Nanoparticles targeting bone tissue macrophages, their preparation method and application

By binding osteo-like peptides and mannose ligands to the surface of nanoparticles, and loading miR-142-3p and encapsulating hyaluronic acid derivatives, the problems of insufficient targeting and stability of existing nanoparticles in bone tissue were solved, achieving efficient bone injury repair and inflammation regulation.

CN119587504BActive Publication Date: 2025-11-14XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411809711.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-10
Publication Date
2025-11-14
Estimated Expiration
2044-12-10

AI Technical Summary

Technical Problem

Existing macrophage-targeting nanoparticle systems suffer from insufficient targeting in bone tissue, low targeting efficiency, lack of versatility and stability, resulting in limited therapeutic effects and potential systemic side effects.

Method used

Nanoparticles were modified using a dual targeting mechanism. This involved binding osteo-like peptides (OPG-mimicking sequences) and mannose ligands to the particle surface, loading miR-142-3p, and encapsulating them with a hyaluronic acid-hexamethylenediamine derivative (HA-HDA) to enhance targeting and stability.

Benefits of technology

It significantly improved the macrophage enrichment effect of nanoparticles in bone tissue, enhanced drug delivery efficiency, reduced systemic side effects, prolonged retention time in bone tissue, achieved multidimensional regulation of bone tissue inflammatory response, and improved bone injury repair effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119587504B_ABST
    Figure CN119587504B_ABST
Patent Text Reader

Abstract

This invention discloses a nanoparticle targeting bone tissue macrophages, its preparation method, and its applications, belonging to the field of biomedical technology. This invention employs a dual targeting mechanism, modifying the nanoparticle surface with bone-like peptide sequences and mannose-modified ligands, enabling the nanoparticles to specifically recognize macrophages in the bone tissue environment. The bone tissue macrophage-targeting nanoparticle system prepared by this invention can significantly improve targeting efficiency, anti-inflammatory effects, and tissue repair effects, while reducing systemic side effects, providing a new treatment approach for bone injury repair and showing promising clinical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to a nanoparticle that targets bone tissue macrophages, its preparation method and application. Background Technology

[0002] Inflammatory regulation during bone tissue repair and regeneration plays a crucial role in promoting bone healing and recovery. Macrophages act as key players in bone injury healing, especially in the early stages of the inflammatory response in bone tissue, modulating the tissue microenvironment by releasing various pro-inflammatory or anti-inflammatory cytokines. However, the distribution and activity of macrophages in bone tissue are not easily regulated directly, posing a challenge to targeted modulation of their function. Therefore, in recent years, nanomedicine delivery systems targeting macrophages have become a research hotspot. These systems achieve effective control of inflammation and promote bone regeneration by targeting and delivering anti-inflammatory drugs, genes, or other active molecules to macrophages. However, among existing nanodelivery systems, there are still few nanostructures that can precisely target bone tissue macrophages and efficiently release active ingredients, limiting their potential for clinical translation.

[0003] Existing macrophage-targeting nanoparticle systems typically modify the particle surface with specific ligands (such as mannose or small molecule antibodies) to recognize macrophage receptors and release drugs or gene loads into the macrophages. However, these targeting systems still have the following drawbacks:

[0004] (1) Insufficient targeting: Although current macrophage-targeting nanoparticles can partially recognize macrophages, they are difficult to effectively distinguish between macrophages in bone tissue and macrophages in other tissues. Therefore, after systemic administration, nanoparticles often distribute non-specifically among macrophages throughout the body, resulting in limited therapeutic effects and even potentially causing systemic side effects.

[0005] (2) Low targeting efficiency: Most existing nanoparticles have only a single targeting mechanism, relying on the interaction with macrophage surface receptors (such as CD206 mannose receptors). However, due to the lack of dual targeting mechanisms, their enrichment effect in bone tissue is poor.

[0006] (3) Lack of multifunctionality: Most targeted nanoparticles in existing technologies are single drug delivery systems, lacking multifunctional loading and synergistic release of genes and drugs, thus limiting the multidimensional regulatory potential of macrophage function. In addition, existing systems are also insufficient in improving the stability of bone tissue and local sustained release. Summary of the Invention

[0007] This invention provides a method for preparing nanoparticles that target bone tissue macrophages, the preparation method comprising the following steps:

[0008] (1) Synthesis of core nanoparticles

[0009] ① Dissolve PLGA in an organic solvent to a final concentration of 8-12 mg / mL;

[0010] ② miR-142-3p was dissolved in buffer at a concentration of 1.5-2.5 μg / mL and then added to the PLGA organic phase. The molar ratio of PLGA to miR-142-3p was 0.5-1.5:95-105. The sequence of miR-142-3p is shown in SEQ ID NO.1.

[0011] ③ Add the above solution dropwise to the aqueous phase containing the surfactant while stirring to form a primary emulsion;

[0012] ④ Further emulsification using ultrasound to form a uniform nanoemulsion;

[0013] ⑤ Remove the organic solvent until solidified nanoparticles are formed;

[0014] ⑥ Remove unencapsulated miR-142-3p from the solidified nanoparticles;

[0015] (2) Modification of targeted ligands

[0016] A. Bone-like peptide modification:

[0017] ① PLGA particle surface modification with active groups:

[0018] HMDI treatment: PLGA particles are suspended in an organic solvent at a concentration of 8-12 mg / mL, and HMDI is added to a final concentration of 8-12 mM. The reaction temperature is 28-32℃ and the reaction is carried out for 3-5 hours to finally obtain PLGA particles with amino groups on the surface.

[0019] Alternatively, HSP treatment: PLGA particles are suspended in an organic solvent at a concentration of 8-12 mg / mL, HSP is added to a final concentration of 14-16 mM, the reaction temperature is 24-26℃, and the reaction is carried out for 5-7 hours to finally obtain PLGA particles with carboxyl groups on the surface.

[0020] ② OPG simulates the binding reaction of the sequence:

[0021] The OPG mimic sequence was dissolved in buffer solution to a final concentration of 0.8-1.2 mg / mL. EDC and NHS were added to final concentrations of 8-12 mM and 4-6 mM, respectively, and the mixture was activated for 10-20 minutes. The OPG mimic sequence is shown in SEQ ID NO.2.

[0022] The activated OPG simulated sequence solution was mixed with PLGA particles, the final concentration of PLGA particles was 8-12 mg / mL, and the reaction was carried out at room temperature for 5-7 hours. After centrifugation, the modified particles were collected.

[0023] B. Mannose-modified ligands:

[0024] ① PLGA particle surface modification with amino or carboxyl groups:

[0025] ② Chemical cross-linking method for mannose modification:

[0026] The concentration of the mannose solution is 4-6 mg / mL;

[0027] The addition amount of PLGA particles is 8-12 mg / mL;

[0028] Crosslinking agent usage: The molar ratio of EDC to NHS is 0.8-1.2:1.5-2.5, and the molar ratio of mannose to the total of crosslinking agent EDC and NHS is 0.5-1.5:1-2;

[0029] Reaction conditions: pH 6-7, reaction temperature 24-26℃, time 3-5 hours;

[0030] (3) Construction of the outer protective shell

[0031] A. Synthesis of hyaluronic acid derivatives:

[0032] ① Dissolve hyaluronic acid in a buffer solution with a pH of 4-6 to prepare a hyaluronic acid solution with a w / v of 0.8-1.2%;

[0033] ② Add EDC and NHS, with a molar ratio of EDC to NHS of 0.5-1.5:1.5-2.5, and a molar ratio of EDC to hyaluronic acid of 0.8-1.2:0.8-1.2;

[0034] ③ Feeding ratio: HDA·HCl is added to prepare HDA-modified hyaluronic acid. The molar ratio of hyaluronic acid monosaccharide units to hexamethylenediamine hydrochloride is 10:1-20:1 to control the degree of modification.

[0035] ④ React at room temperature for 3-5 hours;

[0036] B. Outer coating:

[0037] ① Concentration of HDA-modified hyaluronic acid solution:

[0038] Prepare a 0.8-1.2 mg / mL HA-HDA solution, wherein the molecular weight of the hyaluronic acid is 10-50 kDa;

[0039] ②Required amount to add:

[0040] HDA-modified hyaluronic acid is added dropwise at 10%-20% of the total volume of the PLGA nanoparticle solution; the concentration of the PLGA nanoparticle solution is 8-12 mg / mL.

[0041] ③ Coating method:

[0042] a. Slowly add the HA-HDA solution to the aqueous phase of PLGA nanoparticles while stirring;

[0043] b. Self-assembly conditions: React at room temperature for 0.5-1.5 hours to form a stable coating layer.

[0044] Preferably, in step (1), PLGA is dissolved in an organic solvent to a final concentration of 10 mg / mL.

[0045] More preferably, in step (1), the molar ratio of PLGA to miR-142-3p is 1:100.

[0046] More preferably, in step (2), when HMDI or HSP is used for treatment, the concentration of PLGA particles after being suspended in the organic solvent is 10 mg / mL.

[0047] More preferably, in step (2), HMDI is added to a final concentration of 10 mM and HSP is added to a final concentration of 15 mM.

[0048] More preferably, in step (2), the OPG simulated sequence is dissolved in buffer solution to a final concentration of 1 mg / mL, and EDC and NHS are added to a final concentration of 10 mM and 5 mM, respectively.

[0049] More preferably, in step (2), the concentration of mannose solution is 5 mg / mL; the amount of PLGA particles added is 10 mg / mL; the amount of crosslinking agent used is: the molar ratio of EDC to NHS is 1:2, and the molar ratio of mannose to the total of crosslinking agents EDC and NHS is 1:1.5.

[0050] More preferably, in step (3), the molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to hyaluronic acid is 1:1.

[0051] The present invention also provides nanoparticles targeting bone tissue macrophages prepared by the above preparation method.

[0052] This invention also provides the application of the above-mentioned nanoparticles in the preparation of bone injury repair products.

[0053] Compared with the prior art, the present invention has the following beneficial effects:

[0054] (1) Enhance the targeting and delivery efficiency of bone tissue

[0055] This invention employs a dual-targeting mechanism, modifying the surface of nanoparticles with osteo-like peptide sequences and mannose-modified ligands, enabling the nanoparticles to specifically recognize macrophages in the bone tissue environment. The osteo-like peptides (OPG-mimicking sequences) specifically bind to RANKL molecules in bone tissue, while the mannose ligand targets the CD206 mannose receptor on the macrophage surface. This dual-targeting mechanism significantly improves the accumulation of particles in macrophages within bone tissue and reduces non-specific adsorption in systemic distribution. Experimental data show that the dual-targeting modified nanoparticles achieve a macrophage aggregation concentration in bone tissue that is approximately 40% higher than that of single-targeting nanoparticles, effectively improving the delivery efficiency of drugs or genes.

[0056] (2) Enhance the multidimensional regulatory effects of anti-inflammatory and repair mechanisms

[0057] This invention loads miR-142-3p onto nanoparticles. This specific miRNA plays a significant role in regulating macrophage function, particularly in inhibiting excessive pro-inflammatory responses and modulating macrophage phenotypic transformation, thereby achieving effective regulation of the inflammatory microenvironment. By loading miR-142-3p to achieve gene regulation of macrophages, more precise intervention in the inflammatory response of bone tissue can be achieved, further promoting angiogenesis and tissue repair. This multifunctional loading design has significant advantages over single drug delivery systems, enabling macrophages to be reprogrammed into a pro-healing phenotype in a short time, effectively reducing the persistence of inflammation and related side effects.

[0058] (3) Prolong the retention time of nanoparticles in bone tissue and improve stability

[0059] By coating nanoparticles with a hyaluronic acid-hexamethylenediamine derivative (HA-HDA), this invention improves the biocompatibility and stability of the particles. HA-HDA not only enhances the retention time of nanoparticles in bone tissue but also significantly improves their stability in the circulatory system, prolonging the half-life of the nanoparticles in vivo. Preliminary in vivo experimental data indicate that nanoparticles coated with the HA-HDA derivative have a retention time in bone tissue that is approximately 2-3 times longer than unmodified particles, effectively reducing drug waste caused by rapid clearance and reducing the need for multiple dosing cycles.

[0060] (4) Reduce systemic side effects and decrease the impact on non-target tissues.

[0061] Compared to traditional nanoparticle systems, the dual-targeting design and the application of a hyaluronic acid derivative protective shell in this invention significantly reduce the absorption and accumulation of nanoparticles in non-targeted tissues, thereby lowering the risk of systemic side effects. Experimental results show that, compared to traditional non-specifically distributed nanoparticles, the nanoparticles of this invention exhibit approximately 60% less absorption in non-bone tissue macrophages, improving drug specificity and reducing the risk of unnecessary toxic side effects.

[0062] (5) Enhance clinical translation potential

[0063] This invention overcomes the bottlenecks of traditional nanoparticle systems in bone tissue, such as insufficient targeting, low delivery efficiency, and non-specific distribution, through innovative design. The nanoparticle system based on a dual-targeting mechanism not only exhibits good biocompatibility and low toxicity but also possesses highly efficient inflammation regulation and tissue repair functions, meeting the current clinical requirements for safety and efficacy. Furthermore, the peptide ligands, miRNAs, and hyaluronic acid derivatives used in this invention are all biocompatible components, further enhancing its potential for clinical application.

[0064] In summary, this invention provides a highly efficient and specific bone tissue macrophage-targeting nanoparticle system that can significantly improve targeting efficiency, anti-inflammatory effects, and tissue repair effects, while reducing systemic side effects. It offers a new treatment approach for bone injury repair and has promising clinical application prospects. Attached Figure Description

[0065] Figure 1 This is an electron micrograph of the nanoparticles targeting bone tissue in Example 2.

[0066] Figure 2 The Dir-labeled nanoparticles in Example 3 target bone tissue.

[0067] Figure 3 The results are from the tube formation analysis in Example 4.

[0068] Figure 4 The results are from the immunofluorescence assay in Example 5. Detailed Implementation

[0069] Example 1: Specific synthesis process and steps of nanoparticles

[0070] 1. Material Preparation

[0071] Core material: Polylactic-co-glycolic acid copolymer (PLGA). PLGA (lactic acid:glycolic acid = 85:15) with high biocompatibility and good degradability is selected as the core material to ensure its sustained-release properties in vivo. This material has good degradability and can be gradually degraded into lactic acid and glycolic acid in the body, and finally excreted through metabolism.

[0072] Targeted ligands (the following targeted ligands are covalently linked to the surface of PLGA nanoparticles):

[0073] (1) Osteoporosis-like peptide (OPG mimic sequence SEQ ID NO.2: KYQGIYKSMS), selected OPG mimic sequence specifically recognizing bone tissue, can enhance the targeting of particles in bone tissue.

[0074] (2) Macrophage targeting ligand: Mannose-modified ligand, by covalently binding mannose molecules on the surface of nanoparticles, the ligand can specifically bind to glycoprotein receptors (e.g., Mannose Receptor, MR) on macrophages, thereby selectively targeting macrophages in bone tissue for CD206 receptor.

[0075] (3) Drug or gene loading: anti-inflammatory and angiogenesis-promoting small molecule (miR-142-3p sequence SEQ ID NO.1: UGUAGUGUUUCCUACUUUAUGGA), which can regulate the functional state of macrophages, promote angiogenesis, effectively reduce the inflammatory response in bone tissue, and promote tissue repair.

[0076] (4) Outer protective shell: Hyaluronic acid-hexamethylenediamine covalent derivative (HDA-modified hyaluronic acid), further enhances targeting and biocompatibility, prolongs blood circulation time, and prevents rapid clearance in the circulatory system.

[0077] 2. Synthesis of core nanoparticles

[0078] (1) Dissolve PLGA (85:15) in the organic solvent ethyl acetate to a concentration of 10 mg / mL.

[0079] (2) miR-142-3p was dissolved in TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) at a concentration of 2 μg / mL, and then added to the PLGA organic phase to ensure that the drug loading ratio (miR-142-3p) was 1:100 (molar ratio of PLGA to miR-142-3p) to ensure the optimal balance between loading and release rate.

[0080] (3) The above solution was added dropwise to 10 mL of surfactant (polyethylene glycol modified polyvinyl alcohol (PEG-PVA), concentration 1% (w / v)) aqueous phase at a rate of 1 mL / min (pre-cooled to 4 °C to increase particle uniformity), while stirring at 1000 rpm to form a primary emulsion.

[0081] (4) The emulsifier is further emulsified to form a uniform nanoemulsion by using an ultrasonic probe (20kHz, 60W, 10-second intermittent ultrasound, for 2 minutes).

[0082] (5) Evaporate the organic solvent in the emulsion at 300 rpm and 25°C on a rotary evaporator until solidified nanoparticles are formed.

[0083] (6) After the nanoparticles were prepared, the unencapsulated miR-142-3p was removed by ultracentrifugation (30,000g, 4°C, 20 minutes). The particles were washed three times with sterile PBS.

[0084] Packaging steps and precautions:

[0085] ① Mix the miR-142-3p solution with the PLGA organic solution evenly, and then encapsulate according to the emulsion method procedure.

[0086] ② Maintain low temperature (4°C) operation in the aqueous phase to avoid miR degradation, and use nitrogen gas to protect the environment during organic solvent evaporation to reduce the risk of miR oxidation.

[0087] 3. Modification of targeted ligands

[0088] (1) Bone-like peptide modification:

[0089] On the surface of PLGA particles, OPG-simulated sequences are covalently bound through chemical reactions (such as cross-linking reactions). The specific process is as follows:

[0090] ① PLGA particle surface modification with active groups:

[0091] To introduce amino (–NH2) or carboxyl (–COOH) groups as active sites onto the surface of PLGA particles, surface activation is typically performed using hydroxypropanesulfonic acid (HSP) or 1,6-hexanediol diisocyanate (HMDI).

[0092] HMDI treatment: PLGA particles were suspended in anhydrous dichloromethane (DCM) at a concentration of 10 mg / mL, and HMDI (final concentration of 10 mM) was added. The reaction was carried out at 30°C for 4 hours. Then, the particles were washed three times with anhydrous diethyl ether to remove unreacted substances, and finally, PLGA particles with amino groups on the surface were obtained.

[0093] HSP treatment: PLGA particles were suspended in anhydrous acetonitrile at a concentration of 10 mg / mL, and HSP (final concentration of 15 mM) was added. The reaction was carried out at 25 °C for 6 hours. The particles were then washed three times with distilled water to obtain PLGA particles with carboxyl groups on the surface.

[0094] ② OPG simulates the binding reaction of the sequence:

[0095] a. If the PLGA particle surface contains amino groups (–NH2), the carboxyl activation reaction can be promoted by EDC / NHS (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride / hydroxysuccinimide) to covalently link the OPG simulated sequence (including the terminal carboxyl group) to the PLGA particle surface.

[0096] Dissolve the OPG mimic sequence containing the terminal carboxyl group (concentration 1 mg / mL) in MES buffer (50 mM, pH 6.0). Add EDC (final concentration 10 mM) and NHS (final concentration 5 mM) and activate for 15 minutes.

[0097] The activated OPG mimic sequence solution was mixed with PLGA particles (final concentration 10 mg / mL) and reacted with shaking at room temperature (25 °C) for 6 hours. The particles were washed three times with PBS buffer (pH 7.4) to remove unbound OPG mimic sequences, and then collected after centrifugation.

[0098] b. If the surface of PLGA particles contains carboxyl groups (–COOH), amide bonds can be formed through a reaction similar to EDC / NHS with the OPG sequence (which contains an amino group at the end).

[0099] Dissolve the amino-terminal OPG mimic sequence (1 mg / mL) in MES buffer (50 mM, pH 6.0). Add EDC (final concentration 10 mM) and NHS (final concentration 5 mM) and activate for 15 minutes.

[0100] The activated PLGA particles (final concentration 10 mg / mL) were mixed with the OPG simulated sequence solution and reacted with shaking at room temperature (25 °C) for 6 hours. The particles were washed three times with PBS buffer (pH 7.4), centrifuged, and then collected.

[0101] ③ Combining efficiency and amount of modification:

[0102] Number of simulated OPG sequences bound to the surface of each PLGA particle:

[0103] a. Assume the nanoparticles have a diameter of 200 nm and a surface area of ​​approximately 1.26 × 10⁻⁶. -13 cm 2 .

[0104] b. Approximately 1-10 molecules can be bound per square nanometer surface (the specific binding amount depends on the surface group density and reaction efficiency), and approximately 1,000-10,000 OPG-simulated sequence molecules can be bound to a single particle surface.

[0105] (2) Mannose-modified ligands:

[0106] A chemical cross-linking method was used to covalently link mannose molecules to the surface of PLGA particles to enhance their binding ability to the CD206 receptor on macrophages.

[0107] ① PLGA particle surface modification with amino or carboxyl groups:

[0108] Hydroxypropanesulfonic acid (HSP) or similar surface modifiers are used to generate active groups (such as amino–NH2).

[0109] ② Mannose-modified chemical cross-linking method:

[0110] a. The mannose molecule is covalently linked to the amino (-NH2) or carboxyl (-COOH) groups modified on the surface of the PLGA particles (final concentration of 10 mg / mL) through its terminal hydroxyl group (–OH).

[0111] b. Use borate ester chemical crosslinking agents, such as boric acid-EDC / NHS crosslinking system, to stably covalently attach mannose to the surface of PLGA particles. Reaction conditions: pH 6-7, reaction temperature 25℃, time 4 hours.

[0112] Crosslinking agent usage: The molar ratio of EDC to NHS is 1:2, and the molar ratio of mannose to crosslinking agent (the sum of EDC and NHS) is 1:1.5.

[0113] Mannose concentration: The concentration of the mannose solution is 5 mg / mL.

[0114] Mannose binding efficiency in the reaction: Each PLGA particle can modify approximately 500-5000 mannose molecules, and the binding amount can be determined by infrared spectroscopy or HPLC.

[0115] 4. Construction of the outer protective shell

[0116] (1) Synthesis of hyaluronic acid derivatives:

[0117] HDA-modified hyaluronic acid derivatives were prepared by reacting hyaluronic acid with hexamethylenediamine hydrochloride. The degree of modification was controlled within the range of 10-20% (i.e., approximately 10-20 out of every 100 hyaluronic acid monomers were linked to hexamethylenediamine groups) to ensure good stability and binding ability. The specific process is as follows:

[0118] Hyaluronic acid (HA) is reacted with hexamethylenediamine hydrochloride (HDA·HCl) to prepare HDA-modified hyaluronic acid (HA-HDA).

[0119] ①Reaction solvent: Dissolve hyaluronic acid in MES buffer (50mM) at pH 5.5 to prepare a 1% (w / v) hyaluronic acid solution;

[0120] ② Activator: EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) and NHS (N-hydroxysuccinimide) are added to activate the carboxyl group of HA. The molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to HA is 1:1.

[0121] ③ Feeding ratio: Add HDA·HCl, and control the degree of modification according to the molar ratio of HA monosaccharide units to hexamethylenediamine hydrochloride of 10:1-20:1;

[0122] ④ Reaction time and temperature: Stir the reaction for 4 hours at room temperature (25℃);

[0123] ⑤ Purification: Remove unreacted reagents by dialysis (dialysis bag molecular weight cutoff of 10kDa, dialysis solution is deionized water at pH 7.0, 48 hours).

[0124] Under the above conditions, the degree of hexamethylenediamine modification of hyaluronic acid can be controlled between 10% and 20%. After the reaction is completed, the degree of modification is verified by infrared spectroscopy or nuclear magnetic resonance.

[0125] (2) Outer coating:

[0126] The synthesized HDA-modified hyaluronic acid solution was added dropwise to the aqueous phase of PLGA nanoparticles. The outer protective shell of the nanoparticles was formed through self-assembly or chemical cross-linking methods, as detailed below:

[0127] ① Concentration of HDA-modified hyaluronic acid solution:

[0128] Prepare a 1 mg / mL HA-HDA solution (based on the mass of HA) to ensure that its molecular weight is suitable for the coating of nanoparticles (preferably 10-50 kDa hyaluronic acid).

[0129] ②Required amount to add:

[0130] a. The amount of HDA-modified hyaluronic acid added should be 10%-20% (v / v) of the total volume of the nanoparticle solution to avoid excessive addition that could lead to particle aggregation;

[0131] b. 50-100 μg of HA-HDA needs to be added for every 1 mg of PLGA nanoparticles to ensure uniform coating and form a stable outer protective shell.

[0132] ③ Coating method:

[0133] a. Slowly add the HA-HDA solution to the aqueous phase of PLGA nanoparticles using a micro-dropper (stirring speed 300 rpm) to ensure uniform dispersion;

[0134] b. Self-assembly conditions: Stir the reaction at room temperature (25℃) for 1 hour to form a stable coating layer through electrostatic interaction and hydrogen bonding;

[0135] c. Chemical cross-linking selection: If it is necessary to enhance the coating stability, glutaraldehyde (0.1%-0.5% v / v) can be added. The cross-linking time should be controlled within 15 minutes to avoid excessive cross-linking affecting the activity of surface-targeting molecules.

[0136] 5. Purification and characterization of nanoparticles

[0137] Purification: Use dialysis or centrifugation to remove unbound ligands and excess material.

[0138] Characterization: The particle size and morphology of the nanoparticles were analyzed by dynamic light scattering (DLS) and scanning electron microscopy (SEM). The efficacy and release characteristics of the drug loading were confirmed by UV-Vis spectroscopy and fluorescence methods.

[0139] Electron microscopy examination:

[0140] (1) Take an appropriate amount of targeted nanoparticles and observe their morphology and structure using a transmission electron microscope (TEM).

[0141] During the experiment, the nanoparticles need to be freeze-dried or ultrathin sliced ​​to ensure that the morphology and size of the nanoparticles remain unchanged.

[0142] (2) The treated nanoparticles were coated onto a copper grid and observed using a high-resolution transmission electron microscope.

[0143] (3) Observe the morphology, size, surface structure and possible aggregation of nanoparticles.

[0144] (4) Obtain electron microscopy images and analyze the uniformity and structural integrity of the nanoparticles. Figure 1 ).

[0145] 6. Storage and Application

[0146] The synthesized nanoparticles were stored under suitable conditions for further evaluation of biocompatibility and targeting.

[0147] Example 2

[0148] 1. Synthesis of core nanoparticles

[0149] (1) Dissolve PLGA (85:15) in the organic solvent ethyl acetate to a concentration of 10 mg / mL.

[0150] (2) miR-142-3p was dissolved in TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) at a concentration of 2 μg / mL, and then added to the PLGA organic phase to ensure that the drug loading ratio (miR-142-3p) was 1:100 (molar ratio of PLGA to miR-142-3p) to ensure the optimal balance between loading and release rate.

[0151] (3) The above solution was added dropwise to 10 mL of surfactant (polyethylene glycol modified polyvinyl alcohol (PEG-PVA), concentration 1% (w / v)) aqueous phase at a rate of 1 mL / min (pre-cooled to 4 °C to increase particle uniformity), while stirring at 1000 rpm to form a primary emulsion.

[0152] (4) The emulsifier is further emulsified to form a uniform nanoemulsion by using an ultrasonic probe (20kHz, 60W, 10-second intermittent ultrasound, for 2 minutes).

[0153] (5) Evaporate the organic solvent in the emulsion at 300 rpm and 25°C on a rotary evaporator until solidified nanoparticles are formed.

[0154] (6) After the nanoparticles were prepared, the unencapsulated miR-142-3p was removed by ultracentrifugation (30,000g, 4°C, 20 minutes). The particles were washed three times with sterile PBS.

[0155] Packaging steps and precautions:

[0156] ① Mix the miR-142-3p solution with the PLGA organic solution evenly, and then encapsulate according to the emulsion method procedure.

[0157] ② Maintain low temperature (4°C) operation in the aqueous phase to avoid miR degradation, and use nitrogen gas to protect the environment during organic solvent evaporation to reduce the risk of miR oxidation.

[0158] 2. Modification of targeted ligands

[0159] (1) Bone-like peptide modification:

[0160] On the surface of PLGA particles, OPG-simulated sequences are covalently bound through chemical reactions (such as cross-linking reactions). The specific process is as follows:

[0161] ① PLGA particle surface modification with active groups:

[0162] To introduce amino (–NH2) or carboxyl (–COOH) groups as active sites onto the surface of PLGA particles, surface activation is typically performed using 1,6-hexanediol diisocyanate (HMDI).

[0163] HSP treatment: PLGA particles were suspended in anhydrous acetonitrile at a concentration of 10 mg / mL, and HSP (final concentration of 15 mM) was added. The reaction was carried out at 25 °C for 6 hours. The particles were then washed three times with distilled water to obtain PLGA particles with carboxyl groups on the surface.

[0164] ② OPG simulates the binding reaction of the sequence:

[0165] It forms an amide bond through a reaction similar to EDC / NHS with the OPG sequence (which contains an amino group at the end).

[0166] Dissolve the OPG simulated sequence (concentration 1 mg / mL) in MES buffer (50 mM, pH 6.0). Add EDC (final concentration 10 mM) and NHS (final concentration 5 mM) and activate for 15 minutes.

[0167] The activated PLGA particles (final concentration 10 mg / mL) were mixed with the OPG simulated sequence solution and reacted with shaking at room temperature (25 °C) for 6 hours. The particles were washed three times with PBS buffer (pH 7.4), centrifuged, and then collected.

[0168] (2) Mannose-modified ligands:

[0169] A chemical cross-linking method was used to covalently link mannose molecules to the surface of PLGA particles to enhance their binding ability to the CD206 receptor on macrophages.

[0170] ① PLGA particle surface modification with carboxyl groups:

[0171] Hydroxypropanesulfonic acid (HSP) is used to generate active groups.

[0172] ② Mannose-modified chemical cross-linking method:

[0173] a. The mannose molecule is covalently linked to the carboxyl group (–COOH) modified on the surface of the PLGA particles (final concentration of 10 mg / mL) through its terminal hydroxyl group (–OH).

[0174] b. Use borate ester chemical crosslinking agents, such as boric acid-EDC / NHS crosslinking system, to stably covalently attach mannose to the surface of PLGA particles. Reaction conditions: pH 6-7, reaction temperature 25℃, time 4 hours.

[0175] Crosslinking agent usage: The molar ratio of EDC to NHS is 1:2, and the molar ratio of mannose to crosslinking agent (the sum of EDC and NHS) is 1:1.5.

[0176] The final concentration of PLGA particles was 10 mg / mL.

[0177] Mannose concentration: The concentration of the mannose solution is 5 mg / mL.

[0178] 3. Construction of the outer protective shell

[0179] (1) Synthesis of hyaluronic acid derivatives:

[0180] HDA-modified hyaluronic acid derivatives were prepared by reacting hyaluronic acid with hexamethylenediamine hydrochloride. The degree of modification was controlled within the range of 10-20% (i.e., approximately 10-20 out of every 100 hyaluronic acid monomers were linked to hexamethylenediamine groups) to ensure good stability and binding ability. The specific process is as follows:

[0181] Hyaluronic acid (HA) is reacted with hexamethylenediamine hydrochloride (HDA·HCl) to prepare HDA-modified hyaluronic acid (HA-HDA).

[0182] ①Reaction solvent: Dissolve hyaluronic acid in MES buffer (50mM) at pH 5.5 to prepare a 1% (w / v) hyaluronic acid solution;

[0183] ② Activator: EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) and NHS (N-hydroxysuccinimide) are added to activate the carboxyl group of HA. The molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to HA is 1:1.

[0184] ③ Feeding ratio: Add HDA·HCl at a molar ratio of HA monosaccharide units to hexamethylenediamine hydrochloride of 15:1;

[0185] ④ Reaction time and temperature: Stir the reaction for 4 hours at room temperature (25℃);

[0186] ⑤ Purification: Remove unreacted reagents by dialysis (dialysis bag molecular weight cutoff of 10kDa, dialysis solution is deionized water with pH 7.0, 48 hours).

[0187] (2) Outer coating:

[0188] The synthesized HDA-modified hyaluronic acid solution was added dropwise to the aqueous phase of PLGA nanoparticles (concentration of 10 mg / mL). The outer protective shell of the nanoparticles was formed through self-assembly or chemical cross-linking methods, as detailed below:

[0189] ① Concentration of HDA-modified hyaluronic acid solution:

[0190] Prepare a 1 mg / mL HA-HDA solution (based on the mass of HA) to ensure that its molecular weight is suitable for the coating of nanoparticles (50 kDa hyaluronic acid).

[0191] ②Required amount to add:

[0192] The amount of HDA-modified hyaluronic acid added should be 10% (v / v) of the total volume of the nanoparticle solution to avoid excessive addition that could lead to particle aggregation.

[0193] ③ Coating method:

[0194] a. Slowly add the HA-HDA solution to the aqueous phase of PLGA nanoparticles using a micro-dropper (stirring speed 300 rpm) to ensure uniform dispersion;

[0195] b. Self-assembly conditions: Stir the reaction at room temperature (25℃) for 1 hour to form a stable coating layer through electrostatic interaction and hydrogen bonding;

[0196] 4. Purification and characterization of nanoparticles

[0197] Purification: Use dialysis or centrifugation to remove unbound ligands and excess material.

[0198] Characterization: By dynamic light scattering (DLS) and scanning electron microscopy (SEM, see [link]). Figure 1 The particle size and morphology of the nanoparticles were analyzed. The effectiveness and release characteristics of the drug loading were confirmed using UV-Vis spectroscopy and fluorescence methods.

[0199] Example 3: Small animal imaging results show that Dir-labeled nanoparticles target bone tissue.

[0200] 1. Nanoparticle labeling

[0201] In the preparation of targeted nanoparticles, surface modification techniques containing dyes (such as Dir) are used to label the nanoparticles. Dir (DiR, a near-infrared fluorescent dye) is used to label nanoparticles so that their distribution in vivo can be tracked using imaging techniques.

[0202] 2. Establishment of animal models

[0203] 2.1 A mouse model was selected and subjected to standard anesthesia and treatment to ensure the safety and comfort of the animals during the experiment.

[0204] 2.2 To simulate bone tissue damage in small animals or through local injection, and to serve as a model for nanoparticle targeted therapy, five cases were included in the experimental group and five cases in the control group.

[0205] 3. Nanoparticle injection

[0206] Dir-labeled targeted nanoparticles were introduced into small animals via intravenous injection. Injection time and dosage were recorded.

[0207] (1) Injection dosage:

[0208] The experimental group was injected with Dir-labeled targeting nanoparticles prepared in Example 2 at a dose of 10 mg / kg (based on mouse body weight), dissolved in PBS, with the total injection volume not exceeding 10% of the mouse body weight (e.g., 200 μL for a 20g mouse). The control group was injected with the same volume of PBS.

[0209] (2) Injection frequency:

[0210] A single injection is used to observe targeting performance.

[0211] (3) Duration of drug administration before imaging:

[0212] After intravenous injection, the nanoparticles need to be distributed in the body and target bone tissue, and imaging can be performed 6 hours later.

[0213] 4. Imaging Operation

[0214] 4.1 Real-time imaging was performed using a near-infrared imaging system to record the distribution of nanoparticles within small animals.

[0215] 4.2 During imaging, set appropriate parameters (excitation wavelength: 760nm; emission wavelength: 800–850nm; exposure time: 2 seconds; resolution: 1.0cm; laser power: medium intensity; image acquisition frequency: 3 times; imaging depth: 2.5cm; image format: TIFF; background subtraction: automatic) to ensure that the Dir fluorescence signal can be clearly captured, focusing on observing the fluorescence signal in the bone tissue area.

[0216] 5. Results Analysis

[0217] 5.1 Analyze the imaging results and compare the enrichment degree of nanoparticles in bone tissue with the distribution in other tissues. Confirm the targeting effect of nanoparticles in bone tissue.

[0218] 5.2 Evaluation of nanoparticle targeting in bone tissue based on fluorescence intensity ( Figure 2 ).

[0219] Example 4: Vascularization Experiment

[0220] 1. Cell culture:

[0221] HUVECs were cultured in a medium containing 10% fetal bovine serum (FBS) and 1% antibiotics (such as penicillin / streptomycin) at 37°C and 5% CO2 until the cells reached 80% confluence.

[0222] 2. Preparation of Matrigel matrix:

[0223] On ice, add 50 μL of pre-cooled Matrigel (a matrix for simulating cell growth) to each well of a 96-well plate. Then place the 96-well plate in a 37°C incubator and let it stand for 30 minutes until the Matrigel solidifies into a film.

[0224] 3. Cell treatment:

[0225] HUVECs in logarithmic growth phase were collected, washed with PBS, and then stored at an appropriate cell density (1×10⁻⁶). 4 Cells / wells were seeded into Matrigel-coated 96-well plates.

[0226] 4. Add the treatment material:

[0227] The targeted bone tissue nanoparticles prepared in Example 2 (experimental group, final concentration of 50 μg / mL) or PBS (control group) were added to each well and cultured for 24 hours.

[0228] 5. Observation of the tube:

[0229] Twenty-four hours later, the vascular morphology of HUVECs within each well was observed using a microscope. The effect of nanoparticles on angiogenesis was assessed based on the formation of tubular structures.

[0230] 6. Pipeline Analysis:

[0231] Images of vascular formation were captured using a microscope, and image analysis software (ImageJ) was used to calculate the length of the vessels, the number of branches, and the formation of the network structure to assess angiogenesis. Figure 3 The results showed that nanoparticles can promote angiogenesis.

[0232] Example 5 Immunofluorescence Experiment

[0233] 1. Cell culture:

[0234] THP-1 cells were taken and stimulated with an appropriate concentration of PMA (12-O-tetradecanoylphorbol-13-acetate) for 4-6 hours to induce THP-1 cells to differentiate into macrophages.

[0235] 2. Cell treatment:

[0236] Differentiated macrophages were divided at a rate of 1×10 6 The cells were seeded into 6-well plates at a concentration of cells / mL and cultured for 24 hours until the cells reached 80% confluence.

[0237] 3. Treatment with added nanoparticles:

[0238] The targeted bone tissue nanoparticles (experimental group, final concentration of 50 μg / mL) or PBS (control group) prepared in Example 2 were added to the cell culture medium and cultured for another 24 hours.

[0239] 4. Immunofluorescence staining:

[0240] 4.1 After the culture was completed, the cells were washed with PBS and fixed in 4% paraformaldehyde solution for 15 minutes.

[0241] 4.2 Wash three times with PBS, add 1% Triton X-100 solution, and permeate for 10 minutes.

[0242] 4.3 Wash with PBS, add anti-Arg1 antibody (1:200) and incubate overnight at 4°C.

[0243] 4.4 On the second day, wash with PBS, add fluorescently labeled secondary antibody (1:500), and continue incubation for 1 hour.

[0244] 4.5 Wash three times with PBS, then add DAPI for staining and incubate for 5 minutes.

[0245] 5. Immunofluorescence observation:

[0246] The labeling of M2 macrophages was observed using fluorescence microscopy. The fluorescence intensity and number of Arg1-positive cells can characterize the proportion of M2 macrophages.

[0247] 6. Data Analysis:

[0248] Immunofluorescence images were captured using a microscope to assess changes in the number and fluorescence intensity of Arg1-positive (M2 macrophage marker) cells in the nanoparticle group compared to the control group (PBS), and to analyze the effect of nanoparticles on macrophage polarization. Figure 4 The results showed that the nanoparticles prepared in Example 1 could promote the polarization of M2 macrophages (Arg1+).

[0249] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for preparing nanoparticles targeting bone tissue macrophages, characterized in that, The preparation method includes the following steps: (1) Synthesis of core nanoparticles ① Dissolve PLGA in an organic solvent to a final concentration of 8-12 mg / mL; ② miR-142-3p was dissolved in buffer at a concentration of 1.5-2.5 μg / mL and then added to the PLGA organic phase. The molar ratio of PLGA to miR-142-3p was 0.5-1.5:95-105. The sequence of miR-142-3p is shown in SEQ ID NO.

1. ③ Add the above solution dropwise to the aqueous phase containing the surfactant while stirring to form a primary emulsion; ④ Further emulsification using ultrasound to form a uniform nanoemulsion; ⑤ Remove the organic solvent until solidified nanoparticles are formed; (2) Modification of targeted ligands A. Bone-like peptide modification: ① PLGA particle surface modification with active groups: HMDI treatment: PLGA particles are suspended in an organic solvent at a concentration of 8-12 mg / mL, and HMDI is added to a final concentration of 8-12 mM. The reaction temperature is 28-32℃, and the reaction is carried out for 3-5 hours to finally obtain PLGA particles with amino groups on the surface. Alternatively, HSP treatment: PLGA particles are suspended in an organic solvent at a concentration of 8-12 mg / mL, HSP is added to a final concentration of 14-16 mM, the reaction temperature is 24-26℃, and the reaction is carried out for 5-7 hours to finally obtain PLGA particles with carboxyl groups on the surface. ② OPG simulates the binding reaction of the sequence: The OPG mimic sequence was dissolved in buffer solution to a final concentration of 0.8-1.2 mg / mL. EDC and NHS were added to final concentrations of 8-12 mM and 4-6 mM, respectively, and the mixture was activated for 10-20 minutes. The OPG mimic sequence is shown in SEQ ID NO.

2. The activated OPG simulated sequence solution was mixed with PLGA particles at a final concentration of 8-12 mg / mL. The mixture was reacted at room temperature for 5-7 hours, and the modified particles were collected after centrifugation. B. Mannose-modified ligands: ① PLGA particle surface modification with amino or carboxyl groups: ② Chemical cross-linking method for mannose modification: The concentration of the mannose solution is 4-6 mg / mL; The amount of PLGA particles added is 8-12 mg / mL; Crosslinking agent usage: The molar ratio of EDC to NHS is 0.8-1.2:1.5-2.5, and the molar ratio of mannose to the total of crosslinking agent EDC and NHS is 0.5-1.5:1-2; Reaction conditions: pH 6-7, reaction temperature 24-26°C, time 3-5 hours; (3) Construction of the outer protective shell A. Synthesis of hyaluronic acid derivatives: ① Dissolve hyaluronic acid in a buffer solution with a pH of 4-6 to prepare a hyaluronic acid solution with a w / v of 0.8-1.2%; ② Add EDC and NHS, with a molar ratio of EDC to NHS of 0.5-1.5:1.5-2.5, and a molar ratio of EDC to hyaluronic acid of 0.8-1.2:0.8-1.2; ③ Feeding ratio: HDA·HCl is added to prepare HDA-modified hyaluronic acid. The molar ratio of hyaluronic acid monosaccharide units to hexamethylenediamine hydrochloride is 10:1-20:1 to control the degree of modification. ④ React at room temperature for 3-5 hours; B. Outer coating: ① Concentration of HDA-modified hyaluronic acid solution: Prepare a 0.8-1.2 mg / mL HA-HDA solution, wherein the molecular weight of the hyaluronic acid is 10-50 kDa; ②Required amount to add: The amount of HDA-modified hyaluronic acid added is 10%-20% of the total volume of the PLGA nanoparticle solution; the concentration of the PLGA nanoparticle solution is 8-12 mg / mL. ③ Coating method: a. Slowly add the HA-HDA solution to the aqueous phase of PLGA nanoparticles while stirring; b. Self-assembly conditions: React at room temperature for 0.5-1.5 hours to form a stable coating layer.

2. The preparation method according to claim 1, characterized in that, In step (1), PLGA is dissolved in an organic solvent to a final concentration of 10 mg / mL.

3. The preparation method according to claim 2, characterized in that, In step (1), the molar ratio of PLGA to miR-142-3p is 1:

100.

4. The preparation method according to claim 3, characterized in that, In step (2), when HMDI or HSP is used for treatment, the concentration of PLGA particles suspended in the organic solvent is 10 mg / mL.

5. The preparation method according to claim 4, characterized in that, In step (2), HMDI is added to a final concentration of 10 mM, and HSP is added to a final concentration of 15 mM.

6. The preparation method according to claim 5, characterized in that, In step (2), the OPG simulated sequence is dissolved in buffer solution to a final concentration of 1 mg / mL, and EDC and NHS are added to a final concentration of 10 mM and 5 mM, respectively.

7. The preparation method according to claim 6, characterized in that, In step (2), the concentration of mannose solution is 5 mg / mL; the amount of PLGA particles added is 10 mg / mL; the amount of crosslinking agent used: the molar ratio of EDC to NHS is 1:2, and the molar ratio of mannose to the total of crosslinking agents EDC and NHS is 1:1.

5.

8. The preparation method according to claim 7, characterized in that, In step (3), the molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to hyaluronic acid is 1:

1.

9. Nanoparticles targeting bone tissue macrophages prepared by the preparation method according to any one of claims 1-8.

Citation Information

Patent Citations

  • Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease

    CN113164561A

  • Mannitol modified nanoparticles as well as preparation method and application thereof

    CN115040660A