or connected to dendrimers. Optionally, one or more gene editing systems are conjugated to dendrimers via different bonds such as disulfide bonds, ester bonds, carbonate bonds, carbamate bonds, thioester bonds, hydrazine bonds, hydrazide bonds, ether bonds and amide bonds through one or more spacers / linkers. One or more spacers / linkers between dendrimers and gene editing systems can be designed to provide releasable or non-releasable forms of dendrimer conjugates in vivo. In some embodiments, attachment occurs through a suitable spacer that provides an ester bond between the gene editing system and the dendrimer. In some embodiments, one or more spacers / linkers are added between the dendrimer and the gene editing system to achieve desired and effective release kinetics in vivo. These can be cleavable (ester, SS) or non-cleavable (amide, ether). The connection chemistry can be click chemistry, acid-amine coupling, Steglich esterification, etc.

[0107] In some embodiments, attachment occurs through one or more of a disulfide bond, an ester bond, an ether bond, a thioester bond, a carbamate bond, a carbonate bond, a hydrazine bond, an ether bond, or an amide bond. In a preferred embodiment, attachment occurs through a suitable spacer that provides an ester bond or an amide bond between the agent and the dendrimer, depending on the desired release kinetics of the agent.

[0108] The term "spacer" includes compositions used to attach an active agent (e.g., one or more components of a gene editing system, such as a Cas9 nuclease) to a dendrimer. A spacer can be a single chemical entity or two or more chemical entities linked together. Spacers can include any small chemical entity, peptide, or polymer with sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone, and carbonate termini.

[0109] The spacer can be selected from a class of compounds terminated with thiol, thiopyridyl, succinimidyl, maleimido, vinylsulfone and carbonate groups. The spacer can include thiopyridyl terminated compounds such as dithiodipyridine, N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate LC-SPDP or sulfo-LC-SPDP. The spacer may also include a peptide, wherein the peptide is a linear peptide or a cyclic peptide having essentially a thiol group, such as glutathione, homocysteine, cysteine ​​and its derivatives, arginine-glycine-aspartic acid-cysteine ​​(RGDC), cyclo(arginine-glycine-aspartic acid-d-phenylalanine-cysteine) (c(RGD fc)), cyclo(arginine-glycine-aspartic acid-d-tyrosine-cysteine), cyclo(arginine-alanine-aspartic acid-d-tyrosine-cysteine). The spacer may be a thiol acid derivative, such as 3-mercaptopropionic acid, thioglycolic acid, 4-mercaptobutyric acid, thiolane-2-one, 6-mercaptohexanoic acid, 5-mercaptopentanoic acid and other thiol derivatives, such as 2-mercaptoethanol and 2-mercaptoethylamine. The spacer can be thiosalicylic acid and its derivatives, (4-succinimidyloxycarbonyl-methyl-yloxycarbonylpyridinylthio) toluene, (3-[2-pyridinylthio] propionylhydrazide. The spacer can have a maleimide end, wherein the spacer includes a polymer or a small chemical entity, such as bismaleimide diethylene glycol and bismaleimide triethylene glycol, bismaleimide ethane, bismaleimide hexane. The spacer can include vinyl sulfones, such as 1,6-hexane-bisvinyl sulfone. The spacer can include a thioglycoside, such as thioglucose. The spacer can be a reduced protein, such as bovine serum albumin and human serum albumin, any thiol-terminated compound capable of forming a disulfide bond. The spacer can include polyethylene glycol with a maleimide end, a succinimide end, and a thiol end.

[0110] D. Dendrimer-Gene Editing Agent Conjugates

[0111] The dendrimer may include one or more gene editing agents complexed or covalently conjugated to the dendrimer.

[0112] In some embodiments, one or more gene editing agents are covalently attached to one or more end groups of the dendrimer, such as hydroxyl groups. In some embodiments, the dendrimer conjugate includes one or more gene editing agents conjugated or complexed with the dendrimer through one or more linking moieties. One or more spacers / linkers between the dendrimer and the gene editing system can be designed to provide a releasable or non-releasable form of the dendrimer conjugate in vivo. In some embodiments, the linking moiety is conjugated to one or more spacer moieties. The linking and / or spacer moieties can be cleavable, for example, by exposure to an intracellular compartment of a target cell in vivo. In a preferred embodiment, one or more spacers / linkers are added between the dendrimer and the gene editing system to achieve the desired and effective release kinetics in vivo. These can be cleavable (esters, SS) or non-cleavable (amides, ethers).

[0113] The dendrimer is preferably of 2, 3, 4, 5, 6 and up to 10 generations. In a preferred embodiment, the dendrimer is linked to one or more gene editing agents via a spacer ending in a disulfide bond, an ester bond, an ether bond or an amide bond.

[0114] The optimal loading necessarily depends on many factors, including the choice of drug, the structure and size of the dendrimer, and the tissue to be treated. In some embodiments, for larger generations of dendrimers, the Cas9 nuclease protein is conjugated at a ratio of 1:1 to 4:1 protein to dendrimer, i.e., 4 generations or higher. In preferred embodiments, the dendrimer complex retains an effective amount of surface functional groups for targeting target cells while being conjugated to an effective amount of drug for treating, preventing, and / or imaging a disease or condition.

[0115] Typically, the dendrimer conjugate has a hydrodynamic volume in the nanometer range. For example, in some embodiments, the diameter of the dendrimer-Cas9 RNP complex is between about 5 nm and about 500 nm, including end values, or between about 10 nm and about 200 nm, including end values, between about 15 nm and about 100 nm, including end values, depending on the generation of the dendrimer, the number of loaded nuclease molecules. Preferably, the dendrimer conjugate has a diameter that effectively penetrates and is retained in the target cell for a long time.

[0116] E. Other Agents Delivered

[0117] A variety of agents may be included in the particles to be delivered. The agent may be a protein or peptide, a sugar or carbohydrate, a nucleic acid or oligonucleotide, a lipid, a small molecule, or a combination thereof. The nucleic acid may be an oligonucleotide encoding a protein, such as a DNA expression cassette or mRNA. Representative oligonucleotides include siRNA, microRNA, DNA, RNA, and aptamers. In one embodiment, these are antisense oligonucleotides. In some embodiments, the therapeutic, prophylactic, or diagnostic agent is a therapeutic antibody. One or more types of therapeutic, prophylactic, or diagnostic agents may be encapsulated, complexed, or conjugated to the dendrimer.

[0118] Exemplary therapeutic agents include anti-inflammatory drugs, anti-proliferative agents, chemotherapeutic agents, vasodilators, neuroactive agents, and anti-infective agents. In some embodiments, the dendrimer is linked to a targeting moiety, an imaging agent, and / or a therapeutic agent. In some embodiments, the dendrimer is linked to a targeting moiety or an antibody for targeting a specific cell type.

[0119] 1. Therapeutic agents

[0120] One or more therapeutic agents may be complexed with, covalently attached to, or intramolecularly dispersed or encapsulated within a dendrimer. In some embodiments, two or more different therapeutic agents may be associated with a dendrimer through covalent and / or non-covalent interactions.

[0121] When administered by intravenous injection, the dendrimer conjugates can preferentially cross the blood-brain barrier (BBB). Preferably, the drug is attached or conjugated to a dendrimer that is capable of preferentially releasing the drug at the target site, i.e., disease, injury and / or subcellular location. For example, some drugs can be released intracellularly under reducing conditions in vivo. Dendrimer conjugates conjugated to pharmaceutical agents can be used to perform a variety of functions, including targeting, localization at diseased sites, drug release, and imaging purposes. The dendrimer complex can be labeled or unlabeled with a targeting moiety.

[0122] In some embodiments, one or more therapeutic agents target the underlying cause of the disease or condition, and one or more therapeutic agents alleviate one or more symptoms of the disease or condition.

[0123] Preferred therapeutic or preventive agents include drugs that reduce neuroinflammation (e.g., N-acetylcysteine, pioglitazone, vitamin E) and RNA oligonucleotides that interfere with gene transcription or translation. In particularly preferred embodiments, the drug is N-acetylcysteine, 4-phenylbutyrate, bezafibrate, thyroid hormone (T3), sorbenterolide, pioglitazone, resveratrol, VBP15, vitamin E, erucic acid, coenzyme Q10, clemastine, galactosylceramidase (GALC), asparagine (ASPA) or arylsulfatase A (ARSA). Other suitable agents include anti-inflammatory agents, neuroactive agents and imaging agents. Dendrimers can be conjugated to more than one agent and more than one type of agent.

[0124] a. Anti-inflammatory agents

[0125] In some embodiments, the composition includes one or more anti-inflammatory agents. Anti-inflammatory agents can reduce inflammation and include steroidal and non-steroidal drugs.

[0126] Preferred anti-inflammatory drugs are antioxidant drugs including N-acetylcysteine. Preferred NSAIDS include mefenamic acid. acid, aspirin, diflunisal, salsalate, ibuprofen, naproxen, fenoprofen, ketoprofen, deacketoprofen, flurbiprofen, oxaprozin, loxoprofen, indomethacin, sulindac, etodolac, ketorolac, diclofenac, nabumetone, piroxicam, meloxicam, tenoxicam, droxicam, lornoxicam, isoxicam, meclofenamic acid, fenvalerate ... acid, flufenamic acid, tolfenamic acid, elecoxib, rofecoxib, valdecoxib, parecoxib, lumiracoxib, etoricoxib, firocoxib, sulfonamides, nimesulide, niflumic acid, and licofelone.

[0127] Representative small molecules include steroids such as methylprednisone, dexamethasone, nonsteroidal anti-inflammatory drugs including COX-2 inhibitors, corticosteroid anti-inflammatory drugs, gold compound anti-inflammatory drugs, immunosuppressants, anti-inflammatory agents and anti-angiogenic agents, anti-excitotoxic agents such as valproic acid, D-aminophosphonic acid valerate, D-aminophosphonic acid enanthate, glutamate formation / release inhibitors such as baclofen, NMDA receptor antagonists, salicylate anti-inflammatory drugs, ranibizumab, anti-VEGF agents including aflibercept and rapamycin. Other anti-inflammatory drugs include nonsteroidal drugs such as indomethacin, aspirin, acetaminophen, diclofenac sodium and ibuprofen. Corticosteroids can be fluocinolone acetonide and methylprednisolone.

[0128] Exemplary immunomodulatory drugs include cyclosporine, tacrolimus, and rapamycin. In some embodiments, the anti-inflammatory agent is a biologic drug that blocks the action of one or more immune cell types (such as T cells), or blocks proteins in the immune system, such as tumor necrosis factor-α (TNF-α), interleukin 17-A, interleukins 12 and 23.

[0129] In some embodiments, the anti-inflammatory drug is a synthetic or natural anti-inflammatory protein. Antibodies against specific immune components can be added to immunosuppressive therapy. In some embodiments, the anti-inflammatory drug is an anti-T cell antibody (e.g., anti-thymocyte globulin or anti-lymphocyte globulin), an anti-IL-2Rα receptor antibody (e.g., basiliximab or daclizumab), or an anti-CD20 antibody (e.g., rituximab).

[0130] In preferred embodiments, one or more anti-inflammatory drugs are released from the dendrimer conjugates after administration to a mammalian subject in an amount effective to inhibit inflammation for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, preferably at least 1 week, 2 weeks or 3 weeks, more preferably at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months.

[0131] b. Neuroactive agents

[0132] Many drugs have been developed to interrupt, influence, or temporarily stop the glutamate excitotoxic cascade that damages neurons. One strategy is to reduce glutamate release "upstream." This class of drugs includes the sodium channel blockers riluzole, lamotrigine, and lifazine. The commonly used nimodipine is a voltage-dependent channel (L-type) blocker. Some drugs affect the site of coupled glutamate receptors. Examples of these drugs include felbamate, ifenprodil, magnesium, memantine, and nitroglycerin. These "downstream" drugs attempt to affect intracellular events such as free radical formation, nitric oxide formation, proteolysis, endonuclease activity, and ice-like protease formation (important components in the process leading to programmed cell death or apoptosis).

[0133] The agents used to treat neurodegenerative diseases are well known in the art and vary according to the symptoms and disease to be treated. For example, conventional treatments for Parkinson's disease include levodopa (usually in combination with a dopa decarboxylase inhibitor or a COMT inhibitor), a dopamine agonist, or a MAO-B inhibitor.

[0134] Treatments for Huntington's disease include dopamine blockers to help reduce abnormal behaviors and movements, or drugs such as amantadine and tetrabenazine to control movements. Other drugs that help reduce chorea include neuroleptics and benzodiazepines. Compounds such as amantadine or remazine have shown positive effects. Hypokinesia and rigidity, especially in adolescent cases, can be treated with antiparkinsonian drugs, and myoclonic hyperkinesia can be treated with valproic acid. Psychiatric symptoms can be treated with drugs similar to those used in the general population. Selective serotonin reuptake inhibitors and mirtazapine have been recommended for depression, while atypical antipsychotics are recommended for psychosis and behavioral problems.

[0135] Riluzole (2-amino-6-(trifluoromethoxy)benzothiazole), an excitotoxin, has been shown to prolong survival in ALS patients. Other drugs and interventions can reduce the symptoms caused by ALS. Some treatments improve quality of life, and a few appear to extend lifespan. Gordon, Aging and Disease, 4(5):295-310 (2013) reviews common ALS-related therapies, see Table 1 therein. Many other drugs have been tested in one or more clinical trials with efficacy ranging from ineffective to promising. Exemplary agents are described in Carlsi, et al., Archives For example, treatments may include agents that reduce excitotoxicity, such as talampanel (8-methyl-7H-1,3-dioxol (2,3) benzodiazepine), cephalosporins such as ceftriaxone or memantine; drugs that reduce oxidative stress, such as coenzyme Q10, manganese porphyrin, KNS-760704 [(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride, RPPX] or edaravone (3-methyl-1-phenyl-2-pyrazole agents that reduce apoptosis, such as histone deacetylase (HDAC) inhibitors, including valproic acid, TCH346 (dibenzo(b,f)oxepin-10-ylmethyl-methylprop-2-ynamine), minocycline, or taurodeoxycholic acid (TUDCA); agents that reduce neuroinflammation, such as thalidomide and cerastatin; neurotrophic factors, such as insulin-like growth factor 1 (IGF-1) or vascular endothelial growth factor (VEGF); heat shock protein inducers, such as arimoclomol; or autophagy inducers, such as rapamycin or lithium.

[0136] Treatments for Alzheimer's disease include, for example, acetylcholinesterase inhibitors, such as tacrine, rivastigmine, galantamine, or donepezil; NMDA receptor antagonists, such as memantine; and antipsychotic drugs.

[0137] Treatments for dementia with Lewy bodies may include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, or donepezil; the N-methyl d-aspartate receptor antagonist memantine; dopaminergic therapies such as levodopa or selegiline; antipsychotics such as olanzapine or clozapine; REM disorder therapies such as clonazepam, melatonin, or quetiapine; antidepressant and antianxiety therapies such as selective serotonin reuptake inhibitors (citalopram, escitalopram, sertraline, paroxetine, etc.) or serotonin and norepinephrine reuptake inhibitors (venlafaxine, mirtazapine, and bupropion) (see, e.g., Macijauskiene, et al., Medicina (Kaunas), 48(1):1-8 (2012)).

[0138] Exemplary neuroprotective agents include, for example, glutamate antagonists, antioxidants, and NMDA receptor agonists.Other neuroprotective agents and treatments include caspase inhibitors, trophic factors, anti-protein aggregation agents, therapeutic hypothermia, and erythropoietin.

[0139] Other commonly used therapeutic, prophylactic or diagnostic agents for the treatment of neurological dysfunction include amantadine and anticholinergics for the treatment of motor symptoms, clozapine for the treatment of psychosis, cholinesterase inhibitors for the treatment of dementia, and modafinil for the treatment of daytime sleepiness.

[0140] c. Anti-infective drugs

[0141] Anti-infective drugs that can be used include antibiotics, antifungals, and antivirals. Antibiotics include: beta-lactams such as penicillin and ampicillin, cephalosporins such as cefuroxime, cefaclor, cephalexin, cefadroxil, cefpodoxime, and esters, tetracycline antibiotics such as doxycycline and minocycline, macrolide antibiotics such as azithromycin, erythromycin, rapamycin, and clarithromycin, fluoroquinolones such as ciprofloxacin, enrofloxacin, ofloxacin, gatifloxacin, levofloxacin, and norfloxacin, tobramycin, colistin, or aztreonam, and antibiotics known to have anti-inflammatory activity, such as erythromycin, azithromycin, or clarithromycin. In some cases, these are nucleic acids that interfere with infection or replication, and they are expressed to produce corresponding antibodies.

[0142] 2. Diagnostic agents

[0143] In some cases, the agent delivered to the target cell or tissue by the dendrimer is a diagnostic agent. Examples of diagnostic agents that can be delivered to the brain by the glucose dendrimer conjugate include paramagnetic molecules, fluorescent compounds, magnetic molecules and radionuclides, x-ray imaging agents and contrast agents. The dendrimer conjugate may include an agent for determining the location of the administered composition. Agents for this purpose include fluorescent labels, radionuclides and contrast agents.

[0144] Exemplary diagnostic agents include dyes, fluorescent dyes, near infrared dyes, SPECT imaging agents, PET imaging agents, and radioisotopes. Representative dyes include carbocyanine, indocarbocyanine, oxacarbocyanine, thiocarbocyanine and merocyanine, polymethine, coumarin, rhodamine, xanthene, fluorescein, boron-dipyrromethene (BODIPY), Cy5, Cy5.5, Cy7, VivoTag-680, VivoTag-S680, VivoTag-S750, AlexaFluor660, AlexaFluor680, AlexaFluor700, AlexaFluor750, AlexaFluor790, Dy677, Dy676, Dy682, Dy752, Dy780, DyLight547, Dylight647, HiLyte Fluor 647, HiLyte Fluor 680, HiLyte Fluor 750, IRDye800CW, IRDye 800RS, IRDye 700DX, ADS780WS, ADS830WS and ADS832WS.

[0145] Exemplary SPECT or PET imaging agents include chelators such as diethylenetriaminepentaacetic acid (DTPA), 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), diaminedithiol, activated mercaptoacetyl-glycyl-glycyl-glycine (MAG3), and hydrazinonicotinamide (HYNIC).

[0146] Exemplary isotopes include Tc-94m, Tc-99m, In-111, Ga-67, Ga-68, Gd3+, Y-86, Y-90, Lu-177, Re-186, Re-188, Cu-64, Cu-67, Co-55, Co-57, F-18, Sc-47, Ac-225, Bi-213, Bi-212, Pb-212, Sm-153, Ho-166, and Dy-166.

[0147] In preferred embodiments, the dendrimer composition includes one or more radioisotopes suitable for positron emission tomography (PET) imaging. Exemplary positron emitting radioisotopes include carbon-11 ( 11 C), copper-64 ( 64 Cu), nitrogen-13( 13 N), oxygen-15( 15 O), gallium-68( 68 Ga) and fluorine-18 ( 18 F), such as 2-deoxy-2- 18 F-fluoro-β-D-glucose ( 18 F-FDG).

[0148] In further embodiments, the dendrimer conjugate compositions can be used to simultaneously treat and / or diagnose a disease or condition at one or more sites in the body.

[0149] II. Preparation of dendrimer conjugates

[0150] A. Preparation of Dendrimers

[0151] Dendrimers complexed with one or more gene editing systems can be prepared by various chemical reaction steps. Dendrimers are usually synthesized according to methods that allow control of their structure at each stage of construction. Dendrimer structures are mainly synthesized by two main different methods: divergent or convergent.

[0152] In some embodiments, a divergent approach is used to prepare dendrimers, in which the dendrimers are assembled from a multifunctional core that extends outward through a series of reactions (typically Michael reactions). The strategy involves coupling monomer molecules with reactive and protective groups to a multifunctional core moiety, which results in a stepwise increase in generations around the core followed by removal of the protective groups. For example, PAMAM-NH2 dendrimers are first synthesized by coupling N-(2-aminoethyl)acrylamide monomers to an amine core.

[0153] In other embodiments, dendrimers are prepared using a convergent approach, where the dendrimer is built from small molecules that terminate on the surface of a sphere, and the reaction proceeds inward, building inward and ultimately attaching to a core.

[0154] There are many other synthetic routes for the preparation of dendrimers, such as the orthogonal method, the accelerated method, the two-stage convergence method or the supercore method, the supermonomer method or the branched monomer method, the double exponential method; the orthogonal coupling method or the two-step method, the double monomer method, and the AB2-CD2 method.

[0155] In some embodiments, the core, one or more branching units, one or more linkers / spacers, and / or one or more surface groups of the dendrimer can be modified to allow conjugation with additional functional groups (branching units, linkers / spacers, surface groups, etc.), monomers, and / or agents by click chemistry, using one or more copper-assisted azide-alkyne cycloadditions (CuAAC), Diels-Alder reactions, thiol-ene and thiol-yne reactions, and azide-yne ​​reactions (Arseneault M et al., Molecules. 2015 May 20; 20(5):9263-94). In some embodiments, preformed dendrimers are clicked onto high density hydroxyl polymers. "Click chemistry" involves coupling two different moieties (e.g., a core group and a branch unit; or a branch unit and a surface group), for example, by a 1,3-dipolar cycloaddition reaction between an alkyne moiety (or its equivalent) on the surface of the first moiety and an azide moiety (e.g., present on a triazine composition or its equivalent) or any reactive end group (e.g., a primary amine end group, a hydroxyl end group, a carboxylic acid end group, a thiol end group, etc.) on the second moiety.

[0156] In some embodiments, dendrimer synthesis depends on one or more reactions, such as thiol-ene click reaction, thiol-yne click reaction, CuAAC, Diels-Alder click reaction, azide-yne ​​click reaction, Michael addition, epoxy ring opening, esterification, silane chemistry, and combinations thereof.

[0157] In some embodiments, the methods involve one or more steps of protecting and deprotecting functional groups (e.g., hydroxyl groups) on the central core, branching units, and / or therapeutic, prophylactic, or diagnostic agents to facilitate the addition of branching units to generate the desired dendrimer molecules, or the addition of therapeutic, prophylactic, or diagnostic agents to generate the desired dendrimer conjugates. In the case of hydroxyl groups, they can be protected by forming ethers, esters, or acetals. Other exemplary protecting groups include Boc and Fmoc.

[0158] Existing dendritic platforms can be used to prepare dendritic macromolecules with desired functionalities, i.e., dendritic macromolecules with a high density of surface hydroxyl groups can be prepared by conjugating high hydroxyl-containing moieties such as 1-thioglycerol or pentaerythritol. Exemplary dendritic platforms such as polyamidoamine (PAMAM), poly(propyleneimine) (PPI), poly-L-lysine, melamine, poly(etherhydroxylamine) (PEHAM), poly(esteramine) (PEA), and polyglycerol can be synthesized and explored.

[0159] Dendrimers can also be prepared by combining two or more dendrimers. A dendrimer is a wedge-shaped portion of a dendrimer with a reactive focal functional group. Many dendrimer scaffolds are commercially available. They are available in 1, 2, 3, 4, 5, and 6 generations with 2, 4, 8, 16, 32, and 64 reactive groups, respectively. In certain embodiments, one type of agent is linked to one type of dendrimer and a different type of agent is linked to another type of dendrimer. The two dendrimers are then linked to form a dendrimer. Two dendrimers can be linked by click chemistry, i.e., a 1,3-dipolar cycloaddition reaction between an azide moiety on one dendrimer and an alkyne moiety on another dendrimer to form a triazole linker.

[0160] Exemplary methods of preparing dendrimers are described in detail in International Patent Publication Nos. WO2009 / 046446, WO2015168347, WO2016025745, WO2016025741, WO2019094952, and U.S. Pat. No. 8,889,101.

[0161] 1. Preparation of Glucose Dendrimers

[0162] In some embodiments, a divergent approach is used to prepare glucose-based dendrimers, in which the dendrimers are assembled from a multifunctional core that extends outward through a series of reactions. The strategy involves coupling monomer molecules with reactive and protective groups to the multifunctional core moiety, which results in the stepwise addition of multiple generations around the core, followed by the removal of the protective groups.

[0163] The synthesis of exemplary dendrimers is shown in the Examples.

[0164] In some embodiments, the second generation dendrimer D2-Glu24-OH96 is propargylated at one or more terminal hydroxyl groups, suitable for further conjugation to one or more molecules (eg, Cas9 nuclease). **

[0165] B. Dendrimer-Gene Editing Agent Complex

[0166] Methods of conjugating pharmaceutical agents to dendrimers are well known in the art, for example, as described in US Published Application Nos. US2011 / 0034422, US2012 / 0003155, and US2013 / 0136697.

[0167] In some embodiments, one or more pharmaceutical agents are covalently attached to the dendrimer. In some embodiments, the pharmaceutical agent is attached to the dendrimer via a linking moiety designed to be cleaved in vivo. The linking moiety can be designed to be cleaved hydrolytically, enzymatically, or a combination thereof, thereby providing sustained release of the drug in vivo. The composition of the linking moiety and its point of attachment to the drug are selected so that cleavage of the linking moiety releases the drug or a suitable prodrug thereof. The composition of the linking moiety can also be selected based on the desired rate of drug release.

[0168] In some embodiments, attachment occurs through one or more of a disulfide bond, an ester bond, an ether bond, a thioester bond, a carbamate bond, a carbonate bond, a hydrazine bond, or an amide bond. In preferred embodiments, linkage occurs through a suitable spacer that provides an ester bond or an amide bond between the agent and the dendrimer, depending on the desired release kinetics of the agent. In some cases, an ester bond is introduced as a releasable form of the drug. In other cases, an amide bond is introduced for a non-releasable form of the agent.

[0169] The linking moiety typically includes one or more organic functional groups. Examples of suitable organic functional groups include secondary amides (-CONH-), tertiary amides (-CONR-), sulfonamides (-S(O)2-NR-), secondary carbamates (-OCONH-); -NHCOO-), tertiary carbamates (-OCONR-; -NRCOO-), carbonates (-OC(O)-O-), ureas (-NHCONH-; -NRCONH-; -NHCONR-, -NRCONR-), methanols (-CHOH-, -CROH-), disulfide groups, hydrazones, hydrazides, ethers (-O-) and esters (-COO-, -CH2O2C-, CHRO2C-), wherein R is an alkyl, aryl or heterocyclic group. In general, the nature of the one or more organic functional groups in the linking moiety is selected based on the desired release rate of the drug. In addition, the one or more organic functional groups can be selected to facilitate covalent attachment of the agent to the dendrimer. In a preferred embodiment, the attachment can be performed by providing a suitable spacer for a disulfide bond between the drug and the dendrimer. Under reducing conditions in vivo, the dendrimer complex is capable of rapid release of the drug in vivo via a thiol exchange reaction.

[0170] In certain embodiments, the linking moiety includes one or more of the above-mentioned organic functional groups combined with a spacer group. The spacer group can be composed of any combination of atoms, including oligomeric chains and polymer chains; however, the total number of atoms in the spacer group is preferably between 3 and 200 atoms, more preferably between 3 and 150 atoms, more preferably between 3 and 100 atoms, and most preferably between 3 and 50 atoms. Examples of suitable spacer groups include alkyl, heteroalkyl, alkylaryl, oligomeric and polyethylene glycol chains, and oligomeric and poly (amino acid) chains. Changes in the spacer group provide additional control for the release of the drug in vivo. In embodiments where the linking moiety includes a spacer group, one or more organic functional groups are typically used to connect the spacer group to the anti-inflammatory agent and the dendritic macromolecule.

[0171] Reactions and strategies for covalently linking agents to dendrimers are known in the art. See, for example, March, "Advanced Organic Chemistry," 5th Edition, 2001, Wiley-Interscience Publication, New York) and Hermanson, "Bioconjugate Techniques," 1996, Elsevier Academic Press, USA. The appropriate method for covalently linking a given agent can be selected based on the desired linking moiety and the structure of the agent and dendrimer, as it involves compatibility of functional groups, protecting group strategies, and the presence of labile bonds.

[0172] The optimal loading necessarily depends on many factors, including the choice of agent, the structure and size of the dendrimer, and the tissue to be treated. In one embodiment, the Cas9 nuclease is conjugated to the dendrimer in a 1:1 ratio. However, the optimal loading for any given agent, dendrimer, and target site can be determined by routine methods, such as those described.

[0173] In some embodiments, conjugation of the agent and / or linker occurs through one or more surface and / or internal groups. In preferred embodiments, the dendrimer complex retains an effective amount of surface functional groups for targeting specific cell types while being conjugated to an effective amount of an agent to treat, prevent and / or image a disease or condition.

[0174] IV. Pharmaceutical Preparations

[0175] Pharmaceutical compositions comprising the dendrimer-gene editing agent conjugate can be formulated in a conventional manner using one or more physiologically acceptable carriers, optionally including excipients and auxiliaries, which facilitate processing of the active compound into pharmaceutical preparations that can be used for oral, intranasal, subcutaneous, intraperitoneal or intramuscular administration. In some forms, the pharmaceutical composition comprises a glucose-dendrimer-gene editing agent conjugate.

[0176] Suitable formulations depend on the selected route of administration. In preferred embodiments, the composition is formulated for parenteral administration. In certain embodiments, the composition is formulated for intravenous injection. Typically, the composition is formulated in sterile saline or buffered solution for injection into tissue or cells to be treated. The composition can be lyophilized and stored in a disposable vial to be rehydrated immediately before use. Other methods for rehydration and administration are known to those skilled in the art.

[0177] Representative excipients include solvents, diluents, pH regulators, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizers and combinations thereof. Suitable pharmaceutically acceptable excipients are preferably selected from materials generally recognized as safe (GRAS) and can be administered to individuals without causing undesirable biological side effects or undesirable interactions.

[0178] Typically, pharmaceutically acceptable salts can be prepared by reacting the free acid or base form of the medicament with a stoichiometric amount of a suitable base or acid in water or an organic solvent or a mixture of the two; typically, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred. Pharmaceutically acceptable salts include salts of medicaments derived from inorganic acids, organic acids, alkali metal salts and alkaline earth metal salts, and salts (e.g., quaternary ammonium salts) formed by reacting the drug with a suitable organic ligand. A list of suitable salts can be found, for example, in Remington's Pharmaceutical Sciences, 20th edition., Lippincott Williams & Wilkins, Baltimore, MD, 2000, p.704. Examples of ophthalmic drugs sometimes administered in the form of pharmaceutically acceptable salts include timolol maleate, brimonidine tartrate and diclofenac sodium.

[0179] For ease of administration and uniformity of dosage, the composition is preferably formulated in dosage unit form. The phrase "dosage unit form" refers to a physical discrete unit of a conjugate suitable for treating a patient. However, it should be understood that the total single administration of the composition will be determined by the attending physician within the scope of reasonable medical judgment. The therapeutically effective dose can be initially estimated in cell culture tests or animal models (usually mice, rabbits, dogs or pigs). Animal models are also used to obtain the ideal concentration range and route of administration. Then, this information will help determine the effective dose and route for human administration. The therapeutic effect and toxicity of the conjugate can be determined by standard pharmaceutical procedures in cell culture or experimental animals, such as ED50 (the dose has a therapeutic effect in 50% of the population) and LD50 (the dose is lethal to 50% of the population). The dose ratio of toxicity to therapeutic effect is the therapeutic index, expressed as the ratio of LD50 / ED50. Pharmaceutical compositions that exhibit a large therapeutic index are preferred. Data obtained from cell culture tests and animal studies can be used to formulate a dosage range for human use.

[0180] In certain embodiments, the composition of glucose dendrimers is administered topically, for example, by injection directly into the site to be treated. In some embodiments, the composition is injected, topically applied, or otherwise administered directly into the vasculature at or near the site of injury, surgery, or implantation. For example, in embodiments, the composition is topically applied to exposed vascular tissue during a surgical procedure. Typically, local administration results in an increased local concentration of the composition that is greater than that achievable with systemic administration.

[0181] The present invention describes pharmaceutical compositions formulated for parenteral (intramuscular, intraperitoneal, intravenous or subcutaneous) and enteral routes of administration.

[0182] The composition can be administered parenterally. The phrases "parenteral administration" and "parenteral administration" are art-recognized terms that include modes of administration other than enteral and topical administration. The dendrimer can be administered orally, intranasally, subcutaneously, intraperitoneally or intramuscularly. For liquid formulations, the pharmaceutically acceptable carrier can be, for example, an aqueous or non-aqueous solution, a suspension, an emulsion or an oil. Parenteral vehicles (for subcutaneous, intravenous, intraarterial or intramuscular injection) include, for example, sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution and fixed oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol and injectable organic esters such as ethyl oleate. Aqueous vehicles include, for example, water, alcohol / aqueous solutions, cyclodextrins, emulsions or suspensions, including saline and buffered media. The dendrimer can also be administered in the form of an emulsion, such as water-in-oil. The example of oil is oil of petroleum, animal, plant or synthetic origin, for example peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, cod liver oil, sesame oil, cottonseed oil, corn oil, olive oil, vaseline and mineral oil. Suitable fatty acids for parenteral preparations include for example oleic acid, stearic acid and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0183] Formulations suitable for parenteral administration may include antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions, which may include suspending agents, solubilizers, thickeners, stabilizers, and preservatives. Intravenous vehicles may include liquid and nutrient supplements, electrolyte supplements, such as those based on Ringer's dextrose. Typically, water, saline, aqueous dextrose solutions, and related sugar solutions, as well as glycols such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions.

[0184] Injectable pharmaceutical carriers for injectable compositions are well known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, JB Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pp. 238-250 (1982), and ASHP Handbook on Inject A Bile Drugs, Trissel, 15th ed., pp. 622-630 (2009)).

[0185] The compositions can also be formulated as aerosols (i.e., they can be "nebulized") for administration by inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen and air. For administration by inhalation, the compound is delivered in the form of an aerosol spray from a pressurized pack or nebulizer, using a suitable propellant.

[0186] V. How to use

[0187] Methods of using dendrimer-gene editing agent compositions are described.

[0188] In some embodiments, the compositions are capable of in vitro, ex vivo, and in vivo editing in the context of prokaryotic and eukaryotic cells. In further embodiments, the compositions are capable of gene editing in agricultural contexts, such as in plants.

[0189] A. Treatment methods

[0190] The composition can be used for ex vivo or in vivo gene editing. The method generally comprises contacting a cell with an effective amount of a dendrimer-gene editing agent composition to modify the genome of the cell. As discussed in more detail below, contacting can occur ex vivo or in vivo. In a preferred embodiment, the method comprises contacting a target cell population with an effective amount of a gene editing composition to modify the genome of a sufficient number of cells to obtain a desired result, such as a therapeutic result or a modified trait.

[0191] For example, an effective amount or therapeutically effective amount can be a dose sufficient to treat, inhibit or alleviate one or more symptoms of a disease or condition, or a dose sufficient to provide a desired pharmacological and / or physiological effect, such as reducing, inhibiting or reversing one or more underlying pathophysiological mechanisms behind a disease or condition.

[0192] Formulated into a preparation suitable for the mode of administration. The pharmaceutically acceptable carrier depends in part on the specific composition being administered, and the specific method for administering the composition. Therefore, there are a variety of suitable formulations for pharmaceutical compositions containing nucleic acids. The exact dosage will vary according to a variety of factors, such as subject variables (e.g., age, immune system health, clinical symptoms, etc.). Exemplary symptoms, pharmacological and physiological effects will be discussed in detail below.

[0193] The composition can be administered once, twice, or three times a day, once, twice, three times, four times, five times, six times, seven times a week, or once, twice, three times, four times, five times, six times, seven times, or eight times a month, in a manner of contacting or otherwise contacting the target cell. For example, in some embodiments, the composition is administered once every two or three days, or an average of about 2 to about 4 times a week.

[0194] In preferred embodiments, the composition is administered in an amount effective to induce genetic modification in at least one target allele at a frequency of at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25% of the target cells. In some embodiments, particularly in ex vivo applications, the genetic modification occurs at a frequency of about 0.1-25%, or 0.5-25%, or 1-25%, 2-25%, or 3-25%, or 4-25%, or 5-25%, or 6-25%, or 7-25%, or 8-25%, or 9-25%, or 10-25%, 11-25%, or 12-25%, or 13%-25%, or 14%-25% or 15-25%, or 2-20%, or 3-20%, or 4-20%, or 5-20%, or 6-20%, or 7-20%, or 8-20%, or 9-20%, or 10-20%, 11-20%, or 12-20%, or 13%-20% or 14%-20% or 15-20%, 2-15%, or 3-15%, or 4-15%, or 5-15%, or 6-15%, or 7-15%, or 8-15%, or 9-15%, or 10-15%, 11-15%, or 12-15%, or 13%-15%, or 14%-15%.

[0195] In some embodiments, particularly for in vivo applications, the frequency of genetic modification occurring in at least one target allele is from about 0.1% to about 10%, or from about 0.2% to about 10%, or from about 0.3% to about 10%, or from about 0.4% to about 10%, or from about 0.5% to about 10%, or from about 0.6% to about 10%, or from about 0.7% to about 10%, or from about 0.8% to about 10%, or from about 0.9% to about 10%, or from about 1.0% or about 10%, or from about 1.1% to about 10%, or from about 1.2% to about 10%. %, or about 1.2% to about 10%, or about 1.3% to about 10%, or about 1.4% to about 10%, or about 1.5% to about 10%, or about 1.6% to about 10%, or about 1.7% to about 10%, or about 1.8% to about 10%, or about 1.9% to about 10%, or about 2.0% to about 10%, or about 2.5% to about 10%, or about 3.0% to about 10%, or about 3.5% to about 10%, or about 4.0% to about 10%, or about 4.5% to about 10%, or about 5.0% to about 10%.

[0196] In some embodiments, the genetic modification occurs with low off-target effects. In some embodiments, off-target modifications cannot be detected using conventional analysis. In some embodiments, the frequency of off-target events is 0-1%, or 0-0.1%, or 0-0.01%, or 0-0.001%, or 0-0.0001%, or 0-0000.1%, or 0-0.000001%. In some embodiments, the frequency of off-target modifications is about 102, 103, 104, or 105 times lower than the target site.

[0197] In some embodiments, the method includes the step of selecting a subject who may benefit from treatment with a dendrimer-gene editing agent composition.

[0198] 1. Ex vivo gene therapy

[0199] In some embodiments, ex vivo gene therapy of cells is used to treat a genetic disease in a subject. For ex vivo gene therapy, cells are isolated from a subject and contacted with a composition ex vivo to produce cells containing a genetic mutation or a neighboring genetic mutation. In a preferred embodiment, the cells are isolated from the subject to be treated or a homologous host. Prior to contact with the gene editing composition and the preferred enhancement factor, the target cells are removed from the subject. The cells can be hematopoietic progenitor cells or stem cells. In a preferred embodiment, the target cells are CD34 + Hematopoietic stem cells. Hematopoietic stem cells (HSC), such as CD34 + CD34 cells are pluripotent stem cells that give rise to all blood cell types, including red blood cells. Thus, CD34 cells can be isolated from patients with, for example, thalassemia, sickle cell disease, or lysosomal storage diseases. + Cells, using the compositions and methods to alter or repair mutant genes in vitro, and reintroducing the cells into a patient as a treatment or cure.

[0200] Those skilled in the art can isolate and enrich stem cells. + Such separation and enrichment methods of and other cells are known in the art and are disclosed in, for example, U.S. Pat. Nos. 4,965,204; 4,714,680; 5,061,620; 5,643,741; 5,677,136; 5,716,827; 5,750,397 and 5759793. As used herein in the context of a composition enriched in hematopoietic progenitor cells and stem cells, "enriched" means that the proportion of the desired element (e.g., hematopoietic progenitor cells and stem cells) is higher than that found in the natural source of the cell. The cell composition can be enriched by at least one order of magnitude, preferably two or three orders of magnitude, more preferably 10, 100, 200 or 1000 orders of magnitude than the natural source of the cell.

[0201] In humans, CD34 + Cells can be recovered from umbilical cord blood, bone marrow, or blood following cytokine mobilization by subcutaneous or intravenous injection of hematopoietic growth factors (e.g., granulocyte colony stimulating factor (G-CSF), granulocyte-monocyte colony stimulating factor (GM-CSF), stem cell factor (SCF)) into the donor in an amount sufficient to move hematopoietic stem cells from the bone marrow space into the peripheral circulation. Initially, bone marrow cells can be obtained from any suitable bone marrow source, such as the tibia, femur, spine, and other bone cavities. To isolate the bone marrow, the bones can be flushed with a suitable solution, which will be a balanced salt solution, conveniently supplemented with fetal bovine serum or other naturally occurring factors, and simultaneously with an acceptable low concentration buffer, typically about 5-25 mM. Convenient buffers include Hepes, phosphate buffer, lactate buffer, and the like.

[0202] Cells can be selected by positive and negative selection techniques. Cells can be selected using commercially available antibodies that bind to hematopoietic progenitor or stem cell surface antigens (e.g., CD34) using methods known to those skilled in the art. For example, antibodies can be bound to magnetic beads and immunogenicity procedures can be used to recover the desired cell types. Other techniques include the use of fluorescence activated cell sorting (FACS). The CD34 antigen found on progenitor cells in the hematopoietic system of non-leukemic individuals is expressed on a cell population recognized by the monoclonal antibody My-10 (i.e., expresses the CD34 antigen) and can be used to isolate stem cells for bone marrow transplantation. My-10, deposited as HB-8483 at the American Type Culture Collection (Rockville, Md), is commercially available as anti-HPCA 1. In addition, any desired cell marker can be selected using negative selection of differentiated and "dedicated" cells from human bone marrow. For example, progenitor cells or stem cells, most preferably CD34 + cells, which can be characterized as CD3 - 、CD7 - 、CD8 - 、CD10 - 、CD14 - 、CD15 - 、CD19 - 、CD20 - 、CD33 - , HLA class II + and Thy-1 + Any of the above.

[0203] Once the progenitor or stem cells are isolated, they can be propagated by growing them in any suitable culture medium. For example, the progenitor or stem cells can be grown in conditioned medium from stromal cells, such as those obtained from the bone marrow or liver that are associated with factor secretion, or in a culture medium that includes cell surface factors that support stem cell proliferation. Hematopoietic cells can be removed from the stromal cells using appropriate monoclonal antibodies to remove unwanted cells.

[0204] The isolated cells are contacted in vitro with a combination of a triplex forming molecule and a donor oligonucleotide, an effective amount of which causes a desired mutation in or near a gene to be repaired or altered, such as a human β-globin or α-L-iduronidase gene. These cells are referred to herein as modified cells. Methods for transfecting cells with oligonucleotides and peptide nucleic acids are well known in the art (Koppelhus, et al., Adv. Drug Deliv. Rev., 55(2): 267-280 (2003)). It may be necessary to synchronize the cells into the S phase to further increase the frequency of gene correction. Methods for synchronizing cultured cells, such as by double thymidine blocking, are methods known in the art.

[0205] The modified cells can be maintained or expanded in culture prior to administration to a subject. Culture conditions are generally known in the art and depend on the cell type. + The maintenance conditions have been well studied, and there are several suitable methods available. A common method for in vitro multipotent hematopoietic cell expansion is to culture purified progenitor cells or stem cells in the presence of cytokines such as interleukin-3 early action. It is also shown that a combination of thrombopoietin (TPO), stem cell factor (SCF) and flt3 ligand (Flt-3L, i.e., a ligand of the flt3 gene product) in a nutrient medium for in vitro maintenance of hematopoietic progenitor cells can be used to expand primitive (i.e., relatively undifferentiated) human hematopoietic progenitor cells in vitro, and these cells can be colonized in SCID-hu mice (Luens et al., 1998, Blood 91: 1206-1215). In other known methods, cells can be maintained in vitro in a nutrient medium (e.g., several minutes, hours, or 3, 6, 9, 13 or more days), and the culture medium includes mouse prolactin-like protein E (mPLP-E) or mouse prolactin-like protein F (mPIP-F; collectively referred to as mPLP-E / IF) (U.S. Patent No. 6,261,841). It will be appreciated that other suitable cell culture and expansion methods may also be used in accordance with the present invention. Cells may also be grown in serum-free medium, as described in US Pat. No. 5,945,337.

[0206] In another embodiment, the modified hematopoietic stem cells are differentiated into CD4 T cells in vitro using a specific combination of interleukins and growth factors prior to administration to a subject using methods well known in the art. + Cell Culture. The cells can be expanded in vitro to a greater extent than the original population of isolated hematopoietic stem cells, preferably at least 5-fold, more preferably at least 10-fold, even more preferably at least 20-fold.

[0207] In another embodiment of cells for ex vivo gene therapy, the cells to be used can be dedifferentiated somatic cells. Somatic cells can be reprogrammed to become pluripotent stem cell-like cells, which can be induced to become hematopoietic progenitor cells. The hematopoietic progenitor cells can then be treated with triplex-forming molecules and donor oligonucleotides, as described above for CD34 + Cells are described to produce recombinant cells with one or more modified genes. Representative somatic cells that can be reprogrammed include, but are not limited to, fibroblasts, adipocytes, and muscle cells. Hematopoietic progenitor cells from induced stem cell-like cells have been successfully developed in mice (Hanna, et al., Science, 318: 1920-1923 (2007)).

[0208] In order to produce hematopoietic progenitor cells from induced stem-like cells, somatic cells are collected from the host. In a preferred embodiment, the somatic cells are autologous fibroblasts. The cells are cultured and transduced with vectors encoding Oct4, Sox2, Klf4 and c-Myc transcription factors. The transduced cells are cultured and screened for embryonic stem cell (ES) morphology and ES cell markers, including but not limited to AP, SSEA1 and Nanog. The transduced ES cells are cultured and induced to produce induced stem-like cells. The cells are then screened for CD41 and c-kit markers (early hematopoietic progenitor cell markers) as well as bone marrow and erythroid differentiation markers.

[0209] The modified hematopoietic stem cells or modified induced hematopoietic progenitor cells are then introduced into the subject. Delivery of the cells can be effected in a variety of ways, most preferably including intravenous administration by infusion and direct injection into the periosteum, bone marrow and / or subcutaneous sites.

[0210] Subjects receiving modified cells may receive bone marrow conditioning therapy to promote engraftment of the cells. Prior to administration of the cells, the recipient may be treated with radiation or chemotherapy to enhance engraftment. After administration, the cells typically require a period of time to engraft. It typically takes weeks to months to achieve significant engraftment of hematopoietic stem or progenitor cells.

[0211] It is expected that a high proportion of modified hematopoietic stem cells will not be required to achieve a significant preventive or therapeutic effect. It is expected that the implanted cells will expand over time after implantation to increase the percentage of modified cells. It is expected that only a small number or a small proportion of modified hematopoietic stem cells will be implanted to achieve a preventive or therapeutic effect.

[0212] In preferred embodiments, the cells administered to the subject will be autologous, eg, derived from the subject, or will be syngeneic.

[0213] In a preferred embodiment, the guide RNA can be used for specific gene editing of in vitro and in vivo cell therapies, including CAR-T, CAR-NK and CAR-macrophage editing. In a further embodiment, the guide RNA can knock out and knock in one or more genes or gene fragments in iPSC, ESC, mesenchymal stem cells and stem cell-derived cell lines.

[0214] 2. In vivo gene therapy

[0215] In some forms, the composition is administered directly to a subject for in vivo gene therapy. When the composition is administered directly to a subject, the composition is generally delivered as a pharmaceutically acceptable formulation, by a route and in an amount effective for the intended gene therapy.

[0216] Dendrimer compositions, particularly glucose dendrimers, selectively target neurons, which play a key role in the pathogenesis of many diseases and disorders, including neurodevelopment, neurodegenerative diseases, and brain cancer. Thus, in a preferred embodiment, dendrimer compositions, particularly glucose dendrimers, are systemically administered and cross the blood-brain barrier (BBB) ​​to selectively target or accumulate within neurons, preferably within the neuronal nuclei of damaged / overactive neurons.

[0217] In other forms, the dendrimer compositions are capable of targeted editing of specific cells in vivo, including reactive immune cells, including reactive microglia, macrophages, astrocytes, retinal pigment epithelial cells (RPE cells), through the ability of the hydroxy PAMAM dendrimers to target these cells.

[0218] Typically, the dendrimer composition is administered in vivo in a dosage unit amount effective to treat or alleviate one or more conditions or diseases in a subject. In certain forms, the one or more conditions or diseases are associated with one or more neuronal pathological conditions. Typically, by targeting these cells, the dendrimer delivers an effective amount of the gene editing composition to specifically modify the genome of a sufficient number of diseased neurons to achieve a therapeutic result.

[0219] B. Conditions and Diseases to be Treated

[0220] Gene therapy using dendrimer-gene editing agent compositions is obvious when studied in the context of human genetic diseases, such as cystic fibrosis, hemophilia, hemoglobinopathies such as sickle cell anemia and β-thalassemia, xeroderma pigmentosum, and lysosomal storage diseases, although these strategies can also be used to treat non-genetic diseases such as HIV in the context of in vitro-based cell modification and in vivo cell modification. The compositions are particularly useful for treating genetic defects, disorders, and diseases caused by single gene mutations, for example, to correct genetic defects, disorders, and diseases caused by point mutations. If the target gene contains a mutation that causes a genetic disease, the composition can be used for mutagenesis repair to restore the DNA sequence of the target gene to normal. The target sequence can be within the coding DNA sequence of the gene or within an intron. The target sequence can also be within a DNA sequence that regulates the expression of the target gene, including a promoter or enhancer sequence.

[0221] In some embodiments, the compositions are particularly useful for treating monogenic and polygenic diseases, wherein the dendrimer is conjugated or complexed with one or more sgRNA constructs.

[0222] If the target gene is an oncogene that causes uncontrolled proliferation, such as in cancer cells, then oligonucleotides can be used to cause mutations, inactivate genes, and terminate or reduce uncontrolled cell proliferation. Oligonucleotides are also useful anticancer agents for activating repressor genes that have lost the ability to inhibit proliferation. The target gene can also be a gene encoding an immunomodulatory factor, such as programmed cell death protein 1 (PD-1), to enhance the host's immune response to cancer. Genetic modification technology can be designed to reduce or prevent the expression of PD-1 and to be administered in an effective amount to achieve this purpose. Therefore, in some embodiments, the composition is used to treat cancer.

[0223] The compositions are useful as antiviral agents, for example, when designed to modify specific portions of the viral genome that are necessary for normal proliferation or function.

[0224] Dendrimer compositions, particularly glucose dendrimers, selectively target neurons, which play a key role in the pathogenesis of many diseases and disorders, including neurodevelopment, neurodegenerative diseases, and brain cancer. In a preferred embodiment, the dendrimer compositions, particularly glucose dendrimers, cross the blood-brain barrier (BBB) ​​and selectively target or accumulate within neurons, preferably within the neuronal nuclei of damaged / overactive neurons.

[0225] In further embodiments, the dendrimer compositions are capable of targeted editing of specific cells in vivo, including reactive immune cells, including reactive microglia, macrophages, astrocytes, retinal pigment epithelial cells (RPE cells), by virtue of the ability of the hydroxy PAMAM dendrimers to target these cells.

[0226] Thus, the dendrimer composition is administered in a dosage unit amount effective to treat or ameliorate a condition associated with a neuronal pathological condition. Typically, by targeting these cells, the dendrimer delivers an effective amount of the gene editing composition to specifically modify the genome of a sufficient number of diseased neurons to achieve a therapeutic result.

[0227] In particular, the dendrimer compositions are useful for treating one or more diseases and conditions in the eye, brain and nervous system, particularly those associated with pathological activation of neurons, microglia and / or astrocytes. The compositions and methods are also useful for prophylactic applications.

[0228] In some embodiments, the subject to be treated is a human. In some embodiments, the subject to be treated is a child or infant. All methods may include the step of identifying and selecting a subject in need of treatment or a subject who will benefit from administering the composition.

[0229] 1. Eye diseases and conditions

[0230] The compositions and methods are useful for treating one or more diseases and conditions of the eye.

[0231] In a preferred embodiment, the eye disease to be treated is age-related macular degeneration (AMD). Age-related macular degeneration (AMD) is a neurodegenerative, neuroinflammatory disease of the macula that is responsible for central vision loss. The pathogenesis of age-related macular degeneration involves chronic neuroinflammation of the choroid (the vascular layer beneath the retina), the retinal pigment epithelium (RPE), the cell layer beneath the neural retina, Bruch's membrane, and the neural retina itself.

[0232] Current treatments for exudative retinal diseases, such as neovascular or "wet" age-related macular degeneration (AMD) and diabetic retinopathy, involve intraocular injections of drugs that target vascular endothelial growth factor (VEGF). These anti-VEGF drugs require frequent injections into the eye, which is not only costly but also burdensome for patients.

[0233] As shown in the examples below, dendrimer-Cas9 RNP is effective in editing the VEGF gene. Thus, in some embodiments, the composition is administered in an amount effective to permanently inhibit the secretion of VEGF from human retinal cells.

[0234] In some embodiments, the eye disease is inherited blindness caused by specific gene mutations, such as Leber congenital amaurosis, the most common cause of inherited childhood blindness.

[0235] Other examples of eye diseases that can be treated include amebic keratitis, fungal keratitis, bacterial keratitis, viral keratitis, periocular keratitis, bacterial keratoconjunctivitis, viral keratoconjunctivitis, corneal dystrophic diseases, Fuchs endothelial dystrophy, meibomian gland dysfunction, anterior and posterior blepharitis, conjunctival hyperemia, conjunctival necrosis, keloid scarring and fibrosis, punctate epithelial keratopathy, filamentary keratitis, corneal erosions, thinning, ulcers and perforations, Sjögren's syndrome, Stevens-Johnson syndrome, autoimmune dry eye, environmental dry eye, corneal neoplasia Tubular disease, prevention and treatment of post-keratoplasty rejection, autoimmune uveitis, infectious uveitis, anterior uveitis, posterior uveitis (including toxoplasmosis), panuveitis, inflammatory diseases of the vitreous or retina, prevention and treatment of endophthalmitis, macular edema, macular degeneration, age-related macular degeneration, proliferative and non-proliferative diabetic retinopathy, hypertensive retinopathy, autoimmune diseases of the retina, primary and metastatic intraocular melanoma, other intraocular metastatic tumors, glaucoma, open-angle glaucoma, angle-closure glaucoma, pigmentary glaucoma, and combinations thereof.

[0236] 2. Neurological and neurodegenerative diseases

[0237] Dendrimer compositions and formulations are useful for treating one or more neurological and neurodegenerative diseases. In some embodiments, the disease or condition is selected from, but not limited to, some psychiatric disorders (e.g., depression, schizophrenia (SZ), alcohol use disorder, and morphine analgesia tolerance), neurological and neurodegenerative disorders (e.g., Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS)). In one embodiment, the dendrimer complex is used to treat Alzheimer's disease (AD) or dementia.

[0238] Neurodegenerative diseases are chronic progressive diseases of the nervous system that affect neurological and behavioral functions and involve biochemical changes that lead to different histopathological and clinical syndromes (Hardy H, et al., Science. 1998; 282: 1075–9). Abnormal proteins that resist cellular degradation mechanisms accumulate within cells. The pattern of neuronal loss is selective, i.e., one group of neurons is affected while other neurons remain intact. Usually, there is no clear inciting event for this disease. Diseases commonly described as neurodegenerative diseases are Alzheimer's disease, Huntington's disease, and Parkinson's disease.

[0239] The composition and method deliver an effective amount of a gene editing composition for treating a neurological or neurodegenerative disease or disorder or a central nervous system disorder. In a preferred embodiment, the composition and method can effectively treat and / or alleviate neuroinflammation associated with a neurological or neurodegenerative disease or disorder or a central nervous system disorder. The method generally comprises administering to a subject an effective amount of a composition to improve cognition or reduce cognitive decline, improve cognitive function or reduce cognitive decline, improve memory or reduce memory decline, improve learning ability or capacity or reduce decline in learning ability or capacity, or both.

[0240] In some embodiments, the neurological disease or disorder is Huntington's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, childhood cerebral adrenoleukodystrophy (ccALD), muscular dystrophy, Friedreich's ataxia, and spinocerebellar ataxia.

[0241] In one embodiment, the disease or disorder is Duchenne muscular dystrophy, which is caused by mutations in the DMD gene encoding a protein essential for muscle contraction.

[0242] In another embodiment, the disease or condition is Huntington's disease. Huntington's disease is caused by an abnormal duplication of a DNA sequence in the huntingtin gene. Treating Huntington's disease can be tricky because any off-target effects of CRISPR in the brain could have very dangerous consequences. In a preferred embodiment, the dendrimer-gene editing agent combination can be selectively delivered to target cells with minimal off-target effects.

[0243] In another embodiment, the disease or condition is spinal muscular atrophy. Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease caused by mutations in the survival motor neuron 1 (SMN1) telomeric gene. Ubiquitous SMN functional defects affect multiple tissues and organs; however, neuronal tissues are primarily sensitive, leading to degeneration of α-motor neurons in the anterior horns of the spinal cord, followed by neuromuscular junction dysfunction and proximal muscle weakness. Therefore, in some embodiments, a dendrimer-gene editing composition is administered to increase SMN levels in affected tissues for the treatment of spinal muscular atrophy, for example, by applying targeted genome editing technology to the human SMN locus so as to restore the SMN2 sequence to an SMN1-like sequence that can be properly spliced ​​under endogenous transcriptional control.

[0244] In other embodiments, the compositions and methods can be used to treat a subject having a disease or condition, such as Parkinson's disease (PD) and PD-related conditions, amyotrophic lateral sclerosis (ALS), prion diseases such as Creutzfeldt-Jakob disease, corticobasal degeneration, frontotemporal dementia, HIV-associated cognitive impairment, mild cognitive impairment, motor neuron disease (MND), Lewy body disease, Alpers disease, neuronal ceroid lipofuscinosis, Batten disease, cerebro-oculofacial-skeletal syndrome, corticobasal degeneration, Gerstmann-Straussler-Scheinker disease, cheinkerDisease), kuru, Leigh's disease, monosomic muscular dystrophy, multiple system atrophy, with orthostatic hypotension (Shy-Drager syndrome), multiple sclerosis (MS), Duchenne muscular dystrophy (DMD), neurodegeneration with brain iron accumulation, optic nerve myoclonus, posterior cortical atrophy, primary progressive aphasia, progressive supranuclear palsy, vascular dementia, progressive multifocal leukoencephalopathy, dementia with Lewy bodies (DLB), lacunar syndrome, hydrocephalus, Wernicke-Korsakoff syndrome, postencephalitic dementia, cancer and chemotherapy-related cognitive impairment and dementia, depression-induced dementia and pseudodementia.

[0245] In other embodiments, the disease or condition is injection-localized amyloidosis, cerebral amyloid angiopathy, myopathy, neuropathy, brain trauma, frontotemporal dementia, Pick's disease, multiple sclerosis, prion disease, type 2 diabetes, fatal familial insomnia, arrhythmias, isolated atrial amyloidosis, atherosclerosis, rheumatoid arthritis, familial amyloid polyneuropathy, hereditary non-neurological systemic amyloidosis, Finnish amyloidosis, lattice corneal dystrophy, systemic light-chain amyloidosis, neuropathic Gaucher disease, or Down syndrome. In preferred embodiments, the disease or condition is Alzheimer's disease or dementia.

[0246] 3. Neurodevelopmental disorders

[0247] Neurodevelopmental disorders generally mean that the brain is not formed properly from the beginning. Basic processes of neurodevelopment may be dysregulated, or there may be various forms of damage that disrupt them. Autism and ADHD are classically described as neurodevelopmental disorders. Others include fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipid storage diseases. The compositions and methods can also be used to treat neurodevelopmental disorders, such as cerebral palsy.

[0248] 4. Cancer

[0249] In some embodiments, the dendrimer-gene editing agent composition is administered to a subject with a proliferative disease, such as a benign or malignant tumor. In some embodiments, the subject to be treated has been diagnosed with stage I, II, III, or IV cancer.

[0250] The word cancer refers specifically to malignant tumors. In addition to uncontrolled growth, malignant tumors also exhibit metastasis. In this process, small clusters of cancer cells break away from the tumor, invade blood or lymphatic vessels, and are carried to other tissues, where they continue to multiply. In this way, a primary tumor in one site can give rise to a secondary tumor in another site.

[0251] The compositions and methods can be used to treat subjects with benign or malignant tumors, delay or inhibit tumor growth in the subject, reduce tumor growth or size, inhibit or reduce tumor metastasis, and / or inhibit or reduce symptoms associated with tumor occurrence or growth.

[0252] Malignant tumors that can be treated are classified according to the embryonic origin of the tissue from which the tumor originates. Carcinomas are tumors that arise from endoderm or ectoderm tissues, such as the skin or the epithelial lining of internal organs and glands. The composition is particularly effective in treating cancer. Sarcomas occur less frequently and originate from mesodermal connective tissues, such as bone, fat, and cartilage. Leukemias and lymphomas are malignant tumors of the hematopoietic cells of the bone marrow. Leukemias proliferate in the form of single cells, while lymphomas tend to grow in the form of tumor masses. Malignant tumors may arise in many organs or tissues of the body, thus forming cancer.

[0253] Cancer types that can be treated with the compositions and methods include, but are not limited to, cancers such as vascular cancers, such as multiple myeloma, adenocarcinomas, and sarcomas, as well as bone cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, and uterine cancer. In some embodiments, the composition is used to treat multiple cancer types simultaneously. The composition can also be used to treat metastases or tumors at multiple sites.

[0254] Exemplary tumor cells include tumor cells of cancer, including leukemias, including but not limited to acute leukemias, acute lymphocytic leukemias, acute myeloid leukemias, such as myeloblastic leukemia, promyelocytic leukemia, myelomonocytic leukemia, monocytic leukemia, erythroleukemic leukemia, and myelodysplastic syndrome, chronic leukemias, such as but not limited to chronic myeloid (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas, such as but not limited to Hodgkin's lymphoma, non-Hodgkin's lymphoma; multiple myeloma, such as but not limited to smoldering multiple myeloma, non-secretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma, and extramedullary plasmacytoma; Waldenstrom's macroglobulinemia; monoclonal gammopathy of undetermined significance; benign monoclonal gammopathy; heavy chain disease; bone and connective tissue sarcomas, such as but not limited to osteosarcoma, osteosarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft tissue sarcoma, angiosarcoma (angiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, schwannoma, rhabdomyosarcoma, synovial sarcoma; brain tumors, including but not limited to gliomas, astrocytomas, brain stem gliomas, ependymomas, oligodendrogliomas, non-gliomas, acoustic neuromas, craniopharyngiomas, medulloblastomas, meningiomas, pineal cell tumors, pineoblastomas, primary brain lymphomas; breast cancer, including but not limited to limited to adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, Paget's disease, and inflammatory breast cancer; adrenal cancer, including but not limited to pheochromocytoma and adrenocortical carcinoma; thyroid cancer, such as but not limited to papillary or follicular thyroid cancer, medullary thyroid cancer, and anaplastic thyroid cancer; pancreatic cancer, including but not limited to insulinoma, gastrinoma, glucagonoma, vipoma, somatostatin-secreting tumor, and carcinoid or islet cell tumor; pituitary cancer, including but not limited to Cushing's disease, prolactin-secreting tumor, acromegaly, and diabetes insipidus; eye cancer, including but not limited to ocular melanoma, such as iris melanoma, choroidal melanoma, and ciliary body melanoma, and retinoblastoma Vaginal cancer, including but not limited to squamous cell carcinoma, adenocarcinoma, and melanoma; Vulvar cancer, including but not limited to squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget's disease; Cervical cancer, including but not limited to squamous cell carcinoma and adenocarcinoma; Uterine cancer, including but not limited to endometrial carcinoma and uterine sarcoma; Ovarian cancer, including but not limited to epithelial ovarian cancer, borderline tumors, germ cell tumors, and stromal tumors; Esophageal cancer, including but not limited to squamous cell carcinoma, adenocarcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small cell) carcinoma; Gastric cancer, including but not limited to adenocarcinoma, fungoid (polypoid), ulcer, superficial spreading, diffuse spreading, malignant lymphoma, liposarcoma, fibrosarcoma and carcinosarcoma; colon cancer; rectal cancer; liver cancer, including but not limited to hepatocellular carcinoma and hepatoblastoma, gallbladder cancer, including but not limited to adenocarcinoma; bile duct cancer, including but not limited to papillary, nodular and diffuse; lung cancer, including but not limited to non-small cell lung cancer, squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large cell carcinoma and small cell lung cancer; testicular cancer, including but not limited to germinal tumor, seminoma, anaplastic, typical (typical), spermatocytic carcinoma, non-seminoma, embryonal carcinoma, teratoma, choriocarcinoma (yolk sac tumor), prostate cancer, including but not limited to adenocarcinoma, leiomyosarcoma and rhabdomyosarcoma; penile cancer; oral cancer, including but not limited to squamous cell carcinoma; basal carcinoma; salivary gland cancer, including but not limited to adenocarcinoma, mucoepidermoid carcinoma and adenoid cystic carcinoma;Pharyngeal cancer, including but not limited to squamous cell carcinoma and verrucous carcinoma; skin cancer, including but not limited to basal cell carcinoma, squamous cell carcinoma and melanoma, superficial spreading melanoma, nodular melanoma, lentigo malignant melanoma, acral lentigo melanoma; kidney cancer, including but not limited to renal cell carcinoma, adenocarcinoma, high nephroma, fibrosarcoma, transitional cell carcinoma (renal pelvis and / or ureter); Wilms tumor; bladder cancer, including but not limited to transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, carcinosarcoma. In one embodiment, the cancer is a brain metastasis in a leukemia patient. ;

[0255] Cancers that can be prevented, treated or alleviated by the composition include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovioma, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchial carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma and gastric cancer (for reviews of these diseases, see Fishman et al., 1985, Medicine, 2d Ed., JB Lippincott Co., Philadelphia and Murphy et al., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books USA, Inc., United States of America).

[0256] In a further embodiment, the composition is used for preventive applications, i.e., prevention, delay of onset, reduction, eradication or delay of exacerbation of signs or symptoms after onset, and prevention of recurrence. For preventive applications, a therapeutically effective amount of the composition or a pharmaceutically acceptable salt thereof is administered to a subject before onset (e.g., before obvious signs of cancer), in early stages of onset (e.g., after initial signs and symptoms of cancer), or after cancer development is determined. Preventive administration can be performed a few days or years before the onset of symptoms. Preventive administration can be used, for example, for chemopreventive treatment of subjects with precancerous lesions, subjects diagnosed with early malignancies, and subgroups (e.g., families, races, and / or occupations) with susceptibility to specific cancers.

[0257] C. Dosage and Effective Amount

[0258] The dosage and administration regimen will depend on the severity and site of the disease or injury and / or the method of administration, as well as the specific agent being delivered. This can be determined by one skilled in the art.

[0259] In some embodiments, dosages are expressed in mg / kg, particularly when expressed as in vivo dosages of dendrimer-gene editing compositions.

[0260] Typically, the dosage will be in the range of from μg / kg to about 100 mg / kg body weight. The dosage can be, for example, 0.01 mg / kg to about 1,000 mg / kg per dose, or 0.5 mg / kg to about 1,000 mg / kg, or 1 mg / kg to about 1,000 mg / kg, or about 10 mg / kg to about 500 mg / kg, or about 20 mg / kg to about 500 mg / kg per dose, or 20 mg / kg to about 100 mg / kg per dose, or 25 mg / kg to about 75 mg / kg per dose, or about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75 mg / kg per dose.

[0261] Preferably, the dendrimer-gene editing agent composition does not target or otherwise genetically modify non-target cells or healthy cells that are not in or associated with the diseased tissue, or targets or genetically modifies non-target cells or healthy cells at a reduced level compared to cells associated with a disease or disorder (such as cancer and / or a proliferative disorder). In this way, byproducts and other side effects associated with the composition are reduced. Therefore, in a preferred embodiment, the dendrimer composition is administered in an amount that results in improved or enhanced function in an individual with a disease or disorder (such as cancer and / or a proliferative disorder).

[0262] The actual effective amount of the composition may vary depending on a variety of factors, including the specific agent being administered, the specific composition formulated, the mode of administration, the age, weight, condition, and route of administration and the disease or condition being treated. In general, the dose for intravenous injection or infusion will be lower than that for oral administration.

[0263] The dosage can vary and can be administered once or multiple times per day for one or more days. Appropriate dosage guidelines for a given class of drug products can be found in the literature. The optimal dosing regimen can be calculated by measuring drug accumulation in a subject or patient. One of ordinary skill in the art can easily determine the optimal dose, method of administration, and repetition rate. The optimal dose can vary according to the relative efficacy of a single pharmaceutical composition and can generally be estimated based on effective doses in in vitro and in vivo animal models.

[0264] Also provided are dosage forms of pharmaceutical compositions comprising the dendrimer compositions. "Dosage form" refers to the physical form of a dosage intended for administration to a patient, such as a capsule or vial. The term "dosage unit" refers to the amount of a therapeutic compound administered to a patient in a single dose.

[0265] In general, the timing and frequency of dosing will be adjusted to balance the efficacy of a given therapeutic or diagnostic regimen with the side effects of a given delivery system.

[0266] In some embodiments, the dose is administered daily, biweekly, weekly, biweekly, or less frequently in an amount that provides a therapeutically effective increase in the blood level of the therapeutic agent. When administration is not by oral route, the composition can be delivered over a period of more than 1 hour, such as 3-10 hours, to produce a therapeutically effective dose within 24 hours. Alternatively, the composition can be formulated as a controlled release formulation, wherein the composition is administered in a single dose that is repeated once a week or less frequently.

[0267] Those of ordinary skill in the art will appreciate that the dosing regimen can be any length of time sufficient to treat the subject's disease. In some embodiments, the regimen includes one or more cycles of a round of treatment followed by a drug holiday (e.g., no drug). The drug holiday can be 1, 2, 3, 4, 5, 6, or 7 days; or 1, 2, 3, 4 weeks, or 1, 2, 3, 4, 5, or 6 months.

[0268] D. Control

[0269] The results of treatment with a composition comprising one or more gene editing compositions bound or conjugated to a dendrimer can be compared to a control. Suitable controls are known in the art and include, for example, untreated subjects or placebo-treated subjects. A typical control is a comparison of the condition or symptoms of a subject before and after administration of a glucose dendrimer composition. The condition or symptom can be a biochemical, molecular, physiological, or pathological readout. For example, the effect of a composition on a particular symptom, pharmacological, or physiological index can be compared to the condition of an untreated subject or a subject before treatment. In some embodiments, the subject's symptoms, pharmacological, or physiological index are measured before treatment and measured again one or more times after treatment begins. In some embodiments, the control is a reference level, or an average value determined based on measuring one or more symptoms, pharmacological, or physiological indexes of subjects who do not have the disease or condition to be treated (e.g., healthy subjects). In some embodiments, the treatment effect is compared to conventional treatments known in the art. In some embodiments, the untreated control subject suffers from the same disease or condition as the treated subject.

[0270] In some embodiments, a control includes an equivalent amount of a gene editing composition delivered alone or conjugated to a gene editing composition without a glucose-based branching unit, such as a dendrimer of similar generation number, molecular weight, and / or surface group density (e.g., hydroxyl groups).

[0271] VI.Medicine Box

[0272] The composition can be packaged in a kit. The kit can include a single or multiple doses of a composition comprising one or more gene editing compositions combined or conjugated with dendrimers (e.g., one or more hydroxy PAMAM dendrimers or glucose dendrimers as described in the Examples), and instructions for administering the composition. Specifically, the instructions indicate that an effective amount of the dendrimer composition is administered to an individual suffering from the indicated specific disease / disorder. The composition can be formulated as described above with reference to a specific treatment method and can be packaged in any convenient manner.

[0273] The present invention will be further understood by reference to the following non-limiting examples. Example

[0274] Example 1: Synthesis of Glucose G1 and G2 Dendrimers

[0275] Figure 1 is a schematic diagram showing the stepwise synthesis of first generation (G1) glucose dendrimers. Figure 2 is a schematic diagram showing the stepwise synthesis of second generation (G2) glucose dendrimers using an efficient click chemistry approach.

[0276] GD synthesis was initiated by reacting the hexapropargylated core with AB4, β-D-glucose-PEG4-azide building blocks via a click reaction to obtain the first generation of glucose dendrimers (GD1). Figure 2 The OH groups on GD1 were propargylated to obtain GD1-acetylene 24, which reacted with β-D-glucose-PEG4-azide to obtain the second generation (GD2) with 24 glucose moieties, 24 glucose molecules containing 96 surface hydroxyl groups. The Cy5 fluorescent label was attached to GD2 by propargylation of about 2-3 hydroxyl groups to produce the alkyne-containing GD2 dendrimer. The GD intermediates and final products were purified using dialysis and used 1H nmR Representation.

[0277] The physicochemical properties of the GD2 dendrimers were also evaluated and are shown in Table 1 below.

[0278] For the stepwise synthesis of G1-glucose, the hexapropylated core 1 was treated with AB4 building blocks (β-glucose-PEG4-azide), 2, in a DMF:H2O (1:1) solution of a classical click reagent (CuAAC click reaction), a catalytic amount of copper sulfate pentahydrate (CuSO4.5H2O) and sodium ascorbate to produce G1-glucose-24-OAc, 3. Compound 3 was then treated (removal of the acetate group) under typical Zemplén conditions to obtain the desired product 4 (G1-glucose). The G1-glucose dendrimer has six surface glucose units (i.e., 24 surface hydroxyl groups), as shown in Figure 2. Figure 1 shown.

[0279] In some embodiments, the first generation dendrimer D1-acetylene 24 is further reacted with AB4β-D-glucose-PEG4-azide to obtain a second generation dendrimer with 24 glucose molecules containing 96 surface hydroxyl groups.

[0280] For the stepwise synthesis of G2-glucose; G1-glucose dendrimer 4 was treated with sodium hydride (60% dispersion in mineral oil) at 0°C for 15 min and then with propargyl bromide (80% w / w solution in toluene). The reaction was stirred at room temperature for 8 h to form compound 5. Compound 5 was then treated with AB4 building blocks (β-glucose-PEG4-azide), 2 in a classical click reagent (CuAAC click reaction), a catalytic amount of copper sulfate pentahydrate (CuSO4.5H2O) and sodium ascorbate in DMF:H2O (1:1) to produce G2-glucose-96-OAc, 6. Compound 6 was then reacted under typical Zemplén conditions to give the desired product 7 (G2-glucose).

[0281] Table 1 Physicochemical properties of GD2

[0282] size 4.4nm Zeta Potential -6.0 Glucose quantity 24 HPLC purity >99％ Molecular weight 12800Da

[0283] Example 2: Synthesis of CRISPR-cas 9-ribonucleoprotein based on second generation glucose dendrimers

[0284] GD2-Cas9 conjugation was performed using a strain-promoted click chemistry strategy under mild catalyst-free conditions using trans-cyclooctene-tetrazine (TCO-Tz) chemistry. Cas9-2NLS was functionalized with a terminal tetrazine (Tz), while GD2 was functionalized with trans-cyclooctene (TCO).

[0285] The G2 dendrimer D2-Glu24-OH96 is propargylated at one or more terminal hydroxyl groups and is suitable for further conjugation to one or more molecules such as the Cas9 nuclease. The G2-glucose dendrimer is treated with sodium hydride (60% dispersion in mineral oil) at 0°C and propargyl bromide is added at room temperature at 0°C for 8 hours to form compound 8. The resulting product 8 is reacted with azido-PEG2-amine (9) to form product 10. Product 10 is labeled with a Cy5 fluorophore and the resulting intermediate 11 is conjugated with PEGylated trans-cyclooctene (TCO) to give functionalized Cy5-D-PEG4-TCO (13).

[0286] MALDI-TOF confirmed that GD2-Cas9(2NLS)17 was successfully synthesized and the molecular weight of Cy5-GD2-Cas9 was 183413 Da, which was consistent with the theoretical molecular weight of D-Cas9 of 172800 Da.

[0287] Materials and methods

[0288] Biomolecules, Chemicals and Reagents

[0289] Reactions were performed in flame-dried glassware using dry solvents under a positive pressure of Ar or N2 gas. Commercial grade reagents and anhydrous solvents were purchased from chemical suppliers and used without further purification.

[0290] 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC.HCl), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), trifluoroacetic acid (TFA), γγFA)-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), and N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cyanocyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience-GE health care. Cyanocyanine 3 (Cy3) trans-cyclooctene (TCO) was purchased from AAT bioquest. Deuterated solvents dimethyl sulfoxide (DMSO-d6), water (D2O), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories, Inc. (Andover, MA, USA). Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Domingos, CA, USA). Cas9 nuclease 2NLS, Streptococcus pyogenes, and all primers were purchased from Synthego Corporation (Redwood City, CA).

[0291] instrument

[0292] Proton NMR spectra were recorded on a Bruker 500 MHz spectrometer at ambient temperature. 1 HNMR) spectra and analyzed using software. Residual solvents were used as internal standards (DMSO-d6, 2.50) and (D2O, 4.79ppm). 1 H NMR chemical shifts are reported as δ.

[0293] Analytical high performance liquid chromatography (HPLC) was performed using a Shimadzu LC-AD HPLC system equipped with a variable wavelength absorbance detector and a C18 reverse phase column (Waters, BEH300 5 μm, 19H300 5 μm). The eluent was monitored at 210 nm using a photodiode array (PDA) detector, and the fluorescent-labeled conjugate was monitored at 650 and 210 nm using fluorescence and PDI detectors, respectively. HPLC elution was performed using a 40 min linear gradient of 0%-90% HPLC grade acetonitrile (CH3CN) in water (containing 0.1% TFA), maintaining a flow rate of 1.0 ml / min.

[0294] Ultrafiltration and SEC chromatography

[0295] After each synthesis step and buffer exchange, ultracentrifugal filtration was performed using a 0.5 mL Amicon filter device (30 kDa or 100 kDa molecular weight cutoff) to remove excess reagents and byproducts. Products and intermediates were further purified by size exclusion column (SEC) chromatography using PBS as the mobile phase.

[0296] Sample preparation and MALDI-TOF analysis

[0297] Cas9 protein: Cas9 protein was desalted prior to MALDI analysis. MALDI matrix 3,5-dimethoxy-4-hydroxycinnamic acid (sinapic acid) was freshly prepared (10 mg / mL acetonitrile: water (1:1) and 0.1% trifluoroacetic acid). Cas9 protein (2 μl) was deposited on the MALDI sample plate, and then the matrix (2 μl) was deposited on the air-dried sample and allowed to air dry for 10-20 minutes. MALDI-TOF-MS analysis was performed on a Voyager DE-STR MALDI-TOF operating in linear positive ion mode.

[0298] Dynamic Light Scattering (DLS)

[0299] The particle size of dendrimers and Cas9 conjugates was determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern Instrument Ltd. Worchester, UK) equipped with a 50 mW He-Ne laser (633 nm). The conjugate was dissolved in deionized water (18.2 Ω) to make a solution with a final concentration of 0.2 mg / mL. The solution was filtered through a cellulose acetate membrane (0.45 m, PALL Life Science) and three DLS measurements were performed at 25° with a scattering angle of 173°.

[0300] G2 glucose dendrimers were prepared as in Example 1. Figures 3A-3C The stepwise synthesis of G2-glucose-PEG4-TCO (3A) and its application in Figure 4 Schematic representation of the chemical structures of the synthetic intermediates TCO-PEG4-NHS ester (3B) and Cy5 (3C) shown. The subscript numbers in the formulas indicate the number of attachments per dendrimer.

[0301] Figure 3 is a schematic diagram showing the reaction of Me-Tz attached Cas9 nuclease 2NLS (Streptococcus pyogenes) and TCO attached glucose dendrimer under physiological conditions to form Cy5-D-Cas9 (2NLS) conjugates. Figure 3 is a schematic diagram showing the click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry in the preparation of Cy5-D-Cas9 (2NLS) conjugates.

[0302] To enable delivery to damaged neurons and reactive glial cells, constructs of glucose dendrimer-Cas9 conjugates complexed with appropriate guide RNAs were prepared. Conjugates of dendrimers made of glucose and ethylene glycol building blocks containing multiple glucose moieties on the surface can be used for targeted neuronal delivery of CRISPR-Cas9 ribonucleoprotein.

[0303] Figure 3 is a schematic diagram showing the stepwise synthesis of G2-glucose-PEG4-TCO and synthetic intermediates. G2-glucose dendrimers were treated with sodium hydride (60% dispersion in mineral oil) at 0°C and propargyl bromide was added at room temperature at 0°C for 8 hours to form compound 8. The resulting product 8 was reacted with azido-PEG2-amine (9) to form product 10. Product 10 was labeled with a Cy5 fluorophore, and the resulting intermediate 11 was conjugated with PEGylated trans-cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO 13.

[0304] Figure 4Schematic diagram showing the stepwise synthesis of Cy5-G2-glucose-Cas9(2NLS). The synthetic scheme showing the Me-Tz-linked Cas9 nuclease 2NLS (Streptococcus pyogenes) 16 and TCO-linked G2-glucose dendrimer 13 react under a highly specific reverse Diels-Alder click reaction (IEDDA) to form Cy5-G2-glucose-Cas9(2NLS) conjugate 17.

[0305] result

[0306] GD2-Cas9 conjugation was successfully performed under mild catalyst-free conditions using a strain-promoted click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry. Cas9-2NLS was functionalized with terminal tetrazine (Tz), while GD2 was functionalized with trans-cyclooctene (TCO) as previously described PAMAM-type hydroxy dendrimers. In addition, the successful synthesis of GD2-Cas9 (2NLS) and the molecular weight of the conjugate were determined by MALDI-TOF to be 183.413 Da. The peak of Cy5-GD2-Cas9 is located at 183413 Da, which is very consistent with the theoretical molecular weight of D-Cas9 of 172800 Da ( Figure 5 ).

[0307] Glucose dendrimers (GD2) are formed from 24 glucose molecules (96 surface hydroxyl groups) for Cas9 conjugation. Glucose dendrimers are mainly made of a glucose moiety that contains a central core of dipentaerythritol and one or more branching units of monosaccharide glucose molecules. Unlike hydroxy PAMAM dendrimers, glucose dendrimers are primarily taken up by damaged neurons and have been found to specifically target overexcited neurons in culture and in vivo mouse models.

[0308] Figure 5 yes Figure 4 MALDI-TOF of Cy5-GD2-Cas9 confirmed the synthesis of the conjugate.

[0309] Example 3: Synthesis of Hydroxyl PAMAM Dendrimers Based on CRISPR-Cas9 Ribonucleoprotein

[0310] Materials and methods

[0311] Biomolecules, Chemicals and Reagents

[0312] Reactions were performed in flame-dried glassware using dry solvents under a positive pressure of Ar or N2 gas. Commercial grade reagents and anhydrous solvents were purchased from chemical suppliers and used without further purification. Ethylenediamine core polyamidoamine (PAMAM) dendrimers, generation 6.0, hydroxyl surface (G6-OH; diagnostic grade; consisting of 256 hydroxyl end groups), methanol solution (13.75% w / w) was purchased from Dendritech Inc. (Midland, MI, USA). The D6-OH in methanol was dried under reduced pressure, then dissolved in water and lyophilized for further conjugation. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC.HCl), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), trifluoroacetic acid (TFA), γγFA)-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), and N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cyanocyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience-GE health care. Cyanocyanine 3 (Cy3) trans-cyclooctene (TCO) was purchased from AAT bioquest, Inc. Deuterated solvents dimethyl sulfoxide (DMSO-d6), water (D2O), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories, Inc. (Andover, MA, USA). Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Domingos, CA, USA). Cas9 nuclease 2NLS, Streptococcus pyogenes, and all primers were purchased from synth ego Corporation (Redwood City, CA).

[0313] instrument

[0314] Proton NMR spectra were recorded on a Bruker 500 MHz spectrometer at ambient temperature. 1 HNMR) spectra and analyzed using software. Residual solvents were used as internal standards (DMSO-d6, 2.50) and (D2O, 4.79ppm). 1 H NMR chemical shifts are reported as δ.

[0315] Analytical high performance liquid chromatography (HPLC) was performed using a Shimadzu LC-AD HPLC system equipped with a variable wavelength absorbance detector and a C18 reverse phase column (Waters, BEH300 5 μm, 19H300 5 μm). The eluent was monitored at 210 nm using a photodiode array (PDA) detector, and the fluorescent-labeled conjugate was monitored at 650 and 210 nm using fluorescence and PDI detectors, respectively. HPLC elution was performed using a 40 min linear gradient of 0%-90% HPLC grade acetonitrile (CH3CN) in water (containing 0.1% TFA), maintaining a flow rate of 1.0 ml / min.

[0316] Synthesis Figure 6 and 7 The compounds shown

[0317] Synthetic D-GABABoc, 3

[0318] A solution of PAMAM G6-OH1 (1.00 g, 0.017 mmol) in DMF (12 ml) was treated with Boc-GABA-OH (0.069 g, 0.34 mmol), DMAP (0.0782 g, 0.408 mmol) and stirred at room temperature for 5 minutes. Then EDC. HCl (0.046 g, 0.374 mmol) was added to the reaction mixture in batches over 5 minutes. The reaction mixture was stirred at room temperature for 36 hours. The crude product was transferred to a 3 kD MW cut-off cellulose dialysis tubing and dialyzed with DMF for 12 hours and then with water for 24 hours. The aqueous layer was frozen and lyophilized to give the desired product 3 as a hygroscopic white solid (0.973 g, 95%). 1 H NMR (500 MHz, DMSO-d6) 8.10-7.70 (m, internal amide H), 6.60 (s, GABA amide H, 10H), 4.74 (s, surface OH, 213H), 3.99 (s, ester-linked H, 22H) 3.39 (t, J = 5.0 Hz, dendrimer-CH2), 3.40-3.35 (m, dendrimer CH2), 3.11 (m, dendrimer-CH2), 2.89 (m, dendrimer CH2), 2.73-2.65 (m, d dendrimer CH2), 2.45 (m, dendrimer CH2), 2.21 (m, dendrimer CH2), 1.64-1.59 (m, GABA linker-CH2, 25H), 1.36 (s, Boc group, 85H). HPLC C18 retention time: 19 minutes.

[0319] Synthesis of D-GABA-NH2,4

[0320] The Boc-protected GABA linker containing PAMAM G6-OH 3 (250 mg, 0.004 mmol) was treated with a TFA / DCM (3:4) solvent mixture. The reaction was stirred at room temperature for 12 hours, then diluted with MeOH and concentrated in vacuo (this step is necessary to remove excess TFA and hydrolytic cleavage of the GABA linker). The crude product was used in the next step without any further purification. 1 H NMR (500 MHz, DMSO-d6) SO-dHz was used for further purification, internal amide H), 5.50-4.50 (broad s, surface-OH), 4.00 (s, ester linkage H), 3.50-2.25 (m, dendrimer-CH2), 1.93-1.59 (m, GABA linker-CH2).

[0321] Synthesis of Cy5-D, 5

[0322] A solution of compound 4 (287 mg, 0.0048 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (~7.0-7.5). The reaction was then treated with Cy5-NHS ester (8.7 mg, 0.0115 mmol, 1.2 eq) and stirred at room temperature for 12 hours. It was then dialyzed against DMF for 12 hours and then against water for 24 hours. The aqueous layer was frozen and lyophilized to give the desired product 5 as a blue solid (yield 85%). 1 H NMR (500 MHz, DMSO-d6) δ 5.8 (s, lactam H), 7.30 (s, Cy5 H), 7.10 (s Cy5 H), 6.70 (s, GABA amide H), 6.50 (m Cy5H), 6.25 (m Cy5H, 4.75 (s, surface OH, 226H), 4.00 (m, ester CH2), 3.50-2.00 (m, dendrimer CH2), 1.64-1.59 (s, 31H), 1.25 (s, 66H), 0.8 (s, 21H). HPLC C18 retention time (MeCN in H2O containing 0.1% TFA, linear gradient, 40 min). HPLC C18 retention time: 17.5 min.

[0323] Synthesis of Cy5-D-PEG4-TCO,6

[0324] A solution of compound 5 (48 mg, 0.0008 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (~7.0-7.5). The reaction was treated with TCO-PEG4-NHS ester (4 mg, 0.0080 mmol) and the reaction mixture was stirred at room temperature for 12 hours. It was then dialyzed against DMF for 12 hours and then against water for 24 hours. The aqueous layer was frozen and lyophilized to give the desired product as a blue solid (yield 55%).

[0325] 1 H NMR (500 MHz, DMSO-d6), 7.35 (m, Cy5 H), 7.25 (m, Cy5 H), 7.05 (m, Cy5 H), 6.6 (m, Cy5 H), 6.3 (m, Cy5 H), 6.83 (s, GABA amide H), 5.65-5.50 (m, TCOH), 5.45-5.35 (m, TCOH), (4.74 (s, surface OH, H), 4.01-3.39 (t, J=5.0 Hz, ester-CH2), 3.50-2.00 (m, dendrimer CH2), 1.9 (s, 24H), 1.6 (s, 80H), 1.2 (s, 126H), 0.8 (s, 80H). HPLC C18 retention time: 19.5 minutes.

[0326] Ultrafiltration and SEC chromatography

[0327] After each synthesis step and buffer exchange, ultracentrifugal filtration was performed using a 0.5 mL Amicon filter device (30 kDa or 100 kDa molecular weight cutoff) to remove excess reagents and byproducts. Products and intermediates were further purified by size exclusion column (SEC) chromatography using PBS as the mobile phase.

[0328] Sample preparation and MALDI-TOF analysis

[0329] PAMAM dendrimer conjugates: All MALDI samples were desalted prior to MALDI analysis. The MALDI matrix 2-4'6'-trihydroxyacetophenone monohydrate (THAP) (10 mg) was dissolved in 1 mL of acetonitrile in water (1:1, containing 0.1% trifluoroacetic acid). 2 μl of PAMAM dendrimers were then deposited on the MALDI sample plate. The matrix (2 μl of 10 mg / mL) was deposited on the air-dried samples and allowed to air dry for 10-20 minutes. MALDI-TOF-MS analysis was performed on a Bruker Voyager DE-STR MALDI-TOF (Mass Spectrometry and Proteomics Core, Johns Hopkins University School of Medicine) operating in linear positive ion mode.

[0330] Cas9 protein: Cas9 protein was desalted prior to MALDI analysis. MALDI matrix 3,5-dimethoxy-4-hydroxycinnamic acid (sinapic acid) (10 mg / mL acetonitrile: water (1:1) and 0.1% trifluoroacetic acid) was freshly prepared. Cas9 protein (2 μl) was deposited on the MALDI sample plate, and then the matrix (2 μl) was deposited on the air-dried sample and allowed to air dry for 10-20 minutes. MALDI-TOF-MS analysis was performed on a Voyager DE-STR MALDI-TOF operating in linear positive ion mode.

[0331] Dynamic Light Scattering (DLS)

[0332] The particle size of dendrimer and Cas9 conjugates was determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern instrument Ltd. Worchester, UK) equipped with a 50 mW He-Ne laser (633 nm). The conjugate was dissolved in deionized water (18.2 μm) to make a solution with a final concentration of 0.2 mg / mL. The solution was filtered through a cellulose acetate membrane (0.45 μm, PALL Life Science) and three DLS measurements were performed at 25° with a scattering angle of 173°.

[0333] result

[0334] Synthesis and Characterization of Cy5-D-PEG4-TCO

[0335] Cy5-D-PEG4-TCO conjugate (Example 3) was synthesized using PAMAM-G6-OH (D6-OH, 256 free hydroxyl groups). 4-(tert-Butyloxycarbonylamino)butyric acid (Boc-GABA-OH) was treated with N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC.HCl) and 4-(dimethylamino)pyridine (4-DMAP) in DMF and reacted at room temperature for 36 hours. The lyophilized monofunctionalized D6-OH was functionalized with a Boc-protected amine to give a Boc-protected difunctionalized dendrimer product. The crude dendrimer was dialyzed in ultrapure water with a 3.5 kDa membrane for 24 hours and then lyophilized. Dendrimer 3 1HNMR depicts the tert-butyl protons of the Boc group as a singlet at δ 1.3 ppm, and the GABA methylene protons as a singlet at 1.6 ppm. The peak at δ 3.9 ppm is the methylene protons of the dendrimer adjacent to the hydroxyl group, and once converted from the GABA linker to ester and amide protons, a singlet also appears at δ 6.8 ppm. The Boc group was then deprotected under mildly acidic conditions using trifluoroacetic acid (TFA) in dichloromethane (DCM) at a ratio of 1:4 to obtain the difunctionalized dendrimer. Excess TFA was removed by coevaporation with methanol, and the crude product obtained was used in the next step without further purification. 1 HNMR confirmed the complete disappearance of the Boc protons, while no ester hydrolysis was observed under these conditions. The total number of amine groups remained at about 10. The bifunctionalized dendrimer was then treated with the fluorescent dye Cy5 to obtain dendrimer 4, with about 1-2 Cy5 successfully attached to the surface of the dendrimer. 1 H NMR (DMSO-d6, 500 MHz) characterization showed that the Cy5 signal appeared in the aromatic region, and the HPLC retention time was shortened from 19.0 min to 17.5 min, confirming the formation of the product. After Cy5 attachment, the remaining amine group reacted with a heterobifunctional (NHS-PEG4-TCO) linker containing trans-cyclooctene. This heterobifunctional linker was used to form a chemical bond between the dendrimer and Cas9. 1 The degree of conjugation at each step of the synthesis was calculated from the molecular weight changes measured by H-NMR and MALDI-TOF.

[0336] Under mild catalyst-free conditions, a strain-promoted click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry was used for dendrimer Cas9 conjugation (Kim, E. & Koo, H. Chem Sci 10, 7835-7851, (2019)). Cas9-2NLS was functionalized with terminal tetrazine (Tz), while D6-OH was functionalized with trans-cyclooctene (TCO) for click reaction. First, Cas9 nuclease 2NLS (Streptococcus pyogenes) (1000 pmol of 20 μM in 50 μL) was treated with heterobifunctional PEGylated methyl-SS tetrazine (Me-Tz-PEG4-SS-NHS) (10 molar equivalents in 10-20 μl anhydrous DMSO) and incubated for 1 hour. Excess Me-Tz-PEG4-SS-NHS and byproducts were removed by ultrafiltration. Using MALDI-TOF spectroscopy, the number of Tz groups attached to each Cas9 was determined based on the molecular weight change corresponding to the total molecular weight. PEGylated trans-cyclooctene (PEG4-TCO)-linked dendrimer 6 (61 μg in 200 μL PBS) was reacted with 8 via TCO-Tz click reaction to give crude product 9. The resulting crude product was purified by ultrafiltration. The "click chemistry reaction" used between 1,2,4,5-tetrazine (Tz) and trans-cyclooctene (TCO) was carried out via the inverse electron demand Diels-Alder reaction (IEDDA), followed by the formation of dihydropyridazine bonds under mild physiological conditions. The chemically selective TCO-Tz connection has ultrafast kinetics (>800M-1s-1), which is unmatched by any other bioorthogonal connection pair. The click connection is performed under aqueous conditions at near neutral pH and room temperature. Ultrafast kinetics, selectivity, and long-term water stability make TCO-Tz an ideal pair for low-concentration dendrimer-Cas9 coupling reactions. The chemically synthesized D-Cas9 (2NLS) was further purified by GE Healthcare Sephadex G-25 column and concentrated by ultrafiltration.

[0337] In addition, the successful synthesis of D-Cas9 (2NLS) was confirmed by gel electrophoresis. The molecular weight was determined by MALDI-TOF. The molecular weight peak of PAMAM G6 dendrimer is 57859Da, the molecular weight peak of Cas9 is 162884Da (molecular ion peak), 81193Da (M2+) and 54238Da (M3+), and the molecular weight peak of D-Cas9 is 213099Da (molecular ion peak). The peak position of D-Cas9 is 213099Da, which is very consistent with the theoretical molecular weight of D-Cas9 of 225000. The size change before and after modification was determined by DLS measurement. The hydrodynamic diameter of PAMAM-G6-OH is 4.6±1.2nm, Cas9 is 9.5±1.1nm, and D-Cas9 is 13.2±1.6nm. Cas9 protein and Cas9 concentration in D-Cas9 constructs were determined from absorbance at 280 nm using a nano drop 2000 (Thermofisher Scientific). All other intermediates were prepared using 1 The proteins were characterized by HNMR, MALDI-TOF and HPLC.

[0338] Example 4: In vitro testing of gene editing conjugates

[0339] Materials and methods

[0340] Cell lines

[0341] Human embryonic kidney 293T (HEK293T) cell line expressing GFPd2 was generously provided by Green Lab (Institute of Nanobiotechnology and Translational Tissue Engineering Center, Johns Hopkins University). Cells were cultured in Dulbecco's modified Eagle medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v / v) heat-inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA), 1% penicillin / streptomycin (P / S, Invitrogen Corp., Carlsbad CA). Opti-MEM (Thermo Scientific, Rockford, IL) was used instead of cell culture medium for transfection studies. Cells were maintained in a humidified environment at 37°C and 5% CO2.

[0342] ARPE-19 cells (an immortalized human retinal pigment epithelial cell line) were also used in this study. Cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v / v) heat-inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA), 1% penicillin / streptomycin (P / S, Invitrogen Corp., Carlsbad CA). Cells were maintained in a humidified atmosphere at 37°C and 5% CO2.

[0343] method

[0344] Study of time-dependent Cy5-D-Cas9 uptake

[0345] HEK-293T cells expressing GFP were seeded in glass bottom culture dishes and grown for 24-48 hours to 70-80% confluence. Cells were treated with Cy5 fluorescently labeled dendrimers (Cy5-D) and Cas9 conjugated Cy5-labeled dendrimers (Cy5-D-Cas9, 9) or Cy5-D-EGFP in DMEM supplemented with 1% P / S (serum-free medium). The cells were then washed with PBS (then with ) and fixed in 5% formalin solution. The cells were incubated and confocal microscopy images were taken with a Zeiss Axiovert 200 system equipped with an LSM 510-Meta confocal module. During the imaging process, the image acquisition parameters remained unchanged. Images were processed by Zen 2011 software (Zeiss). Z stack images were analyzed using Zen software and 3D surface rendering was performed using Imaris version software (Bitplane USA, Concord, MA, USA).

[0346] Image analysis

[0347] Live cell images were captured at set time points using a Zeiss Axiovert 200 phase contrast microscope (Carl Zeiss). Images were automatically thresholded using the built-in triangle method in ImageJ.

[0348] D-Cas9 / sgRNA, Cas9 / sgRNA RNP preparation

[0349] Different amounts of D-Cas9-2NLS / Cas9-2NLS conjugates were mixed with sgRNA in PBS buffer and mixed at room temperature, and then incubated at 4 °C for 24 h to form RNP complexes, as shown in Table 2.

[0350] Table 2: Conditions for preparation of D-cas 9 / sgRNA and Cas9 / sgRNA RNP complexes.

[0351]

[0352] Lipofection. Lipofection with Cas9 was performed according to the manufacturer's protocol. 10 μg Cas9, 5 μg sgRNA and 3 μl Lipofectamine 2000 were used in a total volume of 100 μl. Lipofection was performed in serum-free Opti-MEM medium, and an equal volume of growth medium was added to the cells 1 hour after lipofection to minimize cytotoxicity.

[0353] HEK293T cell transfection

[0354] Cells were plated at (0.84-2.5) × 10 5 Cells were seeded at a density of 100 cells / mL in 12-well tissue culture plates and allowed to grow for 12-24 hours. Prior to treatment, the cell culture medium was replaced with Opti-MEM reduced serum medium.

[0355] Study on the efficacy of D-Cas9 / sgRNA genome editing

[0356] HEK293T GFP reporter cells were cultured in DMEM containing 10% PBS and 1% penicillin / streptomycin at 37 °C and 5% CO 2 . For flow cytometry experiments, cells were cultured at 5 cells per well. 5 Cells were seeded into 12-well plates at a cell density of 10 cells and incubated overnight. The culture medium was supplemented with 500 μl of fresh culture medium and 100 μl of RNPs were added. D-Cas9-2NLS and sgRNA were mixed at a molar ratio of 1:10 24 hours before treatment to prepare D-Cas9 RNPs. The sequence of sgRNA is as follows.

[0357] 5RNPs targeting GFP were supplemented in each well to minimize cytotoxicity. Image courtesy of ntific)51,

[0358] sgRNA targeting VEGFA

[0359] sgRNA-15′C*G*G*GGAGGAGGUGGUAGCUG 3′(SEQ ID NO:2)sgRNA-25′G*C*C*GCCGGCCGGGGAGGAGG3′(SEQ ID NO:3)

[0360] As a control study, cells were treated with Lipofectamine 2000 (3 μL / well in a 12-well plate) complexed with Cas9-2NLS. Untreated HEK 293 cells expressing GFP were used as a control group. Three days after treatment, cells were harvested with 0.25% trypsin-EDTA, centrifuged and resuspended in buffer, and fixed with 4% PFA (10 minutes at room temperature). After fixing the cells, the cells were centrifuged and resuspended in 200 L of PBS containing 2% FBS. For VEGF sgRNA studies, cells were incubated with VEGF (Alexa 488) monoclonal antibody at 4 g overnight. The genome editing effects of the cell populations were analyzed, and GFP and VEGFA markers were quantified by Sony SH800 cell sorter. Data were analyzed using FlowJo v10.

[0361] Cytotoxicity of D-Cas9 / sgRNA RNP and RCas9 / sgRNA RNP in HEK293 cells

[0362] Cytotoxicity and cell viability were determined by treating HEK293T GFP-expressing cells in 96-well plates with RNP constructs of different formulations. Cells were seeded in 96-well plates (15,000 cells / well) and incubated for 24 hours to 40-50% confluence. Cells were treated with different concentrations of RNP. After 24 hours of incubation, cell viability / cytotoxicity was determined using the WST-8 assay (Dojindo Molecular Technologies) according to the manufacturer's protocol. Cells were supplemented with 100 μL of fresh medium and treated with 10 μL of WST-8 reagent. The cells were then incubated at 37 for 3 h and the absorbance was measured at 450 nm. During the incubation period, WST-8 tetrazolium salts were reduced by dehydrogenases in living cells to form yellow formazan dyes, which show absorbance at 450 nm. The concentration of formazan dyes is proportional to the density of living cells. Relative cell viability is defined as the percentage of survival compared to the untreated control.

[0363] PCR amplification of genomic DNA

[0364] GFP-expressing HEK293 cell DNA from control (without D-Cas9 / sgRNA RNP) or D-Cas9 / gRNA RNP-treated cells was amplified with primers designed to amplify only the gene editing sequence. PCR was performed using forward primers (forward primer-CTGGTCGAGCTGGACGGCGACG (SEQ ID NO: 5)), reverse primers (reverse primer-CACGAACTCCAGCAGGACCATG (SEQ ID NO: 6)) according to the manufacturer's protocol.

[0365] PCR products were analyzed on 1% (wt / vol) TBE agarose gels using SYBR safe (Thermo Fisher). ImageJ (available on the global Internet at: http: / / imagej.nih.gov / ij / ; National Institutes of Health, Bethesda, MD, USA) was used to calculate the percentage of indel formation using the following equation:

[0366] Indel2 = LSS-[L-[L-fCut] L / 2

[0367] where f cut (Cleaving fraction) is the total relative density of cleaved bands divided by the sum of the relative densities of cleaved and uncleaved bands as described previously (Guschin, DY et al., Methods Mol Biol 649, 247-256, (2010)).

[0368] result

[0369] Chemically synthesized Cy5-D-Cas9 (2NLS) and in vitro transcribed gRNA against GFP (DNA target sequence 5′GGAGCGCACCATCTTCTTCA 3′; (SEQ ID NO: 4), gRNA against VEGFA (target sequence 5′C*G*G*GGAGGAGGUGGUAGCUG 3′; (SEQ ID NO: 2) and 5′G*C*C*GCCGGCCGGGGAGGAGG3′; (SEQ ID NO: 3)) were co-incubated with Cy5-D-Cas9 (2NLS) or Cas9 (2NLS) in appropriate buffer to prepare RNP complexes (Table 2). Nuclease-free water was used to resuspend or dilute RNA to prevent degradation. Pre-assembly of protein and RNA components is very important to avoid off-target effects and premature degradation.

[0370] The efficient delivery and subcellular localization of the D-Cas9 / sgRNA RNP payload were investigated by confocal microscopy. Human embryonic kidney (HEK)-293T cells were transfected with a specially synthesized Cy5-D-Cas9-EGFP (without nuclear localization sequence) to assess the fate of the RNP in the cell cytoplasm. After 24 hours of incubation, most of the dendrimer Cy5 signal (red fluorescence) overlapped with the Cas9-EGFP signal (green fluorescence). At 24 hours, lysosomes (magenta fluorescence) were observed to overlap as well. However, after 48 hours of incubation, it was clear that endosomes / lysosomes did not overlap with either red or green fluorescence, indicating that the RNP was escaping from the endosomes / lysosomes.

[0371] The subcellular localization of Cas9 in Cy5-D-Cas9(2NLS)-treated cells was also assessed. Live GFP-expressing HEK 293 cells were imaged at different time points (24 and 36 hours) using confocal microscopy. Cy5-D-Cas9(2NLS) was successfully internalized into the cytoplasm, and a large portion of Cy5-D-Cas9(2NLS) translocated to the nucleus for genome editing. After 36 hours of incubation, most of the dendrimer Cy5 signal (red fluorescence) overlapped with the nucleus (blue fluorescence). It is clear that the nuclear localization signals (NLSs) fused to the recombinant Cas9 protein promote the nuclear entry of Cy5-D-Cas9(2NLS). In the cytoplasm, Cy5-D-Cas9(2NLS) undergoes glutathione-mediated disulfide bond reduction, releasing the Cas9(2NLS) payload into the cytoplasm and then translocating into the nucleus. When the dendrimer Cas9 conjugates were efficiently delivered to the cytoplasm or Cy5-D-Cas9(2NLS), the conjugates directly entered the nucleus through the nuclear pore complex.

[0372] The delivery and genome editing of D-Cas9 RNPs were also evaluated. Here, the optimal stoichiometric ratio for efficient cell transfection was used, and different ratios of Cy5-D-Cas9 (2NLS) conjugates and different ratios of gene-targeting guide RNA (sgRNA) were added to PBS and incubated at 4°C for 24 hours to form RNPs (Table 1). Compared with the standard acidic buffer, the RNP preparations formed using PBS as a buffer had better protein stability. The chemical conjugation of the dendrimer to the Cas9 protein did not disrupt the intrinsic charge of the Cas9 protein or the interaction between Cas9 and sgRNA.

[0373] Fig. 9 Schematic diagram showing the nuclear entry pathway of Cy5-D-Cas9(2NLS). When the dendrimer Cas9 conjugate is effectively delivered to the cytoplasm, Cy5-D-Cas9-2NLS is reduced by intracellular glutathione, releasing the Cas9(2NLS) payload, and finally Cas9(2NLS) is localized in the nucleus, or the Cy5-D-Cas9(2NLS) conjugate is delivered to the nucleus through the nuclear pore complex.

[0374] D-Cas9 / Lipo Cas9 (RNPs) performs genome editing of the GFP gene.

[0375] The in vitro efficacy of the D-Cas9 / sgRNA RNP system for genome editing was evaluated in HEK293T cells. The different D-Cas9 / Lipo-Cas9 RNP formulations used for this study are listed in Table 3.

[0376] Table 3: Different D-Cas9 / sgRNA and Cas9 / sgRNA RNP formulations used in the studies.

[0377] entry Cas9 nuclease 2NLS (μg) sgRNA (μg) 1 10 5 2 5 2.5 3 2 1.0 4 one 0.5 5 0.1 0.05

[0378] Three days after transfection, the loss of GFP fluorescence was measured by flow cytometry to determine editing efficiency. Successful gene editing resulted in a loss of green fluorescence, which could be detected by flow cytometry. The dendrimer-based delivery platform was compared with a commercially available liposome-based delivery vehicle, Lipofectamine 2000 (Lipo).

[0379] The results are as follows Figures 10A-10D The best RNP formulation was entry 1. Fig. 10A and 10B are bar graphs showing the percentage of GFP-positive cells in cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to HEK293T cells (GFP-negative) and HEK 293 cells expressing GFP (GFP-positive) based on FACS. Fig. 10B It is an enlarged bar graph of cells treated with samples D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs. Fig. 10C It is a bar graph showing the percentage of gene-edited cells (GFP-negative cells) in cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to HEK293 cells expressing GFP (GFP-positive). The data area is expressed as mean ± standard deviation (n = 3). Fig. 10D It is a bar graph showing the percentage of gene-edited cells (GFP-negative cells) in HEK293T cells treated with different formulations of Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs shown in Table 2. The percentage of cell viability was also measured by CCK-8 assay in control cells or cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs.

[0380] Example 6: Genome editing of the vascular endothelial growth factor A (VEGF-A) gene by D-Cas9 / Lipo Cas9 (RNP).

[0381] Materials and methods

[0382] The dose response of D-Cas9(sgRNA)RNP was evaluated in terms of cell viability and cytotoxicity. GFP-expressing cells were treated with Cy5-D-Cas9(2NLS) / Cas9(2NLS) and various formulations of sgRNA targeting GFP for 3 days.

[0383] The loss of GFP fluorescence was detected by flow cytometry to quantify the editing efficiency. D-Cas9RNP was expressed at a Cas9 concentration of 10 μg / mL -1 Maximum efficiency.

[0384] The genome editing efficiency was tested using a T7 endonuclease I (T7EI)-based genomic detection method (GeneArt Genomic Cleavage Detection Kit, Thermos Fisher). Using the T7 endonuclease (T7E1) mismatch detection method, D-Cas9 / RNP for GFP showed an indel formation frequency of 26%. The predicted cleavage site of the GFP target sequence was Fig.11 Indicated by dotted line.

[0385] Four days after transfection, the amount of VEGF A protein was quantified by flow cytometry to detect editing efficiency. For this study, recombinant Alexa Fluor 488 anti-VEGFA antibody (abcam) was used according to the manufacturer's protocol.

[0386] Using flow cytometry, the percentage of VEGF-positive cells in ARPE-19 cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs (VEGFA guide RNA2) was compared with VEGF antibody-treated and untreated cells. Based on FACS, the percentage of gene-edited cells (VEGF-negative cells) in ARPE-19 cells treated with D-Cas9 / sgRNA RNPs with VEGF sgRNA-1 or VEGF sgRNA-2 was compared with VEGF antibody-treated (VEGF + ) and untreated (VEGF - ) were used for comparison with ARPE-19 cells.

[0387] result

[0388] Cy5-D-Cas9(2NLS) did not cause significant cytotoxicity in HEK 293 cells expressing GFP, whereas Lipo RNAs showed significantly higher cytotoxicity (approximately 20-25% cell death) consistent with literature results ( Figures 10A-10D ).

[0389] CRISPR-Cas9 RNP-mediated genome editing of the VEGF-A gene has also been studied in human RPE cell line ARPE-19. Two different gRNAs are used to target the VEGF-A gene. VEGF-A is a diffusible mitogen that is secreted by other cells in RPE and eyes in response to hypoxia and inflammatory conditions (Yiu, G., et al., Investigative Ophthalmology & Visual Science 57, 5490-5497, (2016)). This study is a proof-of-concept genome engineering study with high potential in ophthalmic applications.

[0390] Fig. 12A and 12B is a bar graph showing the expression of VEGF antibody-treated (VEGF + ) and untreated (VEGF - ) The percentage of gene-edited cells (VEGF-negative cells) in ARPE-19 cells treated with Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to ARPE-19 cells. The data area is expressed as mean ± SD (n = 3). Fig. 10B is a magnified bar graph showing the percentage of gene-edited cells (i.e., VEGF-negative cells) in ARPE-19 cells treated with Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs. Fig. 10C is a bar graph showing the percentage of gene-edited cells (i.e., VEGF-negative cells) in ARPE-19 cells treated with different doses of Cas9 / sgRNA and lipid-Cas9 / sgRNA RNPs.

[0391] Compared with the untreated control and the Lipofectamine Cas9 / sgRNA system, the sgRNA targeting GFP showed a significant GFP knockout effect. Compared with the untreated control, the Cy5-D-Cas9(2NLS) RNP (entry 1 in Table 2) induced nearly perfect (100%) editing, which was significantly higher than the lipid (~50%) RNP.

[0392] Successful gene editing results in a decrease in the Alexa 488-labeled cell population, which is easily detected by flow cytometry. Here, the dendrimer-based delivery platform was compared with the commercially available Lipofectamine 2000 (Lipofectamine). sgRNA targeting VEGFA showed significant gene editing capacity compared to untreated controls and the Lipofectamine Cas9 / sgRNA system. Cy5-D-Cas9(2NLS) RNPs (10μg / mL Cas9) induced (~20%) editing compared to untreated controls, which was significantly higher than lipid (~3%) RNPs ( Figures 10A-10B ). In addition, the dose response of D-cas 9(sgRNA) / Lopo-Cas9(sgRNA) RNP was evaluated in ARPE-19 cells. VEGF-expressing cells were treated with various formulations of Cy5-D-Cas9(2NLS) / Lipo Cas9(2NLS) together with sgRNA targeting VEGF for 3 days ( Fig. 10C ). The gene editing efficiency was detected by flow cytometry to quantify the editing efficiency. D-Cas9 RNP targeting VEGFA was 10 μg / mL -1 The Cas9 concentration with the highest efficiency is 1.

[0393] Surprisingly, sgRNA-1 (target sequence: 5′C*G*G*GGAGGAGGUGGUAGCUG3′ (SEQ ID NO: 2)) targeting VEGFA showed significant gene editing ability compared with sgRNA-2 (target sequence: 5′G*C*C*GCCGGCCGGGGAGGAGG3′ (SEQ ID NO: 3)) ( Figures 13A-13C Compared with untreated controls, Cy5-D-Cas9(2NLS) RNPs containing sgRNA-1(10μg / mLCas9) induced (approximately 20%) gene editing ( Figures 12A-12C ). However, under the current treatment regimen, sgRNA-2 containing D-Cas9 RNP or LipoCas9 RNP did not induce any obvious gene editing efficiency. Here, gene editing efficiency was measured by flow cytometry to quantify the editing efficiency.

[0394] Summarize

[0395] A hydroxy-PAMAM dendrimer-conjugated CRISPR / Cas9 delivery system was successfully synthesized using a highly specific reverse Diels-Alder click reaction (IEDDA). Hydroxyl-terminated PAMAM dendrimers are well-defined hyperbranched polymer nanoparticles that were found to preferentially target activated macrophages in inflammation / neuroinflammation models (Nance, E. et al., Journal of Neuroinflammation 14, 252, (2017); Turk, BR et al., Annals of Neurology 84, 452-462, (2018); Sharma, R. et al., J Control Release 323, 361-375, (2020); Mishra, MK et al. ACS Nano 8, 2134-2147, (2014); Sharma, A. et al., Science Advances 6, eaay8514, (2020)). It has been determined that the unique targeting properties of hydroxyPAMAM dendrimers are due to small size, surface functionality and excellent water solubility, while the lack of toxicity and renal clearance allow for further development of this system into a better drug delivery platform (Menjoge, et al., Drug Discov Today 15, 171-185, (2010)).

[0396] Cas9 (Streptococcus pyogenes) nuclease is covalently conjugated to a 6-generation PAMAM dendrimer (PAMAM-G6-OH) (Le Rhun, et al., RNA Biol 16, 380-389, (2019)) via a glutathione-sensitive linker. The sgRNA then complexes with D-Cas9 to form a D-Cas9(sgRNA)RNP complex. When the D-Cas9(sgRNA) complex is effectively delivered to the cytoplasm, it is reduced by intracellular glutathione, releasing the Cas9 / sgRNA payload and ultimately translocating to the nucleus. Here, nuclear translocation of CRISPR / Cas9 is achieved through a nuclear localization signal (NLS), which is a short amino acid sequence that transports the nucleus into the nucleus. A commercially available Cas9 with 2NLS modifications was specifically selected for this study.

[0397] This is the first study to show that dendrimer-Cas9 conjugates can deliver CRISPR Cas9 RNPs directly into the intracellular environment in vitro. Dendrimer-conjugated Cas9 RNPs showed dose-dependent knockdown in HEK 293 cells expressing green fluorescent protein in vitro. D-Cas9 RNPs targeting the GFP gene resulted in nearly quantitative (~100%) knockdown of GFP in HEK cells, as quantified by flow cytometry, in cells expressing a stable form of the GFP reporter gene. Control RNPs complexed with Lipofectamine 2000 produced only about 50% of the gene editing effect in vitro. In addition, in ARPE-19 cells and HEK 293 cell lines, the toxicity of D-Cas9 RNPs was significantly lower than that of lipofectamine transfection. D-Cas9(2NLS) RNPs targeting the VEGFA gene resulted in about 20% of the VEGFA gene-edited cell population. The efficiency of D-Cas9 RNPs for VEGFA and GFP genes was high at a Cas9 concentration of 10 μg / mL. -1 Reached the highest point.

Claims

1. A genome editing composition comprising: (a) Dendrimers, (b) Gene editing system, in, The dendrimer is optionally covalently conjugated to the gene editing system via a linker.

2. The genome editing composition of claim 1, wherein the gene editing system is a protein-guided gene editing system selected from a CRISPR system, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs).

3. The genome editing composition according to claim 1 or 2, wherein The gene editing system is the CRISPR / Cas system.

4. The genome editing composition of any one of claims 1-3, wherein the CRISPR system comprises a Cas nuclease and a single guide RNA (sgRNA).

5. The genome editing composition of claim 4, wherein the Cas nuclease is selected from the group consisting of Cas9, CasX, Cas7-11, CasFx, Cas12a and Cas13.

6. A genome editing composition according to claim 4 or 5, wherein the Cas nuclease comprises one or more nuclear localization signals.

7. The genome editing composition of any one of claims 4-6, wherein the Cas nuclease is a Cas9 nuclease.

8. The genome editing composition of any one of claims 4-7, wherein the dendrimer is covalently conjugated to the Cas9 nuclease, optionally to the sgRNA.

9. The genome editing composition of any one of claims 4-8, wherein the Cas9 nuclease is Streptococcus pyogenes Cas9 nuclease.

10. The genome editing composition of any one of claims 4-9, wherein the Cas nuclease is conjugated to the dendrimer at a ratio of 1:1 to 4:1 protein to dendrimer.

11. The genome editing composition according to any one of claims 1 to 10, wherein the dendrimer is covalently conjugated to the gene editing system via one or more of a disulfide bond, an ester bond, an ether bond or an amide bond and optionally a hydrocarbon chain or an oligoethylene glycol chain.

12. The genome editing composition of any one of claims 1-11, wherein the dendrimer is covalently conjugated to the gene editing system via a releasable bond.

13. The genome editing composition according to any one of claims 1 to 12, wherein the dendrimer is covalently conjugated to the gene editing system via a glutathione-sensitive disulfide bond.

14. The genome editing composition of claim 13, wherein the bond comprises a γ-aminobutyric acid linker.

15. The genome editing composition of any one of claims 1-14, wherein the dendrimer is a 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, or 9th generation dendrimer.

16. The genome editing composition of any one of claims 1-15, wherein the dendrimer is a poly(amidoamine) (PAMAM) dendrimer.

17. The genome editing composition of any one of claims 1-16, wherein the dendrimer comprises hydroxyl, amine, carboxylic acid and / or acetamide groups.

18. The genome editing composition of any one of claims 1-17, wherein the dendrimer is a hydroxyl-terminated PAMAM dendrimer.

19. The genome editing composition of any one of claims 1-18, wherein the dendrimer is a 4-, 5-, or 6-generation hydroxyl-terminated PAMAM dendrimer.

20. The genome editing composition of any one of claims 1-15, wherein the dendrimer is a glucose dendrimer comprising a central core of dipentaerythritol and one or more branching units of monosaccharide glucose molecules, optionally with linkers conjugated thereto.

21. The genome editing composition of claim 20, wherein the glucose dendrimer is a generation 1 dendrimer having the following structure:

22. The genome editing composition of claim 20, wherein the glucose dendrimer is a 2nd generation dendrimer having the following structure:

23. The genome editing composition of any one of claims 1-22, wherein the dendrimer is further conjugated to one or more therapeutic, prophylactic or diagnostic agents selected from the group consisting of small molecules, antibodies or antigen-binding fragments thereof, nucleic acids and polypeptides.

24. The genome editing composition of claim 23, wherein the therapeutic agent is selected from the group consisting of an anti-inflammatory agent, an antioxidant, and an immunomodulator.

25. The genome editing composition of claim 23, wherein the diagnostic agent is selected from the group consisting of fluorescent dyes, near-infrared dyes, SPECT imaging agents, PET imaging agents, and radioactive isotopes.

26. A pharmaceutical preparation comprising the genome editing composition of any one of claims 1-25 and a pharmaceutically acceptable carrier or excipient.

27. The pharmaceutical formulation of claim 26, wherein the formulation is formulated for systemic or local administration.

28. The pharmaceutical formulation according to claim 26 or 27, wherein the formulation is formulated for parenteral or enteral administration.

29. The pharmaceutical formulation according to any one of claims 26-28, wherein the formulation is formulated for intramuscular injection, intraperitoneal injection, intravenous injection or subcutaneous injection.

30. The pharmaceutical formulation of claim 26 or 27, wherein the formulation is formulated for intranasal administration.

31. A method for altering, adding and / or deleting genomic fragments in a target cell of a subject in need thereof, the method comprising administering to the subject an effective amount of the pharmaceutical formulation of any one of claims 26-30.

32. The method of claim 31, wherein the pharmaceutical formulation is administered by parenteral or enteral administration.

33. The method of claim 31, wherein the pharmaceutical preparation is administered by intramuscular injection, intraperitoneal injection, intravenous injection or subcutaneous injection.

34. The method of any one of claims 31-33, wherein the pharmaceutical preparation comprises a genome editing composition comprising a Cas9 nuclease and a sgRNA specific for a genomic fragment in the target cell.

35. The method of any one of claims 31-34, wherein the pharmaceutical formulation is administered in an amount effective for treating a genetic disease.

36. The method of claim 35, wherein the genetic disease is selected from the group consisting of cystic fibrosis, hemophilia, hemoglobinopathy, xeroderma pigmentosum, and lysosomal storage diseases.

37. The method of claim 36, wherein the hemoglobinopathy is sickle cell anemia or beta-thalassemia.

38. The method of claim 35, wherein the genetic disease is selected from the group consisting of ocular diseases, neurological and / or neurodegenerative diseases, neurodevelopmental diseases and cancer.

39. The method of claim 38, wherein the target cells are selected from the group consisting of reactive microglia, macrophages, astrocytes, retinal pigment epithelial cells, neurons, ganglion cells and other neuronal cells in the brain and eye.

40. The method of claim 38 or 39, wherein the ocular disease is age-related macular degeneration, choroidal neovascularization, retinitis pigmentosa, Stargardt's disease.

41. The method of claim 40, wherein the sgRNA is specific for vascular endothelial growth factor (VEGF) for treating AMD.

42. The method of claim 41, wherein the pharmaceutical formulation is administered in an effective amount to induce a decrease in the expression, translation or activity of VEGF in the target cells by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100%, and the target cells are retinal cells.

43. The method of claim 38, wherein the neurological and / or neurodegenerative disease is selected from the group consisting of Huntington's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, childhood cerebral adrenoleukodystrophy (ccALD), muscular dystrophy, Friedreich's ataxia, spinocerebellar ataxia, Duchenne muscular dystrophy, and spinal muscular dystrophy.

44. The method of claim 38, wherein the neurodevelopmental disease is selected from the group consisting of cerebral palsy, fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipidosis.

45. The method of claim 38, wherein the cancer is selected from the group consisting of bone cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, and uterine cancer.

46. ​​The method of claim 45, wherein the pharmaceutical formulation is administered in an effective amount to induce a decrease in the expression, translation, or activity of one or more oncogenes in the cancer by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100%.

47. The method of claim 45 or 46, wherein the pharmaceutical formulation is administered in an effective amount to induce a decrease in the expression, translation or activity of one or more immunomodulatory factors by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%.

48. The method of claim 47, wherein the immunomodulatory factor is PD-1 or PD-L1.

49. The method according to any one of claims 31-47, wherein the method comprises changing, adding and / or deleting at least one nucleotide in the genomic fragment of the target cell.

Images