A high-yield, growth-promoting, anti-browning and highly disease-resistant Agaricus bisporus strain, gene, vector, method and application
By constructing the AbMYB11 overexpression vector in Agaricus bisporus and performing gene transformation, the shortcomings of Agaricus bisporus in disease resistance, growth promotion and browning resistance were solved, and the effects of high yield, growth promotion and browning resistance were achieved, and the market value of the bacterial species was enhanced.
Patent Information
- Application Number
- CN202411818000.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-11
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2044-12-11
AI Technical Summary
The existing Agaricus bisporus species have shortcomings in disease resistance, growth promotion and browning resistance, resulting in low yield, long growth cycle and reduced market value.
By constructing the AbMYB11 overexpression vector, it was transformed into Agrobacterium bisporus by using Agrobacterium mediation method to achieve overexpression of the AbMYB11 gene, enhancing the disease resistance of the bacterial species, promoting growth, and reducing browning.
It significantly improves the yield and disease resistance of Agaricus bisporus, shortens the growth cycle, enhances the anti-browning ability, and enhances the market competitiveness and economic benefits of bacteria.
Smart Images

Figure CN119592604B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of genetic engineering and edible mushroom breeding technology, and in particular relates to an Agaricus bisporus strain, gene, vector, method and application with high yield, growth promotion, anti-browning and strong disease resistance. Background Art
[0002] Agaricus bisporus is one of the widely cultivated edible mushrooms in the world, containing rich nutritional value, being a high-quality source of plant protein, containing various vitamins, and also being able to prevent rickets in children and osteoporosis in adults, promote the growth of beneficial bacteria in the intestine, and can reduce cholesterol absorption, which is beneficial to cardiovascular health. China is a major producer and consumer of Agaricus bisporus, and the edible mushroom industry occupies an important position in the development of China's agriculture and rural economy. With the improvement of people's living standards and the attention to healthy diet, the market demand for Agaricus bisporus is continuously increasing.
[0003] After harvest, Agaricus bisporus is extremely prone to browning due to physiological metabolism and mechanical abrasion and other reasons. Browning will cause the color of Agaricus bisporus to change, reducing the visual quality of the product, making consumers think it is not fresh and of poor quality, thus reducing consumers' willingness to buy and affecting the sales of the product. At the same time, the occurrence of browning means that the physiological state of Agaricus bisporus has changed, shortening its shelf life. In order to reduce the browning of Agaricus bisporus, a series of preservation measures need to be taken, such as low-temperature refrigeration, modified atmosphere packaging, using preservatives, etc., which increases the production cost.
[0004] More remarkable progress has been made in the breeding of Agaricus bisporus strains abroad. Some developed countries have established a perfect strain breeding system, and through advanced biotechnology means, they have cultivated Agaricus bisporus strains with various excellent traits such as high yield, high quality, disease resistance, and stress resistance. These strains have performed excellently in the process of popularization and application, significantly improving the yield and quality of Agaricus bisporus. In addition, foreign strain production units are large in scale and advanced in technology, and can produce high-quality strains, providing a strong guarantee for the development of the Agaricus bisporus industry, but foreign strains are high in price and short in service life.
[0005] In the field of Agaricus bisporus strain breeding, domestic scientific research personnel have successfully cultivated a series of high-yield, high-quality, disease-resistant Agaricus bisporus strains through advanced means such as genetic engineering and mutagenesis breeding. Although these achievements have promoted the development of the edible mushroom industry to a certain extent, in practical applications, these strains still face some problems that need to be solved urgently:
[0006] Limited disease resistance: Although some strains show certain disease resistance, when faced with specific pathogens such as severe diseases like Agaricus bisporus brown blotch disease, the existing strains often fail to provide effective resistance. This not only limits the growth and development of the strains but may also lead to the failure of the entire cultivation cycle, causing economic losses to farmers.
[0007] Insignificant growth promotion effect: The existing Agaricus bisporus strains perform mediocrely in growth promotion, lacking an effective growth stimulation mechanism, resulting in a long growth cycle and slow growth rate, which affects the overall yield and economic benefits.
[0008] Limited anti-browning effect: The performance of existing Agaricus bisporus strains in anti-browning is not ideal. Agaricus bisporus is prone to browning caused by the oxidation of enzymatic phenolic compounds after harvest, and its shelf life at room temperature is usually only 1 - 3 days. This browning phenomenon seriously affects the market value and consumer acceptance of Agaricus bisporus.
[0009] To address the above problems, through innovative directed molecular modification technology, the present invention has successfully cultivated an Agaricus bisporus strain with high yield, growth promotion, anti-browning, and strong disease resistance. This strain not only shows excellent environmental adaptability, being able to maintain stable growth and high output under variable climate conditions, but also has a significant improvement in disease resistance, being able to effectively resist major diseases such as Agaricus bisporus brown blotch disease. In addition, the strain of the present invention also has the characteristic of promoting growth, being able to shorten the growth cycle and increase the growth rate, thus significantly improving the yield and economic benefits. These characteristics make the strain of the present invention have broad application prospects and market competitiveness in the edible mushroom industry.
[0010] After retrieval, the present invention has not been publicly reported at home and abroad and has not been publicly used at home and abroad. Summary of the Invention
[0011] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an Agaricus bisporus strain, gene, vector, method, and application with high yield, growth promotion, anti-browning, and strong disease resistance.
[0012] The technical solution adopted by the present invention to solve its technical problems is:
[0013] Application of an AbMYB11 gene in improving the yield of Agaricus bisporus, wherein the accession number of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as hypothetical protein in the NCBI database.
[0014] Application of AbMYB11 gene in promoting growth, resisting browning and enhancing disease resistance of Agaricus bisporus. The accession number of the sequence of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as hypothetical protein in the NCBI database.
[0015] An Agaricus bisporus AbMYB11 overexpression vector with high yield, growth promotion, browning resistance and strong disease resistance. The overexpression vector is constructed by ligating AbMYB11 with the pCAMBIA1303 vector to form a complete plasmid, and then verified by enzyme digestion and sequencing to obtain the correct plasmid.
[0016] Among them, the accession number of the sequence of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as hypothetical protein in the NCBI database.
[0017] Application of the above-mentioned AbMYB11 overexpression vector in promoting growth, resisting browning and enhancing disease resistance of Agaricus bisporus.
[0018] An Agaricus bisporus strain with high yield, growth promotion, browning resistance and strong disease resistance, containing the above-mentioned AbMYB11 overexpression vector.
[0019] Construction method of the above-mentioned Agaricus bisporus strain. When constructing, Agrobacterium-mediated transformation is used to transfer foreign genes into Agaricus bisporus.
[0020] Furthermore, it includes the following steps:
[0021] Construction of AbMYB11 overexpression vector: First, analyze the map of the pCAMBIA1303 vector, and replace the CaMV35S promoter with the AbGPD promoter, named pCAMBIA1303, to obtain the required empty vector; then overexpress the AbMYB11 gene and ligate it with the empty vector. After verification by enzyme digestion and sequencing analysis is correct,
[0022] pCAMBIA1303-AbMYB11-OE, that is, the AbMYB11 overexpression vector is obtained.
[0023] Transfer the ligated plasmid into Agrobacterium and infect Agaricus bisporus. After screening by resistance and measuring the expression level of the AbMYB11 gene; select the target strain for fruiting test, and measure the browning resistance and disease resistance of the Agaricus bisporus fruit bodies grown. Finally, preserve the target strain containing the overexpressed AbMYB11 gene and with good growth to obtain the Agaricus bisporus strain.
[0024] Furthermore, the screening includes two steps: primary screening and secondary screening. Strains with better-growing hyphae in the hygromycin-containing medium are selected as the target strains; the RNA of the target strains is extracted, and the expression level of the AbMYB11 gene is determined.
[0025] Furthermore, the two steps of primary screening and secondary screening are specifically as follows: Transfer the transformed tissue blocks to the primary screening MMP medium and culture them at 24 °C for 2 weeks; Pick the newly grown hyphae and transplant them to the secondary screening MMP medium and culture them at 24 °C for 2 weeks;
[0026] Among them, the formula of the primary screening MMP medium is: Weigh 10.0 g of maltextract (malt extract), 5.0 g of mycological peptone (fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid), dissolve them thoroughly with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L; The final concentration of antibiotics is: 30 μg / mL of hygromycin B, 200 μM of cefotaxime, 20 μg / mL of rifampicin, 50 μg / mL of kanamycin and ampicillin;
[0027] In the following examples, the formula of the secondary screening MMP medium is: Weigh 10.0 g of maltextract (malt extract), 5.0 g of mycological peptone (fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid), dissolve them thoroughly with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L; The final concentration of antibiotics is: 50 μg / mL of hygromycin B, 17 μg / mL of tetracycline hydrochloride, 50 μg / mL of kanamycin and ampicillin.
[0028] The advantages and positive effects achieved by the present invention are as follows:
[0029] 1. The present invention constructs and studies the disease resistance characteristics of Agaricus bisporus materials with overexpression and silencing of AbMYB11, verifying that the AbMYB11 gene can be well expressed on the pCAMBIA1303 vector.
[0030] 2. The ligated pCAMBIA1303-AbMYB11-OE and pCAMBIA1303-AbMYB11-RNAi plasmids of the present invention can be well expressed under resistance conditions and can be transformed on Agaricus bisporus.
[0031] 3. Characteristics of the overexpressed AbMYB11 Agaricus bisporus strains:
[0032] (1) Hyphal growth: In the PDA medium, compared with the wild type, the overexpression shows dense growth.
[0033] (2) Growth situation of Agaricus bisporus: In the fruiting experiment, compared with the wild type, the overexpression strain had a faster growth rate, higher yield, stronger resistance to browning and diseases.
[0034] 4. The obtained strains of the present invention can be preserved and can be used in actual production, improving the planting quality and production value of Agaricus bisporus, and are used for optimizing the disease resistance of Agaricus bisporus. Therefore, the research on these strains has important practical significance for improving the quality of Agaricus bisporus.
[0035] 5. The present invention uses gene modification in Agaricus bisporus to improve disease resistance, preparing for industrial production.
[0036] 6. The present invention explores that the development process of fruiting bodies is regulated by multiple genes. Among them, the MYB gene may participate in regulating multiple processes such as cell morphogenesis, tissue differentiation, and reproductive development during the development of Agaricus bisporus fruiting bodies. After overexpression of the MYB gene in Agaricus bisporus, it can improve the resistance of mushrooms to the environment during growth, delay the occurrence of browning, and promote the growth of mushrooms, thereby achieving the purpose of increasing yield.
[0037] 7. The present invention conducts research at the gene level, improves the resistance quality of Agaricus bisporus and alleviates the shortage of market supply, providing a strain of Agaricus bisporus with growth promotion, anti-browning, and strong disease resistance to solve problems such as easy browning and low yield of Agaricus bisporus.
[0038] 8. The present invention constructs AbMYB11 overexpression and silencing transgenic materials: Using the pCAMBIA1303 expression vector to construct AbMYB11 overexpression and silencing vectors; on this basis, adopting the Agrobacterium-mediated transformation method, transferring the two constructed vectors into Agaricus bisporus, screening transformants with hygromycin resistance, and analyzing the gene expression level of AbMYB11 in the resistant transformants to obtain Agaricus bisporus materials with AbMYB11 overexpression and silencing, and measuring the anti-browning ability and disease resistance of Agaricus bisporus with AbMYB11 overexpression and silencing. Brief Description of the Drawings
[0039] Figure 1 is a technical roadmap of the method of the present invention;
[0040] Figure 2 is the predicted map of the construction of the AbMYB11 overexpression vector pCAMBIA1303-AbMYBI1-OE of the present invention;
[0041] Figure 3This is the construction result diagram of pCAMBIA1303-AbMYBI1-OE in the present invention; among them, A is the cloning of the AbMYB11 gene in the present invention, and B is the double digestion verification of the AbMYB11 overexpression vector, that is, the recombinant plasmid pCAMBIA1303-AbMYB11-OE; Ml: 2K Plus DNA Marker; M2: 1Kb DNA Marker; 1: PCR amplification product of AbMYBI1; 2: Double digestion verification of pCAMBIA1303-AbMYB11-0E with BglⅡ and BstEⅡ; C is the sequencing result comparison diagram of pCAMBIA1303-AbMYBI1-OE;
[0042] Figure 4 This is the predicted map of the construction of the AbMYB11 silencing vector, that is, pCAMBIA1303-AbMYBII-RNAi, in the present invention;
[0043] Figure 5 This is the construction result diagram of pCAMBIA1303-AbMYBII-RNAi in the present invention; among them, A is the cloning of the AbMYB11-Sense and AbMYB11-Antisense genes in the present invention, and B is the double digestion verification of the AbMYB11 silencing vector, that is, the recombinant plasmid pCAMBIA1303-AbMYB11-RNAi; M1: 2K DNA Marker; M2: 1Kb DNA Marker; 1: PCR amplification product of AbMYB11-Sense; 2: PCR amplification product of AbMYB11-Antisense; 3: Double digestion verification of pCAMBIA1303-AbMYB11-RNAi with XhoI and BstEⅡ; C is the sequencing result comparison diagram of pCAMBIA1303-AbMYBII-RNAi;
[0044] Figure 6 This is the growth situation diagram of the transformants on the MMP medium (A) containing 30 μg / L hygromycin for primary screening and the MMP medium (B) containing 50 μg / L hygromycin for secondary screening after Agrobacterium tumefaciens infects the gills of Agaricus bisporus in the present invention;
[0045] Figure 7 This is the data diagram of the AbMYB11 gene expression levels of the overexpression type, silencing type and wild-type hyphae in the present invention;
[0046] Figure 8 This is the growth situation diagram of the wild-type, overexpression and silencing genotype strains on the PDA medium in the present invention;
[0047] Figure 9 This is the growth situation diagram of the hyphae of different strains on the wheat grain medium in the present invention;
[0048] Figure 10 Growth situation diagram of Agaricus bisporus for the fruiting experiment in the present invention;
[0049] Figure 11 Yield statistical chart of the first and second flushes of mushrooms in the present invention;
[0050] Figure 12 Growth situation diagram of Agaricus bisporus on the 46th and 47th days after sowing in the present invention;
[0051] Figure 13 Anti-browning ability diagram of Agaricus bisporus in the present invention;
[0052] Figure 14 Disease resistance ability diagram of Agaricus bisporus in the present invention.
[0053] Figure 15 Incidence rate diagram of Agaricus bisporus in the present invention.
[0054] In the above pictures: for convenient recording, the present invention uses random letters and numbers for numbering, but they correspond one by one to the genotype naming names. In the pictures, YH26 represents the wild type, HF41 represents OE-AbMYB11-78, and JS59 represents OE-AbMYB11-91. BK58 represents RNAi-AbMYB11-96, and JD97 represents RNAi-AbMYB11-97. Detailed implementation manners
[0055] The following further illustrates the present invention in conjunction with embodiments. The following embodiments are narrative and not restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.
[0056] All kinds of experimental operations involved in the specific embodiments are conventional techniques in the art. For the parts not specifically annotated in this article, those of ordinary skill in the art can refer to various common reference books, scientific and technological literatures, or relevant specifications, manuals, etc. before the filing date of the present invention application for implementation.
[0057] Application of an AbMYB11 gene in increasing the yield of Agaricus bisporus, wherein the accession number of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as hypothetical protein in the NCBI database.
[0058] Application of an AbMYB11 gene in promoting the growth, anti-browning, and enhancing disease resistance ability of Agaricus bisporus, wherein the sequence of the AbMYB11 gene has an accession number in the NCBI database: XM_006459610.1, and it is marked as hypothetical protein in the NCBI database.
[0059] An overexpression vector of Agaricus bisporus AbMYB11 with high yield promotion, growth promotion, anti-browning and strong disease resistance. The overexpression vector is constructed by ligating AbMYB11 with the pCAMBIA1303 vector into a complete plasmid, and verified by restriction enzyme digestion and sequencing to obtain the correct plasmid.
[0060] Among them, the sequence of the AbMYB11 gene has the accession number: XM_006459610.1 in the NCBI database and is marked as hypothetical protein in the NCBI database.
[0061] Application of the above-mentioned AbMYB11 overexpression vector in promoting the growth, anti-browning and enhancing disease resistance of Agaricus bisporus.
[0062] A strain of Agaricus bisporus with high yield, growth promotion, anti-browning and strong disease resistance containing the above-mentioned AbMYB11 overexpression vector.
[0063] Construction method of the above-mentioned Agaricus bisporus strain. When constructing, Agrobacterium-mediated transformation is used to transform foreign genes into Agaricus bisporus.
[0064] Preferably, it includes the following steps:
[0065] Construction of the AbMYB11 overexpression vector: First, analyze the map of the pCAMBIA1303 vector, replace the CaMV35S promoter with the AbGPD promoter, name it pCAMBIA1303, and obtain the required empty vector; then overexpress the AbMYB11 gene and ligate it with the empty vector. After verification by restriction enzyme digestion and sequencing analysis,
[0066] pCAMBIA1303-AbMYB11-OE, that is, the AbMYB11 overexpression vector, is obtained.
[0067] Transfer the ligated plasmid into Agrobacterium and infect Agaricus bisporus. After screening by resistance and measuring the expression level of the AbMYB11 gene; select the target strain for fruiting test, and measure the anti-browning ability and disease resistance of the Agaricus bisporus fruit bodies grown. Finally, preserve the target strain containing the overexpressed AbMYB11 gene and with good growth to obtain the Agaricus bisporus strain.
[0068] Preferably, the screening includes two steps: primary screening and secondary screening. Select the strain with better growing hyphae in the hygromycin-containing medium as the target strain; extract the RNA of the target strain and measure the expression level of the AbMYB11 gene.
[0069] Preferably, the two steps of primary screening and secondary screening are specifically as follows: Transfer the transformed tissue blocks to the primary screening MMP medium and culture them at 24 °C for 2 weeks; Pick the newly grown mycelia and transplant them to the secondary screening MMP medium and culture them at 24 °C for 2 weeks;
[0070] Among them, the formula of the primary screening MMP medium is: Weigh 10.0 g of maltextract (malt extract), 5.0 g of mycological peptone (fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid), dissolve them fully with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L; The final concentrations of antibiotics are: 30 μg / mL of hygromycin B, 200 μM of cefotaxime, 20 μg / mL of rifampicin, 50 μg / mL of kanamycin and ampicillin;
[0071] In the following examples, the formula of the secondary screening MMP medium is: Weigh 10.0 g of maltextract (malt extract), 5.0 g of mycological peptone (fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid), dissolve them fully with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L; The final concentrations of antibiotics are: 50 μg / mL of hygromycin B, 17 μg / mL of tetracycline hydrochloride, 50 μg / mL of kanamycin and ampicillin.
[0072] Specifically, the related preparation and detection are as follows:
[0073] In the following examples, the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.
[0074] In the following quantitative experiments of the examples, unless otherwise specified, three repeated experiments are set up.
[0075] The raw material Agaricus bisporus fruit body "W192" used in the experiment was collected from Xingtai City, Hebei Province.
[0076] The vector provided by the present invention is of the pCAMBIA1303 type. According to the map research, the CaMV35S promoter is replaced with the AbGPD promoter and named pCAMBIA1303 to ensure better expression of the AbMYB11 gene in Agaricus bisporus. However, other vectors or other promoters of this vector can also be replaced for experiments. Its technical roadmap is as Figure 1 shown.
[0077] The overexpression vector pCAMBIA1303-AbMYB11-OE (AbMYB11 overexpression vector) in the following examples was constructed according to the method of Example 1.
[0078] It was constructed with the overexpression vector pCAMBIA1303-AbMYB11-RNAi (AbMYB11 silencing vector) in the following examples, and constructed according to the method of Example 2.
[0079] The following pCAMBIA1303 vector was subjected to map analysis of the pCAMBIA1303 vector, and the CaMV35S promoter was replaced with the AbGPD promoter, and it was named pCAMBIA1303. The public can obtain this biological material from the applicant, and this biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.
[0080] In the following examples, each primer was designed according to the seamless cloning principle, and primer synthesis and sequencing were completed by Genewiz (Suzhou) Inc., and the specific sequences are shown in Table 1 below.
[0081]
[0082] The specific information of the strains used in the present invention is shown in Table 2.
[0083] Table 2 Strains and plasmids used in the present invention
[0084] Strain Name Description Source DH5α Competent Cells Transformation of Recombinant Products TransGen Biotech Co., Ltd. EHA105 Competent Cells Transformation of Agrobacterium Shanghai Vidy Biotechnology Co., Ltd.
[0085] In the following examples, LB medium: Weigh 5.0 g of yeast extract, 10.0 g of tryptone, and 10.0 g of NaCl respectively, dissolve them thoroughly with distilled water, adjust the pH to 7.0, and make up the volume to 1.0 L.
[0086] In the following examples, minimal medium (MM): Take 10 mL of K-buffer (262 g / L dipotassium hydrogen phosphate, 145 g / L potassium dihydrogen phosphate, adjust the pH to 7.0), 20 mL of M-N (30 g / L magnesium sulfate, 15 g / L sodium chloride), 1 mL of calcium chloride with a mass concentration of 0.75%, 10 mL of 21.8% glucose (w / v, mass concentration), 10 mL of 0.018% ferrous sulfate (w / v, mass concentration), 5 mL of Spore Elements (100 mg / L zinc sulfate heptahydrate, 100 mg / L copper sulfate, 100 mg / L boric acid, 100 mg / L manganese sulfate, 100 mg / L sodium molybdate) and 2.5 mL of ammonium nitrate with a mass concentration of 20%, and make up the volume to 1.0 L with ddH2O. The above percentages are all mass percentages, and the solvent is water.
[0087] In the following examples, the induction medium (IM): Take 10 mL of K-buffer (262 g / L dipotassium hydrogen phosphate, 145 g / L potassium dihydrogen phosphate, adjust the pH to 7.0), 20 mL of M-N (30 g / L magnesium sulfate, 15 g / L sodium chloride), 1 mL of calcium chloride with a mass concentration of 1%, 10 mL of ferrous sulfate with a mass concentration of 0.01% (w / v, mass concentration), 5 mL of Spore Elements (100 mg / L zinc sulfate, 100 mg / L copper sulfate, 100 mg / L boric acid, 100 mg / L manganese sulfate, 100 mg / L sodium molybdate), 10 mL of glycerol with a volume concentration of 50%, 40 mL of 1 mol / L MES (adjust the pH to 5.3), 5 mL of 2 mol / L glucose, 2 mL of 100 mmol / L acetosyringone, and 2.5 mL of sodium nitrate with a mass concentration of 20%, and make up the volume to 1.0 L with ddH2O. The above percentages are all mass percentages, and the solvent is water in all cases.
[0088] In the following examples, the co-culture medium (CM): Take 10 mL of K-buffer (262 g / L dipotassium hydrogen phosphate, 145 g / L potassium dihydrogen phosphate, adjust the pH to 7.0), 20 mL of M-N (30 g / L magnesium sulfate, 15 g / L sodium chloride), 1 mL of calcium chloride with a mass concentration of 1%, 10 mL of ferrous sulfate with a mass concentration of 0.01% (w / v, mass concentration), 5 mL of Spore Elements (100 mg / L zinc sulfate, 100 mg / L copper sulfate, 100 mg / L boric acid, 100 mg / L manganese sulfate, 100 mg / L sodium molybdate), 10 mL of glycerol with a volume concentration of 50%, 40 mL of 1 mol / L MES (adjust the pH to 5.3), 2.5 mL of 2 mol / L glucose, 2 mL of 100 mmol / L acetosyringone, and 2.5 mL of sodium nitrate with a mass concentration of 20%, make up the volume to 1 L with ddH2O, and add 1.5% agar. The above percentages are all mass percentages, and the solvent is water in all cases.
[0089] In the following examples, the PDA medium: Weigh 200 g of fresh potatoes, heat and boil them in distilled water for 30 min, then filter them through four layers of gauze. Then weigh 20 g of glucose and 15 g of agar respectively, dissolve them fully in distilled water and make up the volume to 1 L.
[0090] In the following examples, the wheat grain medium: Wash the wheat grains, remove the sediment and broken grains, soak them in clean water for 5 - 8 h, then boil them until there is no white core in the grains, take them out, spread them out to dry the surface moisture, mix in 1% calcium carbonate by mass percentage and put them into the culture bottles for bacteria.
[0091] In the following examples, the primary screening MMP medium: Weigh 10.0 g of malt extract (i.e., malt extract), 5.0 g of mycological peptone (i.e., fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid) respectively, dissolve them thoroughly with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L. The final concentration of antibiotics (30 μg / mL of hygromycin B, 200 μM of cefotaxime, 20 μg / mL of rifampicin, 50 μg / mL of kanamycin and ampicillin).
[0092] In the following examples, the secondary screening MMP medium: Weigh 10.0 g of maltextract (i.e., malt extract), 5.0 g of mycological peptone (i.e., fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid) respectively, dissolve them thoroughly with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L. The final concentration of antibiotics (50 μg / mL of hygromycin B, 17 μg / mL of tetracycline hydrochloride, 50 μg / mL of kanamycin and ampicillin).
[0093] To better understand the present invention, the present invention will be further described in detail below in conjunction with embodiments. However, the scope of protection required by the present invention is not limited to the scope shown in the embodiments.
[0094] The raw materials used in the present invention are all conventional commercially available products without special instructions. The methods used in the present invention are all conventional methods in the art without special instructions. The masses of various substances used in the present invention are all conventional usage masses.
[0095] Example 1. Construction of the overexpression vector pCAMBIA1303-AbMYB11-OE
[0096] 1. Cloning of the AbMYB11 gene
[0097] According to the CDS region of AbMYB11 in the NCBI database and in combination with the pCAMBIA1303 vector map, specific primers for AbMYB11 were designed, and BglⅡ and BstEⅡ restriction enzyme sites were added respectively. The predicted map is shown in Figure 2 . The accession number of the AbMYB11 gene sequence in the NCBI database is: XM_006459610.1, and it is marked as hypothetical protein in the NCBI database.
[0098] The primer sequences are as follows (the BglⅡ and BstEⅡ restriction enzyme sites are underlined):
[0099] pCAMBIA1303-AbMYB11-OE-F:
[0100] 5'AACAAGCTCATCGCC AGATCT ATGCTCTGCAGAGAACGCC3'
[0101] pCAMBIA1303 - AbMYB11 - OE - R:
[0102] 5'CGGGGAAATTCGAGCT GGTCACC CTAGAAAATGTAAGCGAGCTCATTC3'
[0103] PCR amplification was performed with the following program: 95°C for 5 min, 35 cycles (95°C for 30 sec, 55°C for 30 sec, and 72°C for 2 min), 72°C for 10 min, 4°C ∞. After the reaction, the PCR amplification products were detected by 0.8% agarose gel electrophoresis. The agarose gel detection results showed that PCR products with the expected fragment size (1167 bp) were obtained. The PCR products with the correct band size were recovered using a gel extraction kit. The successfully amplified AbMYB11 products are shown in Figure 3 A.
[0104] 2. Ligation of pCAMBIA1303 - AbMYB11 - OE vector
[0105] 2.1 Vector treatment
[0106] According to the pCAMBIA1303 vector map, the pCAMBIA1303 vector was double - digested with the restriction endonucleases BglⅡ and BstEⅡ. After the reaction, the double - digested products were detected by 0.8% agarose gel electrophoresis, and the correct bands were recovered using a gel extraction kit.
[0107] 2.2 Gene and vector ligation (seamless cloning)
[0108] The correctly gel - recovered double - digested products and the PCR amplification products of AbMYB11 were ligated by seamless cloning using the ClonExpress II OneStep Cloning Kit to construct the pCAMBIA1303 - AbMYB11 - OE vector.
[0109] 2.3 Transformation and culture of recombinant products
[0110] According to the DH5α cloning competent cell instruction manual, the recombinant products were transferred into competent cells for culture.
[0111] 2.4 Enzyme digestion verification and sequencing
[0112] Extract the plasmid according to the plasmid miniprep kit instructions and verify the recombinant plasmid by double digestion with BglⅡ and BstEⅡ. The digestion results are shown in Figure 3 B. The results of agarose gel detection showed that two gene fragments with sizes of about 1200 bp and 9000 bp were obtained, which were consistent with the expected sizes, indicating that the target gene was successfully ligated to the vector. The plasmid verified correctly by double digestion was sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing. The results showed that the identity was 100%. The plasmid with correct sequencing was named pCAMBIA1303-AbMYB11-OE. The sequencing alignment results are shown in Figure 3 C.
[0113] Example 2. Construction of the silencing vector pCAMBIA1303-AbMYB11-RNAi
[0114] 1. Cloning of AbMYB11-Sense and AbMYB11-Antisense genes
[0115] According to a segment of exon and intron of AbMYB11 in the genomic DNA of Agaricus bisporus (NW_006267366.1) in the NCBI database, specific primers for AbMYB11-Sense and AbMYB11-Antisense were designed, and BglⅡ and BstEⅡ restriction enzyme sites were added respectively in combination with the pCAMBIA1303 vector map. The predicted map is shown in Figure 4 . The primer sequences are as follows (the BglⅡ and BstEⅡ restriction enzyme sites are underlined):
[0116] AbMYB11-Sense-F:
[0117] 5'AACAAGCTCATCGCC AGATCT AGGATCCCGAGAACCCAAAC3'
[0118] AbMYB11-Sense-R:
[0119] 5'CTGTTGTCGGAGGTTAGGAACTG3'
[0120] AbMYB11-Antisense-F:
[0121] 5'AACCTCCGACAACAGCTTGTTCCATATCGTTCGATTCC3'
[0122] AbMYB11-Antisense-R:
[0123] 5'CGGGGAAATTCGAGCT GGTCACCAGGATCCCGAGAACCCAAAC3'
[0124] Perform PCR amplification with the program of 95°C for 5 min, 30 cycles (95°C for 30 sec, 55°C for 30 sec, and 72°C for 20 sec), 72°C for 10 min, and 4°C ∞. After the reaction, detect the PCR amplification products by 0.8% agarose gel electrophoresis. The agarose gel detection results show that PCR products with the expected fragment sizes (181 bp and 267 bp) are obtained. And use a gel extraction kit to extract the PCR products with the correct band size. The successfully amplified AbMYB11-Sense and AbMYB11-Antisense are shown in Figure 5 A).
[0125] 2. Construction of recombinant vector pCAMBIA1303-AbMYB11-RNAi
[0126] The specific recombination method is the same as that shown in 2 of Example 1. See the enzyme digestion verification in Figure 5 B, and the sequencing alignment results are shown in Figure 5 C, and the results show that the consistency is 100%. The plasmid with correct sequencing is named pCAMBIA1303-AbMYB11-RNAi, which is preserved and used for subsequent experiments.
[0127] Example 3. Screening of putative transformants
[0128] 1. Chemical transformation of recombinant vector into Agrobacterium
[0129] According to the Agrobacterium competent cell instruction manual, transform pCAMBIA1303-AbMYB11-OE, pCAMBIA1303-AbMYB11-RNAi, and pCAMBIA1303 (control group) into Agrobacterium EHA105 respectively.
[0130] 2. Transformation of foreign gene into Agaricus bisporus
[0131] Pick a single colony of Agrobacterium and inoculate it into 10 mL of basic medium. Culture it at 28°C and 220 r / min until the OD 600 reaches 0.6 - 0.8. Then transfer the bacterial liquid to 50 mL to collect the bacteria, and resuspend the bacteria with 20 mL of induction medium. Then shake and culture the bacterial liquid for 3 - 6 h to induce the expression of the VIR region. After cleaning the surface of the mushroom fruiting body with intact pellicle, collect the gill tissue. Add the gill tissue to the induced Agrobacterium, perform vacuum infiltration, transfer the tissue blocks to the co-culture medium, and culture at 21°C for 4 days.
[0132] 3. Screening of transformants
[0133] Transfer the transformed tissue blocks to the primary screening MMP medium and culture them at 24 °C for about 2 weeks; pick the newly grown hyphae and transplant them to the secondary screening MMP medium, and culture them at 24 °C for about 2 weeks. The mycelia of Agaricus bisporus are sensitive to hygromycin, and low concentrations of hygromycin can inhibit the growth of mycelia. The pCAMBIA1303 vector has a corresponding hygromycin resistance gene. Therefore, the normal-growing mycelia of Agaricus bisporus after primary and secondary screening are the successfully transformed transformant mycelia, as shown in Figure 6 After the screening is completed, transfer three AbMYB11 overexpression strains, three AbMYB11-silenced strains with good growth, and one wild-type strain to the PDA medium for culture and preserve the strains. The primary screening MMP medium and the secondary screening MMP medium are prepared according to the above preparation method.
[0134] Example 4. Determination of gene expression level
[0135] After collecting the mycelia of each strain cultured on the PDA medium, perform RNA extraction and reverse transcription to determine the gene expression level of AbMYB11.
[0136] 1. RNA extraction
[0137] Weigh 0.2 g of the sample, grind it with liquid nitrogen, and immediately transfer it to a 2 mL centrifuge tube. Add 1 mL of Trizol extraction solution and 20 μL of β-mercaptoethanol, shake vigorously, and let it stand for 10 min to lyse the cells. Add 480 μL of chloroform:isoamyl alcohol (24:1, v / v, volume ratio), mix gently. At this moment, it is in an emulsion state. Then add 72 μL of absolute ethanol, mix gently and let it stand for 3 min to completely precipitate the protein. Centrifuge at 12,000 rpm at 4 °C for 15 min. Pipette 600 μL of the supernatant into a new 2 mL centrifuge tube, add 1.2 mL of absolute ethanol and 120 μL of NaAC-HAC buffer solution, mix gently, and let it stand at -20 °C for 30 min. Centrifuge at 12,000 rpm at 4 °C for 15 min and discard the supernatant. At this time, pectin precipitation can be seen. Then dissolve the precipitate with 400 μL of 75% ethanol, transfer it to a new 1.5 mL centrifuge tube. Centrifuge at 12,000 rpm at 4 °C for 15 min and discard the supernatant. After the ethanol volatilizes, add 21 μL of DEPC to dissolve the precipitate, which is the crude RNA. Use a NanoDrop instrument and nucleic acid gel electrophoresis to detect the concentration and purity of the crude RNA.
[0138] 2. cDNA synthesis and gDNA removal
[0139] Reverse transcribe the RNA according to the reverse transcription kit to obtain cDNA and store it in a -80 °C refrigerator.
[0140] 3. Determination of AbMYB11 gene expression level
[0141] The results are asFigure 7 As shown, after determining the expression level of the AbMYB11 gene by real-time fluorescence quantitative measurement, the results showed that the expression level of the AbMYB11 gene in the overexpression line OE-AbMYB11-71 was increased to 3.39 times that of the wild-type control; OE-AbMYB11-91 was increased to 2.81 times that of the wild-type; OE-AbMYB11-78 was the line with the highest increase in expression level, which was 5.35 times that of the wild-type control. The expression level of the AbMYB11 gene in the silencing line RNAi-AbMYB11-95 was reduced to 5% of the wild-type control; RNAi-AbMYB11-96 was reduced to 7% of the wild-type; RNAi-AbMYB11-97 was the line with the most significant reduction in expression level, which was 4% of the wild-type control.
[0142] Example 5: Strain production
[0143] Select OE-AbMYB11-78, AbMYB11-OE-91 and the silencing strains RNAi-AbMYB11-96, RNAi-AbMYB11-97 that have been verified for gene expression level. Inoculate them in PDA medium and incubate at a constant temperature of 24 - 25°C.
[0144] Prepare wheat grain medium according to the above method and inoculate quickly under sterile operation. Observe the growth of hyphae through the appearance of the bottle to judge the culture time and then determine the sowing time.
[0145] The growth situation is as Figure 8 Figure 9 As shown, the mycelia of Agaricus bisporus in all media showed a typical white villous appearance. However, there were significant differences in the density of mycelia with different AbMYB11 gene expression levels. The overexpression of the AbMYB11 gene significantly promoted the branching of mycelia, thus increasing the density of mycelia. The mycelia with overexpression of the AbMYB11 gene showed slightly thicker mycelium compared with the silenced mycelia, which may be due to the formation of a more dense mycelial network during the growth of overexpressed mycelia. In addition, the three-dimensional sense of the mycelia with overexpression of the AbMYB11 gene was more obvious, which may be due to the three-dimensional structure formed by the stacking of mycelia during growth. The formation of this structure is related to the key role of the AbMYB11 gene in regulating mycelial growth and morphogenesis. Morphologically, the network structure of overexpressed mycelia is more complex. Thus, it can be seen that the AbMYB11 gene is related to the function of regulating mycelial growth direction and branching pattern. The AbMYB11 gene plays an important role in the growth and development of Agaricus bisporus.
[0146] Example 6: Fruiting test
[0147] The planting areas are randomly set on the mushroom house bed frames, 1m for each area 2, manage according to the conventional cultivation method. Regularly observe the growth of different strains and take pictures for record. Different genotypes are expressed in the strains and finally need to be judged in the mushroom fruiting bodies. For convenience of record, the present invention uses random letters and numbers for numbering, but they correspond one by one to the names of the genotype names. For the overexpressed gene phenotypes, select the strains numbered HF41 (OE-AbMYB11-78) and JS59 (OE-AbMYB11-91); for the silenced gene phenotypes, select the strains numbered BK58 (RNAi-AbMYB11-96) and JD97 (RNAi-AbMYB11-97), and use the wild-type strain YH26 (pCAMBIA1303) as the control for subsequent breeding.
[0148] The fruiting test of the overexpressed and silenced Agaricus bisporus strains. For the sowing of Agaricus bisporus and on the 45th - 47th day after sowing, see Figure 10 , and the yield statistics after fruiting are shown in Figure 11 . The results show that the Agaricus bisporus strains with different AbMYB11 gene expression levels showed different growth characteristics in the fruiting test. The growth rate of the wild-type strain was slower; the growth rate of the AbMYB11 overexpressed strains was faster and they had stronger environmental adaptability; compared with the wild-type, the overexpressed strains grew more lushly in the soil, and the number of mushrooms increased significantly, showing higher growth vitality and faster growth rate. While the AbMYB11 silenced strains showed a slow growth state and low yield.
[0149] Furthermore, the growth of Agaricus bisporus on the 46th and 47th days after sowing, i.e., the harvest period, was analyzed, see Figure 12 . The results show that there were significant differences in the mushroom size distributions of different strains. Under the same growth environment and at the same time point, the growth rate of the overexpressed strains was significantly higher than that of the wild-type strains, and the growth rate of the silenced strains was the slowest. At the mid-harvest period, i.e., on the 47th day after sowing, only 12.69% of the mushrooms of the control group YH26 wild-type strain were about 3 - 4 cm in size, and about 58.85% of the mushrooms were ≤ 1 cm in size. For the AbMYB11 overexpressed HF41 strain, 31.67% of the mushrooms were about 3 - 4 cm in size, and only 26.11% of the mushrooms were ≤ 1 cm in size. However, for the AbMYB11 silenced JD97 strain, only 9.49% of the mushrooms were about 3 - 4 cm in size, but 69.76% of the mushrooms were ≤ 1 cm in size. This indicates that the AbMYB11 overexpressed strains can significantly improve the growth rate of Agaricus bisporus. The Agaricus bisporus strains with overexpressed and silenced AbMYB11 showed obvious differences in the fruiting test and yield size statistics. The AbMYB11 gene has a significant impact on the growth of Agaricus bisporus. Overexpression of AbMYB11 promoted its growth-related metabolic pathways or signal transduction.
[0150] Example 7, Anti-browning experiment and disease resistance experiment
[0151] Harvest the fruiting bodies of Agaricus bisporus, select fresh Agaricus bisporus with intact, white, no mechanical damage, no disease spots, consistent size, and a diameter of 3 - 4 cm. Before treatment, cut off the stipe (retain about 0.5 cm) and place them neatly.
[0152] 1. Browning resistance experiment
[0153] Scratch treatment was performed on the Agaricus bisporus of each strain, and the browning situation was observed within 5 min, 10 min, and 30 min. These scratches were to simulate the damages that might be encountered during the natural growth process in order to better observe their browning resistance ability. The browning situation is shown in Figure 13 , and the results showed that in this browning resistance ability experiment, Agaricus bisporus strains with different AbMYB11 gene expression levels showed obvious browning differences. In the control group YH26, at 5 min, slight browning began to appear in the scratched area. At 10 min, the degree of browning increased and the color became darker. At 30 min, the degree of browning was significant and the color of the scratched area was significantly darker. Compared with the control group, in the AbMYB11 overexpression strain, at 5 min, the degree of browning of HF41 was lighter than that of YH26. At 10 min, the degree of browning was still lighter and the color change was not obvious. At 30 min, the degree of browning was significantly lighter than that of YH26 and the color change of the scratched area was smaller. JS59 was similar to HF41, and the degree of browning was lighter at 5 min and 10 min. At 30 min, the degree of browning was still lighter, showing good browning resistance ability. Compared with the control group in the AbMYB11 - silenced strain, at 5 min, the degree of browning of BK58 was similar to that of YH26. At 10 min, the degree of browning increased and the color became darker than that of YH26. At 30 min, the degree of browning was heavier and the color of the scratched area was significantly darker, showing significant browning compared with YH26. JD97 showed similar results to BK58, with a darker color at the scratched area and a relatively larger browning range, and these strains were relatively weak in browning resistance ability. Agaricus bisporus strains with strong browning resistance ability have broad application prospects in the edible mushroom industry. They can better maintain the quality and taste of mushrooms, extend the shelf life, and meet the needs of consumers for high - quality edible mushrooms.
[0154] 2. Disease resistance experiment
[0155] Purchase P. tolaasii (Accession No.: CGMCC 1.2960) from the China General Microbiological Culture Collection Center. After picking a single colony and culturing it with shaking at 28℃ until the logarithmic phase, perform an enlarged culture at a ratio of 1:10. After culturing to the logarithmic phase, centrifuge to collect the cells, and finally dilute the cell suspension concentration to 6×10 9CFU / mL. The fruiting bodies of Agaricus bisporus of each strain were randomly divided into two groups. One group was inoculated, and the other group was treated with water as a control, and stored at 4°C. Agaricus bisporus started to develop diseases at 24 h. The disease resistance of Agaricus bisporus with overexpression of AbMYB11 was significantly higher than that of Agaricus bisporus with silenced AbMYB11. The disease development is shown in Figure 14 , and the incidence rate is shown in Figure 15 . The results showed that after the inoculation treatment, as the control group, strain YH26 showed obvious disease symptoms within 36 h after the inoculation treatment, including browning, tissue softening, and loss of structural integrity, which provided a benchmark for evaluating the disease resistance of other genotype strains.
[0156] Compared with the control group, for the strain with overexpression of AbMYB11, at 24 h, the disease symptoms of HF41 were lighter than those of YH26, showing a certain degree of disease resistance. At 36 h, the disease development was slow and the degree of browning was lighter. At 48 h, although the disease had developed, it was still relatively light, showing better disease resistance compared with YH26. JS59 showed a similar disease resistance effect as HF41, indicating that the overexpression of AbMYB11 gene was related to the enhanced disease resistance, which could reduce the incidence rate of brown blotch during storage by about 20%. Compared with the control group, for the strain with silenced AbMYB11, at 24 h, the disease symptoms of BK58 were similar to those of YH26, showing poor disease resistance. At 36 h, the disease developed rapidly and the degree of browning was heavier. At 48 h, the disease symptoms of BK58 were very serious and the incidence rate was close to 100%. The disease symptoms of JD97 were similar to those of BK58 and the disease resistance was poor. This may mean that the silencing of AbMYB11 gene reduced the disease resistance of Agaricus bisporus. It was shown that the silencing of AbMYB11 gene generally reduced the disease resistance of Agaricus bisporus. The overexpression of AbMYB11 gene was positively correlated with the disease resistance of Agaricus bisporus, while the silencing of this gene was negatively correlated with the disease resistance. Agaricus bisporus strains with enhanced disease resistance may have higher value in commercial production because they can better resist diseases and reduce postharvest losses.
[0157] Although embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art can understand that various substitutions, changes, and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the content disclosed in the embodiments.
Claims
1. Use of a AbMYB11 gene in increasing the yield of Agaricus bisporus, where the AbMYB11 gene has the accession number XM_006459610.1 in the NCBI database and is labeled as hypothetical protein in the NCBI database.
2. An AbMYB11 application of a gene in promoting the growth, anti-browning, and enhancing the ability to resist brown spot disease of Agaricus bisporus, wherein the AbMYB11 sequence of the gene has the accession number: XM_006459610.1 in the NCBI database and is labeled as hypothetical protein in the NCBI database.
3. An AbMYB11 application of an overexpression vector in promoting growth, anti-browning, and enhancing the ability to resist brown spot disease of Agaricus bisporus, wherein the AbMYB11 overexpression vector is obtained by ligating AbMYB11 with the pCAMBIA1303 vector to construct a complete plasmid, and performing enzyme digestion verification and sequencing verification to obtain the correct plasmid; Among them, The AbMYB11 sequence of the gene has the accession number XM_006459610.1 in the NCBI database and is labeled as hypothetical protein in the NCBI database.
4. A high-yielding, growth-promoting, anti-browning and strong anti-brown spot disease Agaricus bisporus strain containing AbMYB11 an overexpression vector, wherein the AbMYB11 overexpression vector is obtained by ligating AbMYB11 with the pCAMBIA1303 vector to construct a complete plasmid, and performing restriction enzyme digestion verification and sequencing verification to obtain the correct plasmid; Among them, The said AbMYB11 The sequence of the gene has the accession number XM_006459610.1 in the NCBI database and is labeled as hypothetical protein in the NCBI database.
5. The method for constructing the Agaricus bisporus strain according to claim 4, characterized in that: When constructing, Agrobacterium-mediated transformation is used to transfer foreign genes into Agaricus bisporus.
6. The construction method according to claim 5, characterized in that: It includes the following steps: AbMYB11 Construction of overexpression vector: First, analyze the map of the pCAMBIA1303 vector, and replace the Ca MV35S promoter with AbGPD promoter, named pCAMBIA1303, to obtain the required empty vector; then overexpress the AbMYB11 gene and ligate it with the empty vector. After correct verification by restriction enzyme digestion and sequencing analysis, the pCAMBIA1303- AbMYB11 -OE, that is, AbMYB11 overexpression vector is obtained; Transfer the ligated plasmid into Agrobacterium and infect Agaricus bisporus, and then screen through resistance screening and AbMYB11 gene expression measurement; Select the target strain for fruiting test, and measure the anti-browning ability and disease resistance of the fruiting bodies of Agaricus bisporus. Finally, preserve the target strain with overexpression AbMYB11 gene and good growth to obtain the Agaricus bisporus strain.
7. The construction method according to claim 6, wherein: The screening includes two steps: primary screening and secondary screening. Strains with better-growing mycelia in the hygromycin-containing medium are selected as target strains; RNA of the target strains is extracted for AbMYB11 determination of gene expression levels.
8. The construction method according to claim 7, characterized in that: The two steps of primary screening and secondary screening are specifically as follows: Transfer the transformed tissue blocks to the primary screening MMP medium and culture at 24°C for 2 weeks; Pick the newly grown mycelia and transplant them to the secondary screening MMP medium and culture at 24°C for 2 weeks; Among them, the formula of the primary screening MMP medium is: Weigh 10.0 g of maltextract (malt extract), 5.0 g of mycological peptone (fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid), dissolve them thoroughly with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L; The final concentrations of antibiotics are: 30 μg / mL of hygromycin B, 200 μM of cefotaxime, 20 μg / mL of rifampicin, 50 μg / mL of kanamycin and ampicillin; The formula of the secondary screening MMP medium is: Weigh 10.0 g of maltextract (malt extract), 5.0 g of mycological peptone (fungal peptone), and 2.1 g of MOPS (3-(N-morpholino)propanesulfonic acid), dissolve them thoroughly with distilled water, adjust the pH to 7.0 with 1 M KOH, and make up the volume to 1 L; The final concentrations of antibiotics are: 50 μg / mL of hygromycin B, 17 μg / mL of tetracycline hydrochloride, 50 μg / mL of kanamycin and ampicillin.