Application of BnDHAR3 gene in regulating oil content in rapeseed seeds

Abstract

The present invention discloses BnDHAR3 The application of genes in regulating rapeseed seed oil content. By using comparative transcriptome data between high-oil and low-oil rapeseed materials, candidate genes affecting rapeseed seed oil content were obtained. After PCR amplification and sequence alignment, the rapeseed oil content regulating gene was successfully isolated and cloned. BnDHAR3 , overexpressed in rapeseed BnDHAR3 After the gene was introduced, the oil content of transgenic rapeseed seeds increased by more than 10% compared with the control, which can achieve the goal of increasing plant oil production.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a gene BnDHAR3 for regulating the oil content of rapeseed seeds. Increasing the expression level of the BnDHAR3 gene by genetic engineering technology can increase the oil content of rapeseed seeds, thereby achieving the purpose of increasing crop oil yield. Background Art

[0002] Vegetable oils and fats are an indispensable component of the human diet, a crucial industrial raw material, and a bioenergy source, playing a vital role in national economic and social development. In recent years, as people pursue healthier diets, vegetable oils and fats have gradually replaced animal fats and fats, becoming the primary consumer oil in my country's edible oil market. While demand for vegetable oils and fats in my country has increased annually, production has been declining, leaving the country's edible oil supply largely dependent on imports.

[0003] Rapeseed accounts for approximately 40% of my country's edible oil production and is a key oilseed crop. Research shows that a 1% increase in rapeseed seed oil content is equivalent to a 2.5% yield increase. Therefore, increasing rapeseed seed oil content is a crucial measure to ensure my country's edible oil supply. Current research predicts that rapeseed seed oil content can reach as high as 75%, but the average oil content of existing rapeseed varieties in my country has hovered around 43%, leaving significant room for improvement. Rapeseed oil content is a quantitative trait controlled by multiple minor genes and significantly influenced by environmental conditions, making it challenging to significantly increase rapeseed seed oil content using traditional breeding techniques. With the continuous advancement and maturity of molecular biology and sequencing technologies, the discovery, isolation, cloning, and functional analysis of genes regulating rapeseed oil content are advancing rapidly. The use of genetic engineering and gene editing techniques to create new rapeseed varieties with high oil content has become a new direction in rapeseed breeding, offering broad development and application prospects.

[0004] The biosynthetic pathways of fatty acids and oils in plants have been extensively studied. For example, in the model plant Arabidopsis thaliana, the biosynthesis of plant oils primarily involves three steps: fatty acid (FA) synthesis, triacylglycerol (TAG) assembly, and oil body formation. A considerable number of related genes have been isolated and identified from different species, and studies have shown that the chemical pathways for fatty acid and oil synthesis are essentially the same across species. The key prerequisites for seed oil synthesis include acetyl-CoA, NAD(P)H, and ATP. The sources and regulation of these precursors directly influence the rate and amount of oil accumulation. Plant oil metabolism is a complex biological process involving multiple genes, with numerous regulatory points and factors, including key transcription factors, fatty acid synthesis and transport, TAG accumulation, glycolysis, acetyl-CoA, the pentose phosphate pathway, and starch synthesis and degradation. Key transcription factors influencing oil synthesis include WRI1, LEC1, and LEC2. In transgenic rapeseed plants overexpressing LEC1, key genes involved in glycolysis, plastid fatty acid synthesis, and oil accumulation are upregulated, resulting in a significant increase in fatty acid content. LEC2 is a member of the plant-specific B3 transcription factor family, and its transcription level is positively correlated with oil accumulation. However, the functional redundancy of many transcription factors complicates the study of oil content regulation, and the mechanisms of action of some transcription factors remain unknown. With the release of high-quality rapeseed genomes in recent years, several Arabidopsis thaliana homologous rapeseed oil biosynthesis regulatory genes have been cloned, and a small number of novel rapeseed oil biosynthesis regulatory genes, such as BnGDSL, BnSDP1, and BnGRF2, have been discovered.

[0005] In this study, the inventors conducted a comparative transcriptomic analysis of embryos from high- and low-oil rapeseed varieties at different developmental stages. They identified significant differences in the expression of the BnDHAR3 gene between high- and low-oil rapeseed varieties, and found that heterozygous mutants of this homologous gene in Arabidopsis thaliana exhibited a 3-4 percentage point decrease in oil content. By isolating and cloning the gene, constructing an overexpression vector, and validating the transformation of rapeseed varieties, they ultimately confirmed that BnDHAR3 regulates changes in plant seed oil content. Applying this gene to crop breeding could significantly increase oil yields in oilseed crops. Summary of the Invention

[0006] The object of the present invention is to provide a BnDHAR3 gene for regulating the oil content of rapeseed seeds, the coding sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide an application of the gene BnDHAR3 in regulating plant oil yield or breeding high-oil-yielding rapeseed, thereby increasing the oil content of seeds by increasing the expression level of the BnDHAR3 gene in plants, thereby achieving the purpose of increasing plant oil yield.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] 1. Acquisition of the BnDHAR3 gene

[0010] Using two groups of rapeseed resources with uniquely different oil contents, comparative transcriptomic analysis was conducted between a high-oil rapeseed variety (ZY036) and a low-oil rapeseed variety (93275). It was found that in rapeseed embryos at 25 and 35 days of development, the expression level of the BnaA02G0065900ZS gene in high-oil rapeseed seeds was significantly higher than that in low-oil rapeseed. It is speculated that this gene may regulate the oil content of rapeseed seeds. This gene has three homologous genes in rapeseed, namely BnaA02G0367700ZS, BnaA10G0199800ZS, and BnaC03G0065300ZS. After comparison with the Arabidopsis database, it was found that the homologous gene of BnaA02G0065900ZS in Arabidopsis is a DHAR3 gene encoding dehydroascorbate reductase, so the BnaA02G0065900ZS gene was named BnDHAR3 gene.

[0011] 2. Cloning of the CDS region of the BnDHAR3 gene and construction of a plant overexpression vector

[0012] Using the cDNA of the sequenced rapeseed variety ZS11 as a template, PCR amplification was performed with primers BnDHAR3-F: 5′-ATGATAAGACTGAGGTTTCA-3′ (SEQ ID NO. 3) and BNDHAR3-R: 5′-TCAGGCCATCACCTTCGGTC-3′ (SEQ ID NO. 4). The amplified fragment was verified by sequencing and sequence alignment and was determined to be the full-length CDS sequence of the rapeseed BnDHAR3 gene. Its nucleotide sequence is shown in SEQ ID NO. 1, and its encoded amino acid sequence is shown in SEQ ID NO. 2.

[0013] 3. Construction and Verification of Plant Overexpression Vectors of BnDHAR3

[0014] The full-length CDS sequence of the cloned BnDHAR3 gene was ligated to the plant overexpression vector pCAMBIA1305 and named the recombinant vector pCAMBIA1305-BnDHAR3. The recombinant vector pCAMBIA1305-BnDHAR3 was transformed into Escherichia coli and, after sequencing verification, was transformed into Agrobacterium tumefaciens strain GV3101.

[0015] 4. Genetic Transformation and Oil Content Analysis of Rapeseed

[0016] The rapeseed variety Zhongshuang No. 6 was transformed by Agrobacterium-mediated rapeseed petiole infection. After antibiotic screening, homozygous T3 generation transgenic rapeseed was obtained. The seeds of transgenic rapeseed were collected and the oil content was determined.

[0017] The experimental results showed that after using genetic engineering technology to increase the expression level of the rapeseed BnDHAR3 gene, the oil content of transgenic rapeseed seeds increased by 6.81-11.08% compared with untransformed rapeseed.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0019] This invention is the first domestic disclosure of the role of the BnDHAR3 gene in increasing the oil content of rapeseed. This invention, for the first time, utilized comparative transcriptome data between high-oil and low-oil rapeseed materials to obtain candidate genes that affect rapeseed seed oil content. Through PCR amplification and sequence alignment, the rapeseed oil content regulatory gene BnDHAR3 was successfully isolated and cloned. The experimental results of this invention showed that after overexpressing the BnDHAR3 gene in rapeseed, the oil content of transgenic rapeseed seeds increased compared to the control (non-transgenic plants), with the highest increase in oil content exceeding 10%. This gene provides a new genetic resource for high-oil rapeseed breeding and can be used to increase rapeseed oil yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 .Expression levels of BnDHAR3 and its homologous genes in various tissues of rapeseed.

[0021] Figure 2 .BnDHAR3 expression levels between high-oil and low-oil rapeseed varieties.

[0022] Figure 3 . Schematic diagram of vector construction.

[0023] Figure 4 .Results of oil content determination of BnDHAR3 transgenic rapeseed seeds. DETAILED DESCRIPTION

[0024] Example 1: Acquisition of rapeseed oil content regulating gene BnDHAR3

[0025] First, comparative transcriptomic analysis was performed on rapeseed varieties with significantly different oil content. The team found that the expression level of the BnaA02G0065900ZS gene in 35-day-old rapeseed embryos was significantly higher in high-oil rapeseed than in low-oil rapeseed. Gene sequence alignment revealed that the gene's homolog in Arabidopsis is a dehydroascorbate reductase, DHAR3, and thus named the gene BnDHAR3. The BnDHAR3 gene has three homologous genes in rapeseed: BnaA02G0367700ZS, BnaA10G0199800ZS, and BnaC03G0065300ZS. Among them, BnaA02G0367700ZS and BnaC03G0065300ZS genes are not expressed, and BnaA10G0199800ZS tends to be expressed in tissues other than seeds. The expression levels of BnDHAR3 and its homologous genes in Zhongshuang 11 are as follows: Figure 1 As shown in Figure 2, the expression levels of BnDHAR3 (BnaA02G0065900ZS) in high and low oil materials are as follows: Figure 2 As shown. Using ZS11 rapeseed cDNA as a template, specific primers for the BnDHAR3 gene, BnDHAR3-F: 5′-ATGATAAGACTGAGGTTTCA-3′ (SEQ ID NO. 3) and BnDHAR3-R: 5′-TCAGGCCATCACCTTCGGTC-3′ (SEQ ID NO. 4), were designed for PCR amplification. The PCR amplification system consisted of 25 μL of 2× Mix buffer, 2 μL of BnDHAR3-F, 2 μL of BnDHAR3-R, 1 μL of cDNA, and 20 μL of ddH2O. The PCR amplification procedure was as follows: pre-denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s; extension at 72°C for 10 min; and final storage at 4°C. The PCR product was verified by sequencing and sequence alignment, yielding the full-length CDS of the BnDHAR3 gene.

[0026] Example 2: Cloning of rapeseed oil content regulatory gene BnDHAR3 and construction of plant overexpression vector

[0027] Match the backbone vector, and design recombination primers 35S::BnDHAR3-F: 5′-ggacagcccagatcaactagt ATGATAAGACTGAGGTTTCA-3′ (sequence ggacagcccagatcaactagt is the upstream sequence of the SpeI restriction site of the pCAMBIA1305 vector) and 35S::BnDHAR3-R: 5′-gcccttgctcaccatggatcc TCAGGCCATCACCTTCGGTC-3′ (sequence gcccttgctcaccatggatcc is the downstream sequence of the BamH I restriction site of the pCAMBIA1305 vector) at the recombination sites on both ends of the restriction site. Use the cDNA of ZS11 rapeseed as a template to amplify the obtained PCR product, purify it with a PCR product purification kit, and store it for future use. The plant overexpression vector pCAMBIA1305 was double-digested with SpeI and BamH I restriction endonucleases, detected by 1% agarose gel electrophoresis, and recovered using a gel recovery kit and stored for future use.

[0028] The PCR-purified product of the BnDHAR3 gene and the recovered restriction-digested plasmid were recombined using a ligase-independent single-fragment rapid cloning kit. The reaction system consisted of 4 μL of 5×CE II Buffer, 2 μL of Exnase II, 50–200 ng of the linearized vector, 10–200 ng of the insert, and ddH2O to a volume of 20 μL. The recombinant product was transformed into competent E. coli DH5α cells and incubated upside down at 37°C for 12–16 hours. Single colonies that emerged were detected by PCR using the upstream primer 35S: 5′-GACGCACAATCCCACTATCC-3′ and the downstream primer NOS: 5′-GATAATCATCGCAAGACCGG-3′. Single colonies that tested positive by PCR were sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. Analysis revealed the full-length CDS of the BnDHAR3 gene, with the nucleotide sequence shown in SEQ ID NO. 1 and the encoded amino acid sequence shown in SEQ ID NO. 2. The expression vector plasmid of the positive single colony with correct sequencing was extracted and the plasmid was the recombinant plasmid pCAMBIA1305-BnDHAR3 (the vector construction diagram is shown in FIG. Figure 3 shown).

[0029] Example 3: Agrobacterium transformation of rapeseed oil content regulating gene BnDHAR3

[0030] 1. Agrobacterium Transformation

[0031] (1) Thaw the competent cells of Agrobacterium tumefaciens GV3101 stored at -80°C to an ice-water mixture at room temperature and place them on ice.

[0032] (2) Use a pipette to draw about 100 ng of the pCAMBIA1305-BnDHAR3 recombinant plasmid and add it to the GV3101 competent cells. Place them on ice for 5 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min.

[0033] (3) Then, add approximately 700 mL of LB liquid medium (10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl) and incubate at 28°C in a shaker at 200 rpm for 2–3 h.

[0034] (4) The bacterial solution was spread on LB solid medium supplemented with 50 mg / L kanamycin (Kan), 50 mg / L gentamicin (Gent), and 50 mg / L rifampicin (Rif), and cultured in an inverted incubator at 28°C for 36-48 h;

[0035] (5) PCR detection was performed on the grown Agrobacterium single clone using the upstream primer 35S: 5′-GACGCACAATCCCACTATCC-3′ and the downstream primer NOS: 5′-GATAATCATCGCAAGACCGG-3′ of the plant expression vector. The positive single clone was shaken to OD 600 =1.8-2.0, and then preserve the bacteria in 50% glycerol and store in a -80°C ultra-low temperature freezer for later use.

[0036] 2. Preparation of Agrobacterium suspension carrying the BnDHAR3 target gene:

[0037] (1) Inoculate the Agrobacterium carrying the target gene in 200 mL of LB liquid medium (containing 50 mg / L Kan, 50 mg / L Gent, and 50 mg / L R-Lif) at a ratio of 1:100 (volume ratio) and culture in a shaking incubator at 28°C and 200 rpm until the OD 600 The value is about 0.6;

[0038] (2) Place the bacterial solution in a high-speed centrifuge and centrifuge at 8000 rpm for 15 min. Discard the supernatant and collect the bacterial cells.

[0039] (3) Resuspend the Agrobacterium cells in a resuspension solution (5% sucrose and 0.02% surfactant L-77) to an OD of 600 The concentration is about 1.0, which is used to prepare Agrobacterium suspension for subsequent plant transformation.

[0040] Example 4: Transformation and Identification Screening of Rapeseed Overexpressing BnDHAR3

[0041] 1. Transformation of rapeseed using the cotyledon petiole infection method. The specific steps are as follows:

[0042] (1) After soaking and disinfecting Zhongshuang No. 6 rapeseed seeds in 70% ethanol solution for 1 minute, adding mercuric chloride (HgCl2) solution and soaking and disinfecting for 13-15 minutes, washing with sterile water 5 times, and then spreading them on MS culture medium to obtain rapeseed sterile seedlings for use;

[0043] (2) Take the cotyledon petioles of 4-5 day old sterile seedlings and soak them in the above Agrobacterium suspension for 5-8 minutes, gently shaking them. Then pour off the bacterial suspension and remove the residual bacterial suspension on the explants by aspirating. Place the transformed cotyledon petioles on a co-culture medium (containing 0.2 mg / L 6-benzyladenine (6-BA), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 200 μM acetosyringone) and culture for 2-3 days.

[0044] (3) The co-cultured explants were transferred to a differentiation medium containing penicillin (Car) and sterilized and differentiated in a dark greenhouse for 5-7 days; then, the explants were transferred to a selection medium supplemented with Kan (containing 3 mg / L 6-BA, 0.1 mg / L α-naphthylacetic acid (NAA), 5 mg / L silver nitrate (AgNO3), 400 mg / L Car, and 15 mg / L Kan) for selection, and regenerated green shoots were differentiated from the explants;

[0045] (4) When the regenerated buds grew to 1 cm, they were cut and transferred to rooting medium (containing 0.2 mg / L NAA, 10 mg / L Kan, and 400 mg / L Car) for screening;

[0046] (5) After the transformed seedlings have taken root and grown leaves, DNA is extracted from the transformed seedlings and identified by PCR;

[0047] (6) The positive seedlings identified by PCR were transplanted into nutrient pots in an artificial climate chamber for growth. After the seeds matured, the individual plants were harvested to obtain T1 generation transgenic rapeseed seeds.

[0048] 2. Use hygromycin to screen homozygous positive transgenic rapeseed plants. The specific steps are as follows:

[0049] (1) Referring to the experimental steps for the above-mentioned sterile rapeseed seedlings, the T1 generation transgenic rapeseed seeds were disinfected;

[0050] (2) Spread the sterilized seeds on MS solid medium containing 25 mg / L hygromycin, culture them in the dark in an incubator for about 5 days, and then switch to culture under normal light;

[0051] (3) When two true leaves grow, transplant the positive seedlings into nutrient pots in the artificial climate chamber;

[0052] (4) After the positive transgenic rapeseed seeds mature, harvest the seeds individually and store them in sequence to obtain T2 generation transgenic rapeseed seeds;

[0053] (5) The T2 generation transgenic rapeseed seeds were screened for hygromycin resistance according to the above experimental steps, and strains with a 3:1 ratio were isolated and transplanted into an artificial climate chamber. Individual plants were harvested and numbered and stored in sequence to obtain T3 generation transgenic rapeseed seeds;

[0054] (6) The T3 generation transgenic rapeseed seeds were screened for hygromycin resistance according to the above experimental steps, and all normally growing strains were screened out to obtain homozygous T3 generation transgenic rapeseed.

[0055] Example 5: Analysis of Oil Content in BnDHAR Transgenic Rapeseed

[0056] Three homozygous transgenic rapeseed lines were selected and their seed oil content was measured using a nuclear magnetic resonance spectroscopy. The results showed that after increasing the expression of the BnDHAR3 gene through genetic engineering technology, the oil content of rapeseed seeds increased significantly, which can achieve an increase in rapeseed oil yield. Compared with the control plants, after overexpressing the BnDHAR3 gene, the oil content of the seeds of the three transgenic rapeseed lines increased by 6.81%, 11.08% and 9.03% respectively (as shown in Figure 2). Figure 4 shown).

Claims

1. Rapeseed BnDHAR3 The application of the gene in increasing the oil yield of rapeseed is characterized in that: described BnDHAR3 The coding sequence of the gene is shown in SEQ ID NO.

1.

2. Rapeseed BnDHAR3 The application of the gene in the breeding of high oil-yielding rapeseed is characterized in that: described BnDHAR3 The coding sequence of the gene is shown in SEQ ID NO.

1.

3. A method for increasing the oil yield of rapeseed seeds, characterized in that: Overexpression in rapeseed BnDHAR3 The coding sequence of the gene is shown in SEQ ID NO.1.

Images